ID: 930341820

View in Genome Browser
Species Human (GRCh38)
Location 2:50126025-50126047
Sequence GAACGAAGCAGAACAATAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930341817_930341820 20 Left 930341817 2:50125982-50126004 CCATTAGGAAATATGCTGTTTTA 0: 1
1: 0
2: 2
3: 33
4: 339
Right 930341820 2:50126025-50126047 GAACGAAGCAGAACAATAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 112
930341816_930341820 30 Left 930341816 2:50125972-50125994 CCTGTTTACTCCATTAGGAAATA 0: 1
1: 0
2: 1
3: 17
4: 181
Right 930341820 2:50126025-50126047 GAACGAAGCAGAACAATAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930341820 Original CRISPR GAACGAAGCAGAACAATAGC AGG Intronic
903584452 1:24400722-24400744 TAACGAACCAGAACACTAGTTGG + Intronic
903860302 1:26360665-26360687 GACCGTGGCAGAACAATGGCAGG - Intergenic
905678037 1:39843691-39843713 GGAAGAAGCAGAAGCATAGCTGG - Intronic
907104345 1:51867995-51868017 GATGGAAGGAGAACAATTGCTGG + Intronic
909069356 1:70975961-70975983 GAACCAAGCAGCATAATAGCAGG - Intronic
918169495 1:181982895-181982917 GAATGAAGCAGAGCAAGATCTGG - Intergenic
918981437 1:191565151-191565173 CACAGAAGCAGAACAGTAGCAGG - Intergenic
920633485 1:207676348-207676370 GAACTGAGCAGAACAGTAGGAGG + Intronic
921567866 1:216741944-216741966 GAAAGAAGCAGAAAAACAGAGGG - Intronic
922495567 1:226054764-226054786 GAAAGAAACAGCACTATAGCAGG + Intergenic
922510229 1:226159906-226159928 GTAAGAGGCAGAAGAATAGCTGG + Intronic
923874925 1:238036817-238036839 GACAGCAGCACAACAATAGCGGG + Intergenic
924580554 1:245320085-245320107 GAACAAATATGAACAATAGCTGG - Intronic
924606277 1:245538308-245538330 CAAGGAAGTAGAACAGTAGCTGG + Intronic
924746992 1:246845021-246845043 GAAAGAAGCAGAACAATGTGTGG + Intronic
1067780245 10:49197193-49197215 GGATGAAGCAAAAGAATAGCAGG + Intergenic
1071763963 10:88640882-88640904 GCACGTAGCAAAACAACAGCAGG + Intergenic
1072622643 10:97090205-97090227 GAAGGAAACAGAACAGGAGCAGG + Intronic
1073601819 10:104853307-104853329 AAACAAAACAGAACAAAAGCTGG + Intronic
1073704336 10:105965717-105965739 GAAGGAAGCAGAACAGTGGCTGG - Intergenic
1081260285 11:40951365-40951387 AAACTAAGAAGCACAATAGCAGG - Intronic
1081650599 11:44821444-44821466 CAAAGAAACAGAACAATCGCAGG - Intronic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1085930118 11:81071561-81071583 GAACAAATCAGAAAAACAGCAGG - Intergenic
1087333698 11:96815707-96815729 GAAAGAAGAATGACAATAGCTGG - Intergenic
1087639790 11:100744460-100744482 GAAGGAACCAGAAAAATAACTGG - Intronic
1087932774 11:103997914-103997936 GAAGGAAGTAGAAGTATAGCAGG - Intronic
1099416314 12:82391189-82391211 GAATGAGGCAGAACAAGAACTGG + Intronic
1101176125 12:102153500-102153522 GAAAGATGCAAAACATTAGCTGG - Intronic
1104264052 12:127213706-127213728 GATCGCAGCAGACCAATGGCAGG - Intergenic
1104281502 12:127382225-127382247 CAACGAAGCAGAACAATTCCAGG + Intergenic
1106764579 13:32901205-32901227 GAATGATGCAGAACAAAACCAGG - Intergenic
1106985521 13:35343547-35343569 GAACCAGGCAGCACAGTAGCGGG + Intronic
1110866419 13:80400958-80400980 GAACGCTGCAGAAGAAAAGCTGG - Intergenic
