ID: 930345010

View in Genome Browser
Species Human (GRCh38)
Location 2:50169309-50169331
Sequence TACCCATTGCTTGTTCTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 288}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930345010_930345018 9 Left 930345010 2:50169309-50169331 CCCATGAGAACAAGCAATGGGTA 0: 1
1: 0
2: 3
3: 19
4: 288
Right 930345018 2:50169341-50169363 AGTGGAAAAAGATAAATTCAGGG 0: 1
1: 0
2: 6
3: 137
4: 1468
930345010_930345012 -9 Left 930345010 2:50169309-50169331 CCCATGAGAACAAGCAATGGGTA 0: 1
1: 0
2: 3
3: 19
4: 288
Right 930345012 2:50169323-50169345 CAATGGGTACCTTGCCCCAGTGG 0: 1
1: 0
2: 1
3: 5
4: 102
930345010_930345017 8 Left 930345010 2:50169309-50169331 CCCATGAGAACAAGCAATGGGTA 0: 1
1: 0
2: 3
3: 19
4: 288
Right 930345017 2:50169340-50169362 CAGTGGAAAAAGATAAATTCAGG 0: 1
1: 0
2: 4
3: 47
4: 490
930345010_930345020 21 Left 930345010 2:50169309-50169331 CCCATGAGAACAAGCAATGGGTA 0: 1
1: 0
2: 3
3: 19
4: 288
Right 930345020 2:50169353-50169375 TAAATTCAGGGAAGTTTCTTGGG 0: 1
1: 1
2: 0
3: 30
4: 285
930345010_930345019 20 Left 930345010 2:50169309-50169331 CCCATGAGAACAAGCAATGGGTA 0: 1
1: 0
2: 3
3: 19
4: 288
Right 930345019 2:50169352-50169374 ATAAATTCAGGGAAGTTTCTTGG 0: 1
1: 1
2: 2
3: 42
4: 394

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930345010 Original CRISPR TACCCATTGCTTGTTCTCAT GGG (reversed) Intronic
900738577 1:4316380-4316402 AAGCCTCTGCTTGTTCTCATGGG - Intergenic
902127249 1:14225736-14225758 TCCCCATTGCTCGTTATTATTGG - Intergenic
902847704 1:19125087-19125109 TAACAATTTCTTGTTATCATGGG - Intronic
904117213 1:28171733-28171755 TACCCAGTGTTCCTTCTCATTGG + Intronic
906384081 1:45352364-45352386 TACCCTTTGCTTTTCCTTATGGG - Intronic
906565563 1:46798814-46798836 TACCCATTGCCTGTTTTTTTTGG + Intronic
906585404 1:46972202-46972224 TCCCCATTGCTTGTTTTGGTTGG + Intergenic
906941409 1:50258959-50258981 TACACAGTACTTGTTCCCATGGG + Intergenic
907852585 1:58270287-58270309 TCCCCATTGCTTGTTTTTCTCGG + Intronic
908112229 1:60908993-60909015 TTCCCTTTGCTTGTTCCCTTAGG - Intronic
908879896 1:68719493-68719515 TCCTCATTGCTTGTTTTTATCGG - Intergenic
909177969 1:72383737-72383759 TTACCATTGCTTGTTTTGATTGG - Intergenic
909460118 1:75902118-75902140 TACTCATTTCTTGTTCTTAAAGG + Intronic
910313384 1:85854227-85854249 TCCCCATTGCTTGTTATTATCGG + Intronic
912307459 1:108583866-108583888 TCCCCAATGTTTGGTCTCATTGG - Intronic
913473294 1:119212310-119212332 TCCCCATTGCTTGTTTTTGTTGG - Intergenic
913965320 1:143372290-143372312 GAGCCATTCCTTGTGCTCATTGG - Intergenic
914059696 1:144197892-144197914 GAGCCATTCCTTGTGCTCATTGG - Intergenic
914119454 1:144768479-144768501 GAGCCATTCCTTGTGCTCATTGG + Intergenic
915012018 1:152696375-152696397 TACCCATTGTTTCTTTTCCTGGG - Intergenic
916021990 1:160800759-160800781 TACCCATTGCTTCCACTTATAGG + Intronic
917037240 1:170762109-170762131 TCCCCATTGCTTGTTTTTGTCGG - Intergenic
