ID: 930345190

View in Genome Browser
Species Human (GRCh38)
Location 2:50171177-50171199
Sequence GAAGAAACTCTATGTATAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 956
Summary {0: 1, 1: 6, 2: 66, 3: 221, 4: 662}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930345190 Original CRISPR GAAGAAACTCTATGTATAAG TGG Intronic
900669898 1:3845238-3845260 GAAGTAAATCTATTTATAATGGG - Intronic
900912178 1:5606266-5606288 AAGGAAAATCCATGTATAAGTGG + Intergenic
902492247 1:16791795-16791817 GAGGAAAATCTGTGTATAAGTGG + Intronic
903074302 1:20750656-20750678 GAAGAAAATCCACATATAAGTGG - Intronic
903355573 1:22745017-22745039 GAAGAAAGTCCAAGCATAAGTGG + Intronic
904463984 1:30697224-30697246 GAAAAAACTCTAGGTAGATGTGG + Intergenic
904801507 1:33096313-33096335 GAAGAAAATCCATGCATAAGTGG + Intronic
905675917 1:39825028-39825050 GAAAAAAATCTGTGTCTAAGTGG + Intergenic
905753545 1:40487265-40487287 GAAAAAAGTCTATATAGAAGTGG - Intronic
906229053 1:44145203-44145225 GAAGAAAATATAGTTATAAGTGG + Intergenic
906870009 1:49468124-49468146 GAAAACAATCTGTGTATAAGTGG - Intronic
907020644 1:51063761-51063783 GAAGAAGATCTGTGTATAAGTGG - Intergenic
907166070 1:52412510-52412532 GTAGAAACGCTATGTATTAGAGG + Exonic
907674412 1:56505477-56505499 GAAGAAAATTTGTGTTTAAGTGG - Intronic
907713702 1:56908132-56908154 GAAGAAACTCTACGTCCATGAGG + Intronic
907839814 1:58145876-58145898 GAAGAAAATCTATGTGTAAGTGG - Intronic
907878957 1:58525307-58525329 AAAAAAATCCTATGTATAAGTGG + Intronic
908963050 1:69725308-69725330 GAAGAAAATCCACGTTTAAGTGG + Intronic
909107773 1:71434077-71434099 AAAAAAAATCTATGTATAAGTGG - Intronic
909142566 1:71887291-71887313 GAAGAAAATCCAAGTATAAGTGG + Intronic
909614140 1:77587765-77587787 GAAGAAAATTTGTGTATAAGTGG - Intronic
909835355 1:80247855-80247877 GAAGAAAATTTAAGTATAAATGG + Intergenic
910892054 1:92028805-92028827 GAAGAAAATCCATGTGTAAGTGG - Intergenic
911217764 1:95214752-95214774 GAAGAAACTGTATTAATTAGCGG - Intronic
911228909 1:95338951-95338973 GAAAAAAGTCTGTGTATAAGTGG + Intergenic
912032045 1:105260604-105260626 GAAGAAAATCCACATATAAGTGG + Intergenic
912279141 1:108294892-108294914 GCAAAAAATCTTTGTATAAGTGG + Intergenic
912289085 1:108399465-108399487 GCAAAAAATCTTTGTATAAGTGG - Intronic
913127051 1:115801485-115801507 GAAGAAAATCTAAGTATAAGTGG - Intergenic
913692766 1:121295111-121295133 GAAGATACTCTAGGAAAAAGGGG + Intronic
914144793 1:144984977-144984999 GAAGATACTCTAGGAAAAAGGGG - Intronic
914462092 1:147894505-147894527 GAAGAACACCTGTGTATAAGTGG - Intergenic
914785077 1:150822196-150822218 GAAAAAAATCCATGTATAAGTGG + Intronic
915834114 1:159160784-159160806 AAAAAAAATCCATGTATAAGTGG + Intergenic
915852112 1:159335629-159335651 GAAAAAAATCCATGTATAAGTGG + Intergenic
916286754 1:163114633-163114655 GAAGAAATTATATGTAGTAGGGG - Intronic
916726868 1:167531487-167531509 GAAGAAAATCCATGCATAAGTGG + Intronic
917566542 1:176218190-176218212 AAAAAAAATCCATGTATAAGTGG - Intergenic