1112281022 13:98063365-98063387 CAAGGAAACAGAACAATAGAGGG + Intergenic
1118244189 14:64092756-64092778 GAACTAACCAGAACAATACCTGG - Intronic
1120434537 14:84464312-84464334 GAAGGAGGAAGAACAATAGGAGG + Intergenic
1121126551 14:91411000-91411022 GAACTGGGGAGAACAATAGCAGG - Intronic
1202890239 14_KI270722v1_random:149829-149851 CAAAGAAGAAGAACAATAGTTGG + Intergenic
1125348942 15:38747489-38747511 GAAAGAAGCACAACAAGGGCAGG - Intergenic
1127968968 15:63944347-63944369 GAAGGAAGCAGAAACATGGCTGG - Intronic
1129538083 15:76330382-76330404 GAAGAAAGCAGAACACTAGAAGG + Intergenic
1129882847 15:79018549-79018571 GAGCAAAGCAGAACCAAAGCAGG - Intronic
1133041437 16:3062253-3062275 GTATGAAGGAGAAGAATAGCTGG - Intergenic
1133041508 16:3062981-3063003 GTATGAAGCAGAAGAATAGCTGG - Intergenic
1133701209 16:8310851-8310873 AAAAAAAGCAGAACACTAGCTGG + Intergenic
1138306889 16:55985636-55985658 GACCAAGGCAGCACAATAGCGGG - Intergenic
1141262013 16:82462795-82462817 GAAAGAAACAGAACCATTGCTGG + Intergenic
1141393111 16:83681082-83681104 GAACCAAGCAGAAGATGAGCAGG + Intronic
1144049773 17:11488619-11488641 GAACAAAGCAGAACAAGAGATGG - Intronic
1152534854 17:80944605-80944627 AAAGGAAGCAGAAGAAAAGCAGG - Intronic
1155419459 18:25639154-25639176 GAGCGTAGCAGAACAATAGTGGG - Intergenic
1166246493 19:41530835-41530857 GAAATAAGCAGAACATCAGCTGG - Intergenic
1166246522 19:41531160-41531182 GAAATAAGCAGAACATCAGCTGG - Intergenic
1202665659 1_KI270708v1_random:116658-116680 CAAAGAAGAAGAACAATAGTTGG + Intergenic
926297655 2:11580284-11580306 GAAGGAAGCAGAACAGTTTCAGG + Intronic
930341820 2:50126025-50126047 GAACGAAGCAGAACAATAGCAGG + Intronic
932533484 2:72564946-72564968 GCACTAAGCAGAACAAAATCAGG + Intronic
932969196 2:76517795-76517817 GAACGATGTAGTACTATAGCTGG - Intergenic
933518083 2:83331481-83331503 GGACAGAGCAGAACAAAAGCTGG - Intergenic
935227142 2:101062425-101062447 GAACGAAGAAGAACTAAAGCAGG + Intronic
935331794 2:101982772-101982794 GAACTAAGCATAATATTAGCTGG - Intergenic
938196732 2:129335175-129335197 GAAGGAAACAGAACACCAGCAGG - Intergenic
939286969 2:140144286-140144308 GAAACAAGCAGAAAAATAGAAGG + Intergenic
939703140 2:145419569-145419591 GCAGGAAGCAGAATAATTGCAGG + Intergenic
940144912 2:150535775-150535797 GAACGATGCAGACAAATTGCTGG - Intronic
942796907 2:179831884-179831906 GCATGAATCAGAAAAATAGCAGG - Intronic
943566494 2:189523005-189523027 GAAGAAAACAGAACAAAAGCAGG - Intergenic
945217508 2:207449888-207449910 CAACAAAGCAGAATAATTGCTGG + Intergenic
947066788 2:226235768-226235790 GACTGAAGCAGAAGAATCGCTGG + Intergenic
1179809486 21:43861243-43861265 GAATGAGGCAGAAGAATTGCTGG + Intergenic
1180332373 22:11493581-11493603 CAAAGAAGAAGAACAATAGTTGG + Intergenic
1182960492 22:34467730-34467752 GACAGAAGCAGAACAGGAGCTGG + Intergenic
1183239822 22:36649390-36649412 GACTGAAGCAGAAGAATAACTGG - Intronic
1183687034 22:39367110-39367132 GAACGAAGCAGGGCAAGAGGAGG - Intronic
1185235739 22:49711886-49711908 GAACAAAGCAGAACATGAGATGG + Intergenic
949967189 3:9367355-9367377 GAAGAAAGCAGAGCAAAAGCAGG - Intronic
953226538 3:41026655-41026677 GAAGGAAACAGAACCACAGCGGG + Intergenic