917903486 1:179566828-179566850 TCCCCATTGCTTGTTTTTGTTGG + Intronic
918930744 1:190853395-190853417 TTCCCATTGCTTGTTTTTGTTGG + Intergenic
919354634 1:196505348-196505370 TCCCCATTGCTTGTTTTCTCAGG + Intronic
922639871 1:227218993-227219015 TAGCCAGTGTTTGTTCTGATTGG - Intronic
922896846 1:229107430-229107452 TTCCCTTTGCTTGTTCCCAGTGG - Intergenic
1063512926 10:6663822-6663844 TAGGCATTGCATGTTTTCATAGG + Intergenic
1064900695 10:20292674-20292696 TCCCCATTGCTTGTTTTTGTTGG + Intergenic
1065405657 10:25360514-25360536 TCCCCATTGCTTGTTTTTGTCGG + Intronic
1065463245 10:25991777-25991799 TCCCCATTGCTTGTTTTTGTCGG + Intronic
1068460631 10:57323826-57323848 TTCCCATTCCTTGTTCTCTCTGG + Intergenic
1068761175 10:60711110-60711132 TAACCATTACATGTTCTAATGGG + Intronic
1068906084 10:62324429-62324451 TCCCCATTGCTTGTTTTTGTCGG - Intergenic
1069057601 10:63860947-63860969 TACCCATTGGCTGTTACCATTGG + Intergenic
1069368385 10:67717581-67717603 TCCCCATTGCTTGTTTTTGTCGG + Intergenic
1071022714 10:81077663-81077685 TCCCCATTGCTTGTTATTTTTGG + Intergenic
1071199400 10:83201786-83201808 TTCCCATTGCTTGTTTTAGTTGG + Intergenic
1072953064 10:99865057-99865079 TCCCCATTGCTTGTTTTTGTGGG + Intergenic
1074363510 10:112840487-112840509 TAGCCTTCGCTTGTTCTCATTGG + Intergenic
1077946868 11:6909440-6909462 TCCCCATTGCTTGTTTTTGTTGG - Intergenic
1078028071 11:7718582-7718604 TTCCCATTGCTTGTTTTTGTTGG - Intergenic
1078278075 11:9870581-9870603 TCCCCATTGCTTGTTCTGTCAGG - Intronic
1079777263 11:24547445-24547467 TACCCACTGCTTGTTATTGTTGG - Intronic
1080237782 11:30092238-30092260 TACTGATTGCTTGATGTCATGGG - Intergenic
1081838991 11:46182126-46182148 TTCCCTTTGCTCGCTCTCATGGG - Intergenic
1084796567 11:71510007-71510029 TAACCATGGTTTGTTCTCCTTGG + Intronic
1085481633 11:76827669-76827691 TCCCCATTGCTTGTTTTTCTCGG + Intergenic
1085828291 11:79871656-79871678 TTCCCATTGCTTGTTTTTGTTGG - Intergenic
1086307825 11:85501146-85501168 TCCCCATTGCTTGTTTTTGTCGG - Intronic
1090600534 11:128365329-128365351 TACCACTTGCATCTTCTCATTGG + Intergenic
1093753270 12:22825813-22825835 TCCCCATTGCTTGTTTTTGTTGG + Intergenic
1093968380 12:25351336-25351358 TCCCCATTGCTTGTTTTTGTTGG - Intergenic
1095517852 12:43026912-43026934 TAGCAATTGCTTAATCTCATTGG - Intergenic
1096036041 12:48471606-48471628 TCCCCATTGCTTGTTTTTCTTGG + Intergenic
1097488868 12:60239496-60239518 TTCCCATTGCTTGTTTTTGTTGG - Intergenic
1098126965 12:67307001-67307023 TACCTTTTACTTGTTCTAATGGG - Intronic
1099164074 12:79280378-79280400 TCCCCAGTGTATGTTCTCATCGG - Intronic
1099324396 12:81195666-81195688 TCCCCCTTCCTTGTTCTCAAAGG + Intronic
1099563735 12:84213375-84213397 AACCCATTGCTTGTGCTGTTGGG - Intergenic
1101263577 12:103060701-103060723 TCCCCATTGCTTGTTTTTGTTGG - Intergenic
1107440020 13:40418125-40418147 TCCCCATTGCTTGTTTTTGTCGG - Intergenic
1108132293 13:47315681-47315703 TCCCCATTGCTTTTTCTTGTTGG + Intergenic