917736734 1:177928078-177928100 GAATAAAATCCAAGTATAAGTGG + Intronic
917824474 1:178802973-178802995 GAAAAAAATCTGTGTATGAGTGG + Intronic
918515139 1:185355153-185355175 AAAAAAAATCTGTGTATAAGTGG + Intergenic
918999876 1:191816673-191816695 GAAGAAAATCCATGCCTAAGTGG - Intergenic
919035670 1:192305508-192305530 GAAAAAAATCTAAGTATAAGTGG - Intergenic
919162149 1:193844157-193844179 GAAGAAAGTCTAAGTAAATGGGG + Intergenic
919191994 1:194232246-194232268 GAAGAAAATTCATGTATAAGTGG + Intergenic
919314777 1:195957693-195957715 AAAAAAAGTCTATGTATAAATGG + Intergenic
919458985 1:197854472-197854494 GAAGAAAATCCAAGTATAAGTGG + Intergenic
919494313 1:198245246-198245268 GAAGAAAATCTACATATAAGTGG + Intronic
919507046 1:198412301-198412323 GAAGAAAATCCATGGATAAGTGG + Intergenic
919629563 1:199946917-199946939 GAAGAACAGCTATTTATAAGGGG - Intergenic
920151534 1:203912782-203912804 AAAAAAAATCTATGTATAAGGGG - Intergenic
920480085 1:206313476-206313498 GAAGATACTCTAGGAAAAAGGGG + Intronic
920533524 1:206722638-206722660 GAAGAAAATCCCTGTATAAATGG + Intronic
920915453 1:210254520-210254542 CAAGTTACTCTTTGTATAAGTGG - Intergenic
921269425 1:213453866-213453888 GAAAAATATCCATGTATAAGCGG - Intergenic
921276723 1:213528067-213528089 AAAGAAAATCCATGTATAAGTGG + Intergenic
921484112 1:215696332-215696354 GAAGAAAAGCTATGGGTAAGTGG + Intronic
921494240 1:215817863-215817885 GAAGAAAATCTACATGTAAGTGG - Intronic
921543936 1:216451946-216451968 AAAGAAAATCCATGTATAAGAGG + Intergenic
921545566 1:216470721-216470743 GAAGAAAATCTACTTATAAGTGG + Intergenic
922432558 1:225570374-225570396 AAAAAAAATCCATGTATAAGTGG - Intronic
922854673 1:228764380-228764402 GAAAAAAATCTGTGTGTAAGTGG + Intergenic
922960667 1:229643184-229643206 GAAGAAAACCCATGTATAAGTGG + Intronic
923054149 1:230412786-230412808 GAAGAAAATCTGTGTATAAGTGG + Intronic
923113690 1:230914228-230914250 GAAGAAAATCCTCGTATAAGTGG - Intronic
923290753 1:232543344-232543366 GAAAAAAATATGTGTATAAGTGG - Intronic
923399811 1:233605915-233605937 GAAAAATATCTATGTGTAAGTGG + Intergenic
923498975 1:234549094-234549116 AAAGAAAATCCATGCATAAGTGG - Intergenic
923528201 1:234790742-234790764 GAGGAAAATCTGTGTATAAGTGG - Intergenic
923546168 1:234924943-234924965 GATGGAAGTCTCTGTATAAGGGG - Intergenic
923615499 1:235533856-235533878 GAAGAAAATCCACATATAAGTGG - Intergenic
923683545 1:236138739-236138761 GAAGAAATTCTATATATTATAGG - Intergenic
923754400 1:236777502-236777524 GAAGAAAATCCCTGAATAAGTGG - Intergenic
923861441 1:237895813-237895835 GAAGACAACCTATGTATAAGTGG + Intergenic
924123904 1:240829999-240830021 GAAGAAACTCGAAGAAGAAGAGG + Intronic
924400803 1:243678885-243678907 GAAAAAAATCCATGTATAAGTGG - Intronic
924550241 1:245069465-245069487 GAAGAAAATCCATGGAGAAGTGG + Intronic
924690475 1:246345150-246345172 GGAGAAACTCTTTGGATATGGGG - Intronic
1062928280 10:1334665-1334687 GAAGAAACTTTATTTGTAAAAGG - Intronic
1063343106 10:5286874-5286896 GAAAAAAATTCATGTATAAGTGG - Intergenic