956280053 3:67546632-67546654 GACTGAGGCAGAAGAATAGCTGG + Intronic
957090249 3:75722839-75722861 CAAAGAAGAAGAACAATAGTTGG - Intronic
960185844 3:114637871-114637893 GGAAGAAGCAGAACATAAGCTGG - Intronic
961192205 3:124971377-124971399 GAAAGAAGGAAAAAAATAGCTGG - Intronic
962638578 3:137358739-137358761 GAACCCAGTAGAATAATAGCTGG - Intergenic
963378218 3:144496668-144496690 CAAGGAAGCTGAACAATGGCTGG + Intergenic
968208027 3:196822009-196822031 GAAAGAAGCCGAACAACAGATGG + Intronic
970325633 4:14920544-14920566 GAAGCAACCAGAACAAGAGCTGG + Intergenic
972905530 4:43742297-43742319 TAAAGAAGAAGAAAAATAGCTGG - Intergenic
974512422 4:62861469-62861491 GAACAAAGCAGCAAAATAGGGGG + Intergenic
976858114 4:89628955-89628977 GAAACAAACTGAACAATAGCAGG + Intergenic
979150229 4:117303012-117303034 GAATAAAGCAAAACAATAGCAGG - Intergenic
979280717 4:118864548-118864570 GATCGAAATACAACAATAGCTGG - Intronic
981312932 4:143314378-143314400 GAAGGAAGCAGAATAATTCCTGG + Intergenic
982089175 4:151865599-151865621 AGAGGAAGCAGAACAAGAGCTGG + Intergenic
982849014 4:160288290-160288312 GAACTAAGCAGAACTATAAAAGG - Intergenic
983653142 4:170053405-170053427 GAAGGAAGCAGCAAAATAGTAGG - Intergenic
985619457 5:946449-946471 GAACGGTGCAGAACAATGCCTGG - Intergenic
994599016 5:101878245-101878267 GAAGAAAGCAGAACACTTGCTGG + Intergenic
995241912 5:109894777-109894799 AAACCCAGCAGAACTATAGCTGG + Intergenic
996522148 5:124438972-124438994 GAAGGAAACAGAACAATGGGGGG + Intergenic
997935961 5:138111358-138111380 GGCCAAAGCAGAAGAATAGCTGG + Intergenic
1001080658 5:168664966-168664988 GAGCAAGGCAGAACAAGAGCAGG + Intronic
1012589201 6:100959047-100959069 GAACGAAGCTAAACAATTGTGGG - Intergenic
1020427131 7:8080578-8080600 GAGAGAAGCAGAATAATATCTGG - Intronic
1021794717 7:24242514-24242536 GAATGAATTAGAACTATAGCTGG - Intergenic
1023026670 7:36056943-36056965 GAAAGAGGTAGAACAATAGGAGG - Intergenic
1028044292 7:86096122-86096144 GAAAGAGGCAGAACAATATTTGG - Intergenic
1029331937 7:99864499-99864521 TAACAAAGCAGAAGAATAACTGG - Intronic
1032353006 7:131183423-131183445 GAATGAAGGAGTACAATAGTGGG - Intronic
1032824273 7:135554021-135554043 GAACGAGGCTGAACCATATCAGG + Intergenic
1036569622 8:9968704-9968726 AAAGGAAACAGAACAATAGTGGG + Intergenic
1036642735 8:10594197-10594219 GATCGAGGCAGGACAATGGCTGG + Intergenic
1037778669 8:21852526-21852548 GAATGAGGCAGAAGAATTGCTGG + Intergenic
1038131258 8:24733999-24734021 GAACTAAGGAGAACATCAGCAGG + Intergenic
1050376265 9:4976530-4976552 TAATGAATAAGAACAATAGCAGG - Intergenic
1050429354 9:5546311-5546333 GAATGAAGTAGAACAAGAACAGG - Intronic
1057927474 9:99166097-99166119 GAGAGAAGCAGAACAAGAACAGG - Intergenic
1058596884 9:106624433-106624455 GAACAAAGCAGAAAAATAATAGG + Intergenic
1186804450 X:13126128-13126150 GACCGAGGCAGAAAGATAGCAGG - Intergenic
1187952588 X:24485518-24485540 CAACGCAGCAGACCAGTAGCGGG + Intronic
1188094433 X:26004112-26004134 GAAGGAACCAGAAAAATAACTGG + Intergenic
1195649699 X:107272101-107272123 GAAGGAAGGAAAAAAATAGCTGG + Intergenic
1197869381 X:131050932-131050954 GAAGGAAGATGAGCAATAGCGGG - Intergenic