1108160833 13:47637169-47637191 TCCCCATTGCTTGTTTTTGTCGG - Intergenic
1108985114 13:56576940-56576962 TCCCCATTGCTTGTTTTCTCAGG - Intergenic
1109461985 13:62672887-62672909 TTCCCATTGCTTGTTTTTGTTGG + Intergenic
1109467957 13:62763416-62763438 TCCCCATTGCTTGTTTTTGTCGG - Intergenic
1110128931 13:71982218-71982240 TCCCCATTGCTTGTTTTTGTTGG + Intergenic
1110977682 13:81861439-81861461 TCCTCATTGCTTGTTTTTATCGG - Intergenic
1111044178 13:82793812-82793834 TACCCAGTGGTTGTACTCCTAGG + Intergenic
1114368454 14:22056887-22056909 TCCCCATTGCTTGTTTTCCTTGG - Intergenic
1114833528 14:26175376-26175398 TACCCATTTCCCCTTCTCATGGG + Intergenic
1115043420 14:28958992-28959014 TCCCCATTGCTTGTTTTTCTTGG - Intergenic
1115623346 14:35164033-35164055 TCCCCATTGCTTGTTTTTGTTGG + Intronic
1116196706 14:41736538-41736560 TACACATTGCCTGTTCACTTCGG + Intronic
1117857105 14:60046536-60046558 TCCCCATTGCTTGTTTTTGTTGG + Intronic
1118264696 14:64283832-64283854 TACCCATTGTTTTTTATTATTGG - Intronic
1118572756 14:67210260-67210282 TGCCCATGGCTTTTTCTAATGGG - Intronic
1120058885 14:79958426-79958448 TCCCCATTGCTTGTTTTTGTCGG - Intergenic
1120064393 14:80023314-80023336 TTCCCATTGCTTGTTATTATTGG + Intergenic
1120184451 14:81379722-81379744 TCCCCATTGCTTGTTATTGTTGG - Intronic
1122970532 14:105150385-105150407 TGGCCATTGCTTGTTGTGATGGG - Intronic
1123952731 15:25298608-25298630 TCCCCATTGCTTGTTTTTCTCGG - Intergenic
1126612395 15:50542836-50542858 TAGCTATTAATTGTTCTCATTGG - Intronic
1130001121 15:80047777-80047799 TACCCATTGCTTTGCCCCATGGG - Intergenic
1130728269 15:86463703-86463725 TCCCCATTGCTTGTTTTTGTCGG + Intronic
1131926971 15:97395472-97395494 TCCCCATTGCTTGTTTTTGTCGG + Intergenic
1132057254 15:98661765-98661787 TATCTATTGCTAATTCTCATTGG - Intronic
1134424168 16:14123544-14123566 TCCCCATTGCTTGTTTGTATAGG + Intronic
1137079396 16:36027557-36027579 TCCCCATTGCTTGTTTTTCTCGG + Intergenic
1139135749 16:64202674-64202696 TAGCAATTGTATGTTCTCATGGG + Intergenic
1139263133 16:65614523-65614545 TACCCATTGCTTATTTTTGTTGG + Intergenic
1140749465 16:78010117-78010139 AACACATTGCTTTTTCTCAGAGG - Intergenic
1140978762 16:80085957-80085979 TGTCCATTGGTTGTACTCATGGG + Intergenic
1141204532 16:81923391-81923413 TACCATTTGGTTCTTCTCATTGG - Intronic
1143590603 17:7884500-7884522 TCCCCCTTTCTTGTTCTCTTGGG + Intronic
1150894124 17:69189785-69189807 TCCCCATTGTTTGTTTTCACTGG + Intronic
1151060994 17:71094302-71094324 TCCCCATTGCTTGTTTTTGTCGG - Intergenic
1153226074 18:2901054-2901076 CATCCATTGCTTGGTCTGATTGG + Intronic
1153582352 18:6587024-6587046 TCCCCATTGCTTGTTTTTGTTGG - Intronic
1153717414 18:7864460-7864482 TCCCCATTGCTTGTTTTTCTTGG + Intronic
1156540838 18:37908563-37908585 TACCCATTGCTTGTTTTTGTTGG - Intergenic
1157062811 18:44312535-44312557 TCCCCATTGCTTGTTTTTGTCGG + Intergenic
1157073720 18:44440869-44440891 TCCCCATTGCTTGTTGTTGTTGG - Intergenic