1063818025 10:9799371-9799393 GAAAAATATCCATGTATAAGTGG + Intergenic
1063821623 10:9842959-9842981 AAAGAAAATCCATGTAGAAGTGG - Intergenic
1063883000 10:10550365-10550387 GAAGAAAATCTGTGTATAAGTGG + Intergenic
1064036101 10:11914601-11914623 GAAGAAAATCCATGTGTAAGTGG - Intergenic
1064036462 10:11917378-11917400 GAAGAAAATCCATGTGTAAGTGG - Intergenic
1064599052 10:16974713-16974735 GAAGAAAATCTGTGTTTAAGTGG - Intronic
1064658177 10:17577776-17577798 ACAGAAACGCTATGTATTAGAGG + Intergenic
1064859654 10:19814522-19814544 GAAGAAAATCCATGCAAAAGCGG + Intergenic
1064993267 10:21274994-21275016 GAAGAAAGTCCATGTGTAAGTGG + Intergenic
1065320985 10:24509985-24510007 GAAGGAAATCTACATATAAGTGG + Intronic
1065446298 10:25805058-25805080 GAAGATAATCTATATATAAAAGG - Intergenic
1065648041 10:27857095-27857117 GAAGAAAATCCACATATAAGTGG - Intronic
1065707590 10:28484952-28484974 GGAAAAAGTCCATGTATAAGTGG + Intergenic
1065748324 10:28862168-28862190 GAAGAAAATCCACATATAAGTGG + Intronic
1066129756 10:32381418-32381440 AAACAAAATCTGTGTATAAGTGG + Intergenic
1066237126 10:33496302-33496324 GAAGAAAATCGATGTATAAGTGG + Intergenic
1066304581 10:34128233-34128255 GAAGAAACTCTGTGTATCAGTGG - Intronic
1066433364 10:35373539-35373561 TAAGAAAATCCATGTATAAGTGG - Intronic
1066648779 10:37636556-37636578 GAAGAAAATCTGTGTGTAAGTGG + Intergenic
1067031671 10:42882254-42882276 GAAGAAAATCTGTGTGTAACTGG + Intergenic
1067930711 10:50558644-50558666 GAAGAAAATCTGTGTATAAGTGG - Intronic
1068253292 10:54471310-54471332 GAAGAAAATCCACATATAAGTGG + Intronic
1068417302 10:56740471-56740493 GAAGAAAATCTGTGCATAGGTGG - Intergenic
1068505177 10:57891329-57891351 CAAGAAAGTCCACGTATAAGTGG + Intergenic
1068507420 10:57919381-57919403 GAAAAAAACCTATGTATAAGTGG - Intergenic
1068850036 10:61727490-61727512 AGAGAAATTCTGTGTATAAGGGG - Intronic
1069458614 10:68573584-68573606 CAAGAAACTCTTGGTATGAGTGG + Exonic
1069612103 10:69780899-69780921 GAAGAAAATCTGCTTATAAGTGG - Intergenic
1070353782 10:75619227-75619249 GAAGAAAATCCATGTACAAGTGG + Intronic
1071100493 10:82031135-82031157 GATGAAACTTTATATATAAATGG - Intronic
1072356404 10:94615862-94615884 GACAAAACTATATGTATTAGGGG + Intergenic
1072440860 10:95453712-95453734 GAAAAAAATCTACATATAAGTGG - Intronic
1073419701 10:103414700-103414722 GAATAAACTCTACATATAAAGGG - Intronic
1073558039 10:104472399-104472421 GAAAAAGGTCTACGTATAAGAGG - Intergenic
1073963952 10:108966841-108966863 GAAAAAAATCCATGTATAAGTGG - Intergenic
1074052175 10:109889949-109889971 GGAGAAACTGTATTAATAAGTGG - Intronic
1074107201 10:110397396-110397418 GAAGAAAATCTGTGTATAAGTGG + Intergenic
1074379585 10:112968246-112968268 GAAGAAAATCCATGTCTAAGTGG - Intronic
1074570849 10:114622693-114622715 GAAGAAAATCTGTGTGCAAGGGG - Intronic
1074770365 10:116729697-116729719 GAAAAAAATCCATGGATAAGTGG + Intronic
1075183023 10:120229069-120229091 GAAGAAAATCCATGTATAAGTGG + Intergenic