1159438050 18:68443751-68443773 TCCCCATTGCTTGTTTTTCTCGG - Intergenic
1159468977 18:68824316-68824338 TTCCCATTGCTTGTTTTTGTTGG + Intronic
1161137120 19:2626389-2626411 AACCAATTGATTGTTGTCATGGG + Intronic
1161879000 19:6934011-6934033 CAGCCTTTGCTTGTTCTCAATGG - Intronic
1166360273 19:42250243-42250265 GACCCAATGCTTGTTCCCACAGG + Intronic
1168030846 19:53678471-53678493 TAGGCATTGCTTTTTCTCTTTGG + Intergenic
1168031230 19:53681603-53681625 TAGGCATTGCTTTTTCTCTTTGG + Intergenic
1168031683 19:53684775-53684797 TAGGCATTGCTTTTTCTCTTTGG + Intergenic
1168032334 19:53690642-53690664 TAGGCATTGCTTTTTCTCTTTGG + Intergenic
1168032767 19:53694156-53694178 TAGGCATTGCTTTTTCTCTTTGG + Intergenic
1168033230 19:53698150-53698172 TAGTCATTGCTTTTTCTCTTTGG + Intergenic
1168037379 19:53730771-53730793 TAGGCATTGCTTTTTCTCTTTGG + Intergenic
1168040158 19:53752161-53752183 TAAGCATTGCTTTTTCTCTTTGG + Intergenic
1168420955 19:56203043-56203065 GTCCCATTGCTTGTTTTAATGGG + Intronic
1168430029 19:56271368-56271390 TAGCCTTTGCTTGTTTTCATTGG + Intronic
1202699099 1_KI270712v1_random:149778-149800 GAGCCATTCCTTGTGCTCATTGG - Intergenic
925192436 2:1895586-1895608 TCCCCACTGCTTGTTCTCATTGG - Intronic
925432820 2:3810843-3810865 TCCCCATTGCTTGTTTTTGTTGG + Intronic
925464081 2:4090406-4090428 TACCCATTGTCTGTTGTGATGGG + Intergenic
927070232 2:19521075-19521097 TCCCCATTGCTTGTTTTTGTGGG - Intergenic
927180326 2:20441846-20441868 TGCCCATTGCCTGTTCCCCTCGG + Intergenic
928765461 2:34640192-34640214 TCCCCATTGCTTGTTTTTGTTGG - Intergenic
929336837 2:40758569-40758591 TTCCCATAGCTTGCTCACATTGG + Intergenic
929796256 2:45060821-45060843 TCCCCATTGCTTGTTTTTCTCGG + Intergenic
930345010 2:50169309-50169331 TACCCATTGCTTGTTCTCATGGG - Intronic
930433683 2:51313969-51313991 TCCCCATTGCTTGTTTTCTGAGG + Intergenic
930930742 2:56878901-56878923 TCCCCATTGCTTGTTTTTGTCGG - Intergenic
931846662 2:66211100-66211122 TCCCCATTGCTTGTTTTCTCAGG - Intergenic
932977421 2:76620471-76620493 TCCCCATTGCTTGTTTTTGTTGG + Intergenic
933201782 2:79458979-79459001 TATCCATTTCTTTTTTTCATGGG - Intronic
937399862 2:121572871-121572893 TACCCTTTCCCTTTTCTCATTGG - Intronic
937782060 2:125849954-125849976 TACCCATTGCCTGTTTTTGTTGG + Intergenic
939133068 2:138261262-138261284 TCCCCATTGCTTGTTTTTGTCGG + Intergenic
940254201 2:151712172-151712194 TACCTCTTGCTTGTTGTCAAAGG + Intronic
940812515 2:158261246-158261268 TCCCCATTACTTGTTTTCGTTGG - Intronic
941015014 2:160345743-160345765 TTTCCAGTGCTTGTTCTGATTGG + Intronic
941673873 2:168323621-168323643 TTCCCACTGTTTGTTCTCACAGG + Intergenic
941709924 2:168701156-168701178 TACTCATTACATGTTATCATTGG - Intronic
942801633 2:179882839-179882861 TACTCATAGCTTCTACTCATTGG + Intergenic
942832476 2:180253349-180253371 TCCCCATTGCTTGTTTTTGTCGG - Intergenic
943264163 2:185705706-185705728 TCCCCATTGCTTGTTTTTGTTGG + Intergenic
945164794 2:206931586-206931608 TTCCCATTGCTTGTTTTTGTTGG - Intergenic
945830899 2:214783746-214783768 TCCCCATTGCTTGTTTTGTTAGG - Intronic
1170495330 20:16918171-16918193 TTCCCAGTACATGTTCTCATGGG - Intergenic
1171098535 20:22358029-22358051 TCCCCATTGCTTGTTTTTGTTGG - Intergenic
1173695660 20:45009299-45009321 TACCCATTGCTTGTTTTTGTTGG + Intronic
1176909002 21:14540019-14540041 TCCCCATTGCTTGTTTTCTCAGG - Intronic
1177133594 21:17286605-17286627 TCCCCATTGCTTGTTTTTGTTGG - Intergenic
1178033951 21:28559852-28559874 GCCCCATTGCTTGTTTTCTTTGG - Intergenic
1178128019 21:29536891-29536913 TCCCCATTACTTGCTCCCATTGG - Intronic
1181065235 22:20302705-20302727 CATCCATTGCCTGTTCTCCTGGG + Intergenic
1184031472 22:41897432-41897454 CACTCATTGCTTGTTCTTCTGGG - Intronic
1184115529 22:42419706-42419728 TACCCATTCCTTCCTCTCCTGGG + Intronic
1184572926 22:45337970-45337992 TACCCGTTGCTTTTTTTCCTGGG + Intronic
949393707 3:3591957-3591979 TCCCCATTGCTTGTTTTGGTTGG - Intergenic
952501427 3:33965954-33965976 TCCCCATTGCTTGTTTTTGTCGG + Intergenic
952574002 3:34752512-34752534 TCCCCATTGCTTGTTTTTGTTGG - Intergenic
952686875 3:36160252-36160274 CATGCATTGCTTGTACTCATAGG + Intergenic
953544012 3:43848418-43848440 TCCCCATTGCTTGTTTTTGTTGG - Intergenic
956359253 3:68429093-68429115 TCCCCATAGCTCTTTCTCATGGG + Intronic
957254718 3:77822102-77822124 TTCCCATTGCTTGTTTTTCTTGG + Intergenic
957358142 3:79118050-79118072 TACCCATGGCTTGTGCTCACTGG + Intronic
958649745 3:96923892-96923914 TCCCCATTGCTTGTTTTAGTCGG + Intronic
960559668 3:119069934-119069956 TACCCATTGCTTTTTCTTACAGG - Intronic
960762766 3:121092039-121092061 TCCCCATTGCTTGTTTTTCTCGG + Intronic
962001081 3:131297927-131297949 TCCCCATTGCTTGTTTTTCTCGG + Intronic
963019802 3:140862027-140862049 TTCCCATTGCTTGCTTTCATCGG - Intergenic
963460974 3:145614770-145614792 TCCCCATTGCTTGTTTTGGTCGG + Intergenic
964241070 3:154595348-154595370 TCCCCATTGCTTGTTTTCTCAGG + Intergenic
964678248 3:159307836-159307858 TCCCCATTGCTTGTTTTTGTTGG + Intronic
966629067 3:182051760-182051782 TATCCATTGCATTTTCTCCTAGG + Intergenic
966654861 3:182344770-182344792 TTCCCATTGCTTGTTTTTGTTGG + Intergenic
966970058 3:185036487-185036509 TCCCCATTGCTTGTTTTTGTTGG - Intronic
970475824 4:16421870-16421892 TCCCCATTGCTTGTTTTCTCAGG - Intergenic
971739813 4:30504842-30504864 TCCCCATTGCTTGTTTCCGTTGG + Intergenic
971740654 4:30516288-30516310 TCCCCATTGCTTGTTTTTGTCGG - Intergenic
973722506 4:53739513-53739535 TCCCCATTGCTTGTTTTCTCAGG - Intronic
974152223 4:58024541-58024563 TCCCCATTGCTTGTTTTTCTTGG + Intergenic
975664075 4:76716785-76716807 TAACCATTGCTGTTTCTTATGGG + Intronic
977100513 4:92807296-92807318 TACCCTTTGCTTATTTTCAGAGG + Intronic
977528842 4:98175881-98175903 TGCCCATTGCTTTTCATCATAGG + Intergenic
978649339 4:110981489-110981511 TATCAATTTCTTCTTCTCATTGG + Intergenic
980243993 4:130213906-130213928 TACTTATTGCCTTTTCTCATAGG + Intergenic