1076098916 10:127758137-127758159 GAAGAAAATCCATGTATAAATGG - Intergenic
1076312485 10:129518413-129518435 GAAGAACATCTAAGTGTAAGTGG - Intronic
1077165883 11:1138110-1138132 GAAAAAACTCCATGCATAAGAGG + Intergenic
1078349558 11:10581438-10581460 GAAGAGACTCCATTTATAGGAGG + Intronic
1078362825 11:10682661-10682683 CAAGAAATTCTCTGTATATGGGG + Intronic
1078477843 11:11647997-11648019 GAAAAAAATCCATGTATAAATGG - Intergenic
1078785398 11:14486086-14486108 AAAAAAAGTCCATGTATAAGTGG + Intronic
1079227838 11:18623192-18623214 GAAAAAAATCCATGTATAAGTGG + Intronic
1079346721 11:19659154-19659176 GAAGAATCTAATTGTATAAGGGG + Intronic
1079449622 11:20588498-20588520 GAAGAAAACCCATGTATAAGTGG + Intergenic
1079584577 11:22110143-22110165 GAAGAAAATCCTTGTATAAGCGG + Intergenic
1080153911 11:29085161-29085183 GAAGAAAATCCACATATAAGTGG + Intergenic
1080272486 11:30465758-30465780 GAAAAAAATCCGTGTATAAGTGG - Intronic
1081922072 11:46787838-46787860 GAAGAAAATTCATGCATAAGTGG - Intronic
1081942703 11:46957986-46958008 AAAGAAAATCTGTGTATAAGTGG - Intronic
1085839228 11:79991795-79991817 GAAGAAAATCTATCTCAAAGTGG + Intergenic
1085955509 11:81388832-81388854 GAAAAAAATTTATATATAAGTGG - Intergenic
1086482535 11:87258369-87258391 TATGAATCCCTATGTATAAGAGG - Intronic
1086943500 11:92822101-92822123 GAAGAAACTGGATGTTTAAAAGG - Intronic
1086965382 11:93021755-93021777 GAAAAAAATGTATGTATAAGTGG - Intergenic
1087126394 11:94630422-94630444 GAAGAAAATCCATGTTTAAGTGG + Intergenic
1087942964 11:104122835-104122857 GATGACTCTCTATGTATAAAGGG + Intronic
1088208358 11:107422204-107422226 GAAAAAAATCTGTGTATAAGTGG - Intronic
1088297920 11:108321079-108321101 GGAGAAACTCTGAGTGTAAGTGG + Intronic
1088664084 11:112076738-112076760 GAAGAAAATCTGAGGATAAGTGG + Intronic
1088696284 11:112368775-112368797 GAACAAAATCTGTGTAAAAGTGG - Intergenic
1088846027 11:113668812-113668834 GAAAAATATCTGTGTATAAGTGG - Intergenic
1089100755 11:115960325-115960347 GAAGAAAATCCATGTATAAGTGG + Intergenic
1089131420 11:116215245-116215267 TTAGGAACTCTATGTTTAAGTGG + Intergenic
1089899557 11:121966552-121966574 TGAGAAACACTATGTGTAAGAGG - Intergenic
1091009982 11:131992074-131992096 GAAGAAAATCTGTGTATAAGTGG - Intronic
1091235344 11:134018484-134018506 GAAGAATATGTATGTGTAAGTGG - Intergenic
1091340511 11:134808995-134809017 TAAAAAAATCCATGTATAAGGGG + Intergenic
1091411385 12:242200-242222 GGAGAAAATCCACGTATAAGTGG - Intronic
1092388923 12:8058068-8058090 GTGGAAACTCTATGTAATAGTGG + Intergenic
1092397206 12:8137773-8137795 GAAAAAACTCTATTGATAAGTGG + Intronic
1092812077 12:12280901-12280923 GAAAAAAGTTCATGTATAAGTGG + Intergenic
1092822356 12:12364527-12364549 GAAGAAAATCTACGTATAAGTGG + Intronic
1092932767 12:13332619-13332641 GAAGAAAATCTGTGTATAAGTGG - Intergenic
1092981813 12:13802931-13802953 GAAGAAAATCTGTGTGTAAGTGG - Intronic
1093163826 12:15782134-15782156 GAAAAAAATCTGTGTATAAGTGG - Intronic
1093612653 12:21181757-21181779 GAAAAAAGTCTGTGCATAAGTGG - Intronic