980718683 4:136663069-136663091 TTCCCTTTGCTGTTTCTCATAGG - Intergenic
981069559 4:140520753-140520775 TCCCCATTGCTTGTTTTTCTCGG - Intergenic
981152924 4:141399755-141399777 TCCCCATTTCTTGTTTTTATCGG + Intergenic
981757463 4:148155989-148156011 TCCCCATTGCTTGTTTTCCTCGG - Intronic
981825926 4:148941610-148941632 AACCCATTGGTTCTTATCATGGG + Intergenic
981878401 4:149577494-149577516 TCCCCATTGCTTGTTATTGTTGG + Intergenic
982686063 4:158490357-158490379 TCCCCATTGCTTGTTTTTGTAGG + Intronic
982764332 4:159326697-159326719 TACCAATTGCCTGGTATCATAGG - Intronic
982838397 4:160152434-160152456 TCCCCATTGCTTGTTTTTCTCGG + Intergenic
983030733 4:162798615-162798637 TCCCCATTGCTTGTTTTTGTAGG + Intergenic
983169213 4:164516859-164516881 TCCCCATTGCTTGTTTTTGTTGG + Intergenic
983371596 4:166866158-166866180 TCCCCATTGCTTGTTTTTGTAGG - Intronic
983560335 4:169095069-169095091 TATCCATTCCTTGATGTCATTGG - Exonic
984592134 4:181628597-181628619 TCCCCATTGCTTGTTTTTGTCGG + Intergenic
985301033 4:188489795-188489817 TTCCCATTGCTTGTTTTTGTTGG + Intergenic
985317866 4:188677589-188677611 TCCCCATTGCTTGTTTTTGTCGG - Intergenic
985985899 5:3516018-3516040 TTACTATTGCTTGTTCTCATGGG - Intergenic
986550929 5:8954396-8954418 TACCTAGTGCCTGTTCTTATTGG - Intergenic
986694504 5:10339795-10339817 TAGCCTTTGCTTGTTCTCATTGG - Intergenic
986883403 5:12204089-12204111 TCTCCATTGCTTGTTTTCACAGG + Intergenic
989320903 5:40132677-40132699 TCTCCATTGCTTTTTCTCACAGG - Intergenic
989455866 5:41643396-41643418 TCCCCATTGCTTGTTTTTGTTGG - Intergenic
989858987 5:46341628-46341650 TCCCCATTGCTTGTTTTCTCAGG + Intergenic
990161139 5:52942039-52942061 TCCCCATTGCTTGTTTTTGTTGG + Intronic
990175682 5:53105452-53105474 TCCCCATTGCTTGTTTTTGTAGG - Intronic
990642336 5:57800957-57800979 TCCCCATTGCTTGTTTTTGTTGG + Intergenic
992846223 5:80751396-80751418 TCCCCATTGCTTGTTTGTATCGG - Intronic
993655422 5:90572558-90572580 TCCCCATTGCTTGTTTTTGTTGG - Intronic
993655531 5:90573913-90573935 TCCCCATTGCTTGTTTTTGTTGG + Intronic
993862682 5:93155596-93155618 TACCCAGAGCTCTTTCTCATTGG - Intergenic
994259810 5:97643972-97643994 CCCCCATTGCTTGTTTTTATTGG - Intergenic
994802649 5:104398647-104398669 TCCCCATTGCTTGTTTTTGTTGG - Intergenic
996331367 5:122332814-122332836 CTCCCATTGCTTGTTCTAATGGG - Intronic
997997442 5:138597904-138597926 TTCCCAATGCTCGTTGTCATTGG - Intergenic
998192629 5:140040450-140040472 TACACATTGTTTGTTCTAGTGGG - Intronic
998805020 5:145910006-145910028 TTCCCATTGCTCTTACTCATTGG + Intergenic
999033324 5:148319022-148319044 TCCCCATTGCTTGTTTTTGTCGG + Intergenic
999531118 5:152464487-152464509 AAGCCTTTGCTTGTTCTCGTTGG - Intergenic
999986644 5:157011915-157011937 TCCCCATTGCTTGTTTTTGTCGG - Intergenic
1000995611 5:167955731-167955753 TCCCCATTGCTTGTTTCCATCGG + Intronic
1004091017 6:12501631-12501653 TACCCATTGTTTGTTTTTGTTGG - Intergenic
1004333989 6:14747414-14747436 TATTGATTGCTTATTCTCATGGG - Intergenic
1005151899 6:22761280-22761302 TTCCCATTGCTTGTTTTTGTCGG + Intergenic
1008017124 6:46533051-46533073 TCCCCATTGCTTGTTTTTCTCGG - Intergenic
1008575055 6:52852298-52852320 TCCCCATTGCTTGTTTTTGTTGG + Intronic
1008935926 6:56992269-56992291 TACAAATTTCTTGTTCTCACAGG - Intronic
1009189361 6:60611193-60611215 TCCCCATTGCTTGTTTTTGTTGG + Intergenic
1009273393 6:61644182-61644204 TCCCCATTGCTTGTTTTTGTTGG - Intergenic
1010501237 6:76602930-76602952 TTCCCATTGCTTGTTTTCTCAGG - Intergenic
1011106963 6:83792813-83792835 TCCCTATTGCTTGTTTTTATTGG - Intergenic
1012481476 6:99672057-99672079 TCCCCATTGCTTGTTTTTGTCGG + Intergenic
1012810542 6:103951343-103951365 TCCTCACTGCTTGTTTTCATTGG + Intergenic
1014374030 6:120649917-120649939 TCCCCATTGCTTGTTTTTGTTGG - Intergenic
1014872174 6:126610264-126610286 TCCCCATTGCTTGTTTTTGTAGG + Intergenic
1015136540 6:129878540-129878562 TCCCCATTGCTTGTTTTTGTCGG + Intergenic
1016297671 6:142591997-142592019 TCTCTATTGCTTGTTTTCATTGG + Intergenic
1017935840 6:159004087-159004109 TCTCCATTGCTTTTTCTGATTGG - Intergenic
1018356632 6:163024337-163024359 TCCCCATTGCTTGTTTTCATTGG + Intronic
1018532562 6:164783223-164783245 TCCCCATTGCTTGTTTTTCTTGG + Intergenic
1019099340 6:169615512-169615534 TCCCCATTGCTTGTTTTTGTCGG - Intronic
1020348981 7:7197305-7197327 TCCCCATTGCTTGTTTTTGTCGG + Intronic
1023793808 7:43774402-43774424 TCCCCATTGCTTGTTTTTGTCGG + Intronic
1024168972 7:46764677-46764699 TGGCCTTTGCCTGTTCTCATTGG + Intergenic
1024452837 7:49567936-49567958 TCCCTATTGCTTGTTTTTATTGG - Intergenic
1025784187 7:64629186-64629208 TCCCCATTGCTTGTTTTTTTAGG - Intergenic
1026252715 7:68684923-68684945 TGCCCGTTGCTTCTTCTCAATGG + Intergenic
1028019797 7:85755989-85756011 TCCCCGTTGCTTGTTTTTATCGG - Intergenic
1029014293 7:97298865-97298887 TACTCATTGCTTCTTTTCATAGG - Intergenic
1030961537 7:115929407-115929429 TCCCCATTGCTTGTTTTTGTCGG - Intergenic
1032394218 7:131577545-131577567 TCCCCAGTGTTTGTCCTCATAGG - Intergenic
1036097464 8:5739852-5739874 TCCCCATTGCTTGTTTTTGTCGG + Intergenic
1037095496 8:14981463-14981485 TTCCCTTTGATTTTTCTCATAGG - Intronic
1037191513 8:16131745-16131767 TTCCTATTGCTTGTTTTTATCGG + Intronic
1040957815 8:52997310-52997332 TAAACATGGCTTGTCCTCATGGG + Intergenic
1041628808 8:60061729-60061751 TACCCAGTGCTTGGACTCACTGG - Intergenic
1043272810 8:78355376-78355398 TCCCCATTGCTTGTTTTCTCAGG - Intergenic
1043452831 8:80385249-80385271 TCCCCATTGCTTGTTTTCTCAGG + Intergenic
1043804116 8:84649544-84649566 TCCCCATTGCTTGTTTTTCTCGG + Intronic
1043832594 8:85007531-85007553 TCCCCATTGCATCTTCACATAGG - Intergenic
1045207810 8:100061043-100061065 TCCCCATTGCTTGTTTTTGTTGG - Intronic
1046091859 8:109512459-109512481 TCCCCATTGCTTGTTTTTCTCGG + Intronic
1046637750 8:116691124-116691146 TAACCAATGTTTGCTCTCATTGG - Intronic
1046797792 8:118391555-118391577 TGCCCAGTGCCTGTTCTCTTTGG - Intronic