1093732543 12:22582290-22582312 GAAGAAAATCCATATATAATTGG + Intergenic
1094088128 12:26616759-26616781 AAAGAAAATCTGTGTATAAGTGG - Intronic
1094279375 12:28718460-28718482 GAAGAAAACGTATGTATAGGTGG + Intergenic
1094609174 12:31976839-31976861 AAAGAAAATCCACGTATAAGTGG + Intronic
1094663007 12:32489589-32489611 GAGGAAAGTTTATGTATAAAAGG + Intronic
1095279599 12:40334717-40334739 GAAGAAAATTTATGTATATGTGG + Intronic
1097413145 12:59280751-59280773 GAAGAAAATCTACATATAAGTGG + Intergenic
1098532842 12:71560479-71560501 GAAGAAACCCCACATATAAGTGG + Intronic
1098582314 12:72114627-72114649 GAAGAAAATCCATGTATAAGTGG + Intronic
1098603176 12:72358232-72358254 GAAGAAAATTCATGTATAAGGGG - Intronic
1098815343 12:75153989-75154011 GAAAAAAAACTATGTATAAATGG + Intronic
1098824701 12:75281075-75281097 GAAGGAACTCCATGTAAAATGGG + Intronic
1098861453 12:75715482-75715504 GAAAAAGATCTATTTATAAGTGG - Intergenic
1098869381 12:75800184-75800206 GAAAAAAATCCATGTTTAAGTGG + Intergenic
1098941800 12:76545968-76545990 GAAAAAAATCCGTGTATAAGTGG - Intronic
1099046636 12:77728780-77728802 GAAAAAGATCTAGGTATAAGTGG - Intergenic
1099146399 12:79050366-79050388 GAAGAAAACCTGTGAATAAGTGG + Intronic
1099171124 12:79365571-79365593 GTAGAAACTCTTTGTATTACAGG - Intronic
1099331314 12:81292380-81292402 GAAGAAAGTCTGTGTATAAGTGG - Intronic
1099863406 12:88247522-88247544 CAATAAACTCTACATATAAGTGG - Intergenic
1100255820 12:92881892-92881914 GAAGAAAATCCACGTGTAAGTGG - Intronic
1100384721 12:94095189-94095211 GACGAAAATCCATGTACAAGTGG + Intergenic
1100760591 12:97802605-97802627 GAAAAAACTGTATGTATAGTAGG - Intergenic
1101472810 12:105014444-105014466 GAAAATAATCCATGTATAAGTGG + Intronic
1101746085 12:107542955-107542977 GAAGAAAATCCATGTATAAGTGG + Intronic
1102189536 12:110976519-110976541 GAAGAAAATCCATGTGTAAGTGG + Intergenic
1102232321 12:111271840-111271862 GTAGACACTCTTTGTATATGGGG + Intronic
1103163235 12:118748515-118748537 GAAGAAAATCCAAGTATAAATGG + Intergenic
1103551469 12:121740679-121740701 GAAGAAAATCTGTGTATAAGTGG + Intronic
1103806855 12:123580522-123580544 GAAAAAAATCCATATATAAGCGG - Intergenic
1104135023 12:125929447-125929469 GAAGAAAATGCATGTATAAGTGG - Intergenic
1104349484 12:128032405-128032427 GAAGAAACTCTCAGTTTAAAAGG - Intergenic
1105933633 13:25076805-25076827 GAAGAAAATCTACATATAAGTGG + Intergenic
1106373436 13:29160221-29160243 GAAGAAAATCCACATATAAGTGG - Intronic
1106492166 13:30236116-30236138 GAAGAAAAGCCATGTGTAAGGGG + Intronic
1106979925 13:35267163-35267185 GAATAAAATCCATATATAAGTGG + Intronic
1107121616 13:36802464-36802486 GAAGAAAATCCACATATAAGTGG + Intergenic
1107136263 13:36947211-36947233 GAAAACAATCCATGTATAAGTGG + Intergenic
1107231989 13:38120921-38120943 GAAGAAAGTCCACATATAAGTGG - Intergenic
1107251447 13:38368330-38368352 GAAGAAAATCCATGTATAAATGG + Intergenic
1107367864 13:39704597-39704619 GAAGACAATCTATGTAAATGTGG + Intronic
1108050214 13:46427503-46427525 GAAGAAAATCTGTACATAAGTGG - Intronic
1108239852 13:48452247-48452269 GAAGAAAATCTGAGTAAAAGTGG + Intronic
1108584157 13:51853571-51853593 AAAGAAAATTCATGTATAAGTGG + Intergenic
1108772670 13:53723793-53723815 GAAGAAAATCTATGTACAAGTGG + Intergenic
1108954937 13:56141312-56141334 GAAGAAAATTTATGTGGAAGTGG - Intergenic
1109048303 13:57441534-57441556 TAAAAAAATCTATGTATATGTGG + Intergenic
1109334353 13:60974228-60974250 AAAAAAAATCTGTGTATAAGTGG + Intergenic
1109338156 13:61019140-61019162 GAAGAAAATCTGTGTACAAGTGG + Intergenic
1109343136 13:61087453-61087475 GAGGAAAATCCATGTGTAAGAGG - Intergenic
1109542734 13:63800821-63800843 GAAGAAAATCTGTACATAAGTGG - Intergenic
1109706841 13:66105335-66105357 GAAGGAGCTCAATGTAGAAGTGG + Intergenic
1109990428 13:70047848-70047870 GAAGAAACACTACATATAAAGGG + Intronic
1110094446 13:71498794-71498816 GAAGAAACTGTATTTTTAGGGGG + Intronic
1110346743 13:74457238-74457260 GAAGAAACTGCATGTGAAAGGGG + Intergenic
1110935258 13:81279665-81279687 AAAAAAAGTCTATGTATAATTGG - Intergenic
1110953511 13:81523395-81523417 GAAGAAAATCCACATATAAGTGG - Intergenic
1111089917 13:83431555-83431577 GCAGAAATTGAATGTATAAGAGG - Intergenic
1111117923 13:83804990-83805012 GAAGAAAAAGAATGTATAAGTGG + Intergenic
1111270815 13:85882156-85882178 GAAGAAAATTTATGTGTAATTGG + Intergenic
1111461659 13:88552269-88552291 GAAAAAAATGTATGTATAAGTGG + Intergenic
1111502927 13:89147614-89147636 AAAGAAAATCCATGTATAAGAGG - Intergenic
1113733720 13:112660837-112660859 GAAAAAAATCTGTGTGTAAGTGG + Intronic
1114133885 14:19824585-19824607 GAAGAAAATCCACATATAAGTGG - Intronic
1115316001 14:32025825-32025847 GAAGAGACTCTGTGTGTATGTGG + Intergenic
1116237894 14:42304491-42304513 AAAAAATATCTATGTATAAGTGG + Intergenic
1116741581 14:48761528-48761550 GAAGAAAATTCATGTATAAATGG + Intergenic
1117175443 14:53141416-53141438 GAAGAAATTCTGTTTACAAGGGG - Intronic
1117242877 14:53853036-53853058 GAAGAAAATAAGTGTATAAGTGG - Intergenic
1117384707 14:55199772-55199794 GAAGACAATCCATGTATAAGGGG + Intergenic
1117422655 14:55562175-55562197 GAAGAAAATCCACGTGTAAGTGG + Intronic
1117639420 14:57782281-57782303 AAAAAAAATCCATGTATAAGGGG - Intronic
1117757031 14:58985798-58985820 GAAGAAAATCCATGTATAAATGG + Intergenic
1118105211 14:62650887-62650909 GAAAAAAATCCATATATAAGTGG - Intergenic
1118138892 14:63057747-63057769 GAAAAAAATCTGTGTACAAGTGG - Intronic
1118832238 14:69445175-69445197 AAAGAAAATCCATGTATAAATGG - Intronic
1119449696 14:74698675-74698697 GAAGTAACTGTATGTGCAAGTGG + Intronic
1119882338 14:78110777-78110799 GAAGAAAATCCATGTATAAGTGG + Intergenic
1120351652 14:83368310-83368332 GAAGGAACTCTTTGTGTGAGTGG - Intergenic
1120396341 14:83971501-83971523 GAAGAAAATCCATGTATAAGTGG + Intergenic
1120440346 14:84529058-84529080 GAAGAAAATCTGTGTAAATGTGG - Intergenic
1120445976 14:84597021-84597043 GAAAAAAATCTGAGTATAAGTGG - Intergenic
1120568522 14:86089431-86089453 GAAGAAAATCAATGTATAATTGG + Intergenic