1047043009 8:121019488-121019510 AACCCATTTGTTCTTCTCATGGG + Intergenic
1048894213 8:138974880-138974902 TAGCCTTTGTTTTTTCTCATTGG - Intergenic
1050233938 9:3558132-3558154 TCCCCATTGCTTGTTTTTGTCGG + Intergenic
1050923706 9:11236875-11236897 TCCCCATTGCTTGTTTTTGTTGG + Intergenic
1052701982 9:31949014-31949036 TCCCCATTGCTTGTTTTTGTTGG - Intergenic
1055572227 9:77628615-77628637 TCCCCATTGCTTGTTTTTGTCGG - Intronic
1056315328 9:85383271-85383293 TATTCATTTCTTGTTTTCATAGG + Intergenic
1056863483 9:90208954-90208976 TCCCCATTGCTTGTTTTTGTCGG + Intergenic
1057561830 9:96133866-96133888 TAGCCTTTGCTTGTTCTCTTTGG + Intergenic
1059608169 9:115859149-115859171 TCCCCATTGCTTGTTTTTGTCGG + Intergenic
1059822914 9:117993960-117993982 TTCACATTGCATGTTCTCAAAGG + Intergenic
1186659295 X:11652398-11652420 TACCCATTGCTTGTTTTTGTTGG - Intronic
1187513223 X:19941535-19941557 TCCCCATTGCTTGTTTTTCTCGG + Intronic
1187554279 X:20336650-20336672 TCCCCATTGCTTGTTTTTCTCGG - Intergenic
1187562557 X:20416396-20416418 TCCCCATTGCTTGTTTTTCTCGG - Intergenic
1187876875 X:23811562-23811584 TTCCCATTGGTTGTTCTGGTTGG - Intergenic
1188506557 X:30889810-30889832 AACCCTTTGCTTGTCCTTATGGG + Intronic
1188672202 X:32893936-32893958 CACCCAGTGCATGTTTTCATAGG - Intronic
1188790288 X:34401093-34401115 TCCCCATTGCTTGTTTTTGTTGG - Intergenic
1188856431 X:35201720-35201742 TAGCCTTTGGTTATTCTCATGGG - Intergenic
1189872901 X:45403547-45403569 TCCCCATTGCTTGTTTTTGTCGG - Intergenic
1190548182 X:51551635-51551657 TCCCCATTGCTTGTTTTTCTCGG + Intergenic
1191630885 X:63320776-63320798 TCCCCATTGCTTGTTTTTGTTGG - Intergenic
1191817222 X:65259291-65259313 TCCTCATTGCTTGTTTTCATTGG - Intergenic
1192692535 X:73379583-73379605 TCCCCATTGCTTGTTTTTGTTGG - Intergenic
1193439780 X:81525396-81525418 TCCCCATTGCTTGTTTTTGTTGG + Intergenic
1193663412 X:84285078-84285100 TCCCCATTGCTTGTTTTTGTTGG + Intergenic
1193767346 X:85546082-85546104 TCCCCATTGCTTGTTTTTGTTGG + Intergenic
1193854802 X:86586687-86586709 TCCCCATTGCTTGTTTTTGTTGG + Intronic
1194022073 X:88703224-88703246 TCCCCATTGCTTGTTTTTATGGG - Intergenic
1194126588 X:90025637-90025659 TCCCCATTGCTTGTTATTGTTGG - Intergenic
1194927387 X:99841757-99841779 TCCCCATTGCTTGTTTTTGTCGG - Intergenic
1196075726 X:111573820-111573842 TCCCCATTGCTTGTTTTTGTCGG + Intergenic
1197702331 X:129608677-129608699 TCCCCTTTAGTTGTTCTCATAGG + Intergenic
1197749550 X:129955117-129955139 CACCCCTTGCTAGTTCTCTTGGG - Intergenic
1198930191 X:141849156-141849178 TCCCCACTGCTTGTTTTCGTTGG - Intronic
1199207517 X:145165872-145165894 TCCCCATTGCTTGTTTTTGTCGG - Intergenic
1201699396 Y:16863637-16863659 TCCCCATTGCTTGTTTTTGTTGG - Intergenic
1201991860 Y:20035815-20035837 TCCCCATTGCTTGTTTTTCTTGG - Intergenic
1202350194 Y:23981575-23981597 TCCCCATTGCTTGTTTTTCTTGG + Intergenic
1202520585 Y:25688546-25688568 TCCCCATTGCTTGTTTTTCTTGG - Intergenic