1120662370 14:87265670-87265692 GAAGAATGGCTATGTAGAAGAGG + Intergenic
1120767324 14:88341194-88341216 GAAGAAAATCTGTGTATAAGTGG - Intergenic
1120804241 14:88728672-88728694 GAAGAAAATCCACCTATAAGTGG + Intronic
1120907916 14:89636466-89636488 GAAGAAAATCCATGTAAAAGTGG - Intronic
1121150941 14:91634343-91634365 GAAAAATTTCCATGTATAAGTGG + Intronic
1121351897 14:93180299-93180321 GAAGAAAATCTGTGGATAAGTGG - Intergenic
1121393021 14:93592579-93592601 GAAAACAATCCATGTATAAGTGG + Intronic
1121460863 14:94076870-94076892 GAAGAAATTCTGTGTATAAGTGG - Intronic
1121671937 14:95716824-95716846 GAAAACACTCTATATATTAGAGG - Intergenic
1121804276 14:96801917-96801939 GAAGAAAATCTGTGTATAAGTGG + Intronic
1122104566 14:99442481-99442503 GAAGAAAATCTATGTATAAGTGG - Intronic
1122109540 14:99487584-99487606 GAAGAAACCAAATGTAAAAGTGG + Intronic
1123454315 15:20405438-20405460 AAAGAAAATCTGTATATAAGTGG - Intergenic
1123576952 15:21680174-21680196 GAAGAAAATCCACATATAAGTGG - Intergenic
1123613574 15:22122642-22122664 GAAGAAAATCCACATATAAGTGG - Intergenic
1124403479 15:29372155-29372177 GAAGAAGATCCATGTGTAAGTGG - Intronic
1124406789 15:29399968-29399990 GAAGAAAATCCACATATAAGTGG + Intronic
1124465119 15:29931305-29931327 GAAGAAAATCTGCATATAAGTGG + Intronic
1124577156 15:30919864-30919886 GAAGAAAATCCACATATAAGTGG + Intronic
1124701142 15:31913299-31913321 GAAGAAAATCCATGTAAAAGTGG - Intergenic
1125118836 15:36128509-36128531 GAAGAATGTCCATGTATGAGTGG - Intergenic
1125547882 15:40521136-40521158 GAAGAAACTTTGTCTATCAGTGG + Intergenic
1125803997 15:42476770-42476792 GAGAAAAATCTGTGTATAAGTGG + Intronic
1126558373 15:50016447-50016469 GAGGGAGCTTTATGTATAAGAGG + Intronic
1126560948 15:50043397-50043419 AAAAAAAATCTGTGTATAAGTGG - Intronic
1127368665 15:58314935-58314957 GAAGAAAATCTTTGTCTAAGTGG - Intronic
1128486688 15:68098460-68098482 GAAGAAAATCTGTGTATAAATGG + Intronic
1129421264 15:75428809-75428831 GGAGAAAATCCATGTATAAGTGG - Intronic
1129809202 15:78493413-78493435 AAAAAAAATCGATGTATAAGTGG + Intronic
1130065375 15:80598637-80598659 GAAGAAAATCCACGTGTAAGTGG - Intergenic
1130085270 15:80772779-80772801 GAAAAAAATCCATGTATAAATGG - Intergenic
1130380399 15:83367181-83367203 GAAGAAAATCTGCCTATAAGTGG + Intergenic
1130644734 15:85714354-85714376 GAAGAAATTCCACATATAAGGGG + Intronic
1130693850 15:86110563-86110585 GAAGAAAATCCATGTATGAGTGG + Intergenic
1131575216 15:93582689-93582711 GAAGAAAATCCACATATAAGTGG - Intergenic
1132223444 15:100122865-100122887 GAAAAAAACCCATGTATAAGTGG + Intronic
1132246950 15:100304794-100304816 GGTGAAAATCCATGTATAAGTGG - Intronic
1132257994 15:100394523-100394545 GAAGAAAATCCATGTAAAAGTGG - Intergenic
1202985820 15_KI270727v1_random:414419-414441 GAAGAAAATCCACATATAAGTGG - Intergenic
1132824729 16:1898409-1898431 GAAACAACGCTATGTCTAAGTGG + Intergenic
1134363429 16:13554151-13554173 GAAGAGACTCTGTATGTAAGAGG - Intergenic
1134573402 16:15311258-15311280 GAAAAAAATCCATGTATAAGTGG + Intergenic
1134728981 16:16444704-16444726 GAAAAAAATCCATGTATAAGTGG - Intergenic
1134821967 16:17254181-17254203 GAAGAAAATCTGTTTATAAATGG - Intronic
1134938454 16:18267162-18267184 GAAAAAAATCCATGTATAAGTGG + Intergenic
1135682079 16:24466145-24466167 GAAGAAAATCTGCATATAAGTGG + Intergenic
1135682547 16:24470500-24470522 GAAGAAAATCCAGGTAGAAGTGG - Intergenic
1136027308 16:27477146-27477168 AAAGAAAATCTATGTATAAGTGG - Intronic
1136035305 16:27534832-27534854 AAAAAAAATCTGTGTATAAGTGG - Intronic
1136181495 16:28555496-28555518 GAAGAAAATCCACATATAAGTGG + Intronic
1137941408 16:52691175-52691197 GAAGAAAATCCGTGTACAAGTGG - Intergenic
1138759431 16:59523353-59523375 CAAAAAAATCCATGTATAAGTGG + Intergenic
1138774296 16:59702993-59703015 GAAAAAAATGTATGTATAAGTGG - Intergenic
1138955117 16:61962211-61962233 GAAGAAAATCTATGTACCAGTGG + Intronic
1138955375 16:61964979-61965001 GAAAGAACTAGATGTATAAGAGG - Intronic
1139181101 16:64749827-64749849 GAAAATACTGTATGTATAAAAGG + Intergenic
1139298585 16:65924174-65924196 GAAGACAGTTCATGTATAAGTGG - Intergenic
1139830091 16:69790496-69790518 GGAGAAAATCCATGTAAAAGTGG + Intronic
1139839104 16:69863899-69863921 GAATAAACTCAATGCATAAAAGG - Intronic
1140523763 16:75604922-75604944 GAAGAAAATCTATGTGTAAGTGG - Intronic
1140553180 16:75890140-75890162 GAAGAAAATCTGTGTATACATGG - Intergenic
1141073672 16:80982063-80982085 AAAGAAAATCCAGGTATAAGTGG - Intronic
1141146053 16:81530807-81530829 GAAGATAATGTATGTAAAAGAGG - Intronic
1142576516 17:912269-912291 GAAAAAAATCTGTGTATAAATGG + Intronic
1143754958 17:9060130-9060152 GAAGAAAATCCATGTATAAATGG - Intronic
1143803612 17:9406814-9406836 GAAAAAGATCCATGTATAAGTGG + Intronic
1144096932 17:11908212-11908234 GAAAAAAATCCATGTGTAAGTGG + Intronic
1144187690 17:12811538-12811560 GGAAAAAGTCTGTGTATAAGTGG + Intronic
1144288475 17:13802771-13802793 AAAAAAGATCTATGTATAAGTGG + Intergenic
1144291947 17:13834925-13834947 GAAGAAAATCTGTGTATAATTGG - Intergenic
1144530146 17:16030312-16030334 GAAGAAAATCCATGTATAAGTGG + Exonic
1144548286 17:16216950-16216972 GAAGGAACTCTTCCTATAAGTGG + Intronic
1144601488 17:16618622-16618644 GAAGTAAATCCATGTATAAGTGG - Intergenic
1145818698 17:27814408-27814430 GAAGAAAATCCACTTATAAGTGG + Intronic
1146097885 17:29950089-29950111 GAAGAAAATCTGTGTATAAGTGG - Intronic
1146245371 17:31277208-31277230 GAAGTAAACCTCTGTATAAGTGG + Intronic
1146394615 17:32454028-32454050 GTAGAAAATCTCTGTCTAAGGGG + Intronic
1146509300 17:33432117-33432139 GAAGAAAATCTACGTATTACTGG - Intronic
1147298655 17:39505707-39505729 GGATAAAATCTGTGTATAAGTGG - Intronic
1147524438 17:41207417-41207439 GAAGAAAATCCACATATAAGTGG + Intronic
1148880874 17:50725642-50725664 GAAAAAACTCCACGTATAAATGG - Intronic
1149070938 17:52541879-52541901 AAAAAAAATCTGTGTATAAGTGG + Intergenic
1149287362 17:55179559-55179581 GGAGAAAATCCATGTATATGTGG - Intergenic
1149526701 17:57361774-57361796 GAAGAAAATCCACATATAAGTGG + Intronic
1149599256 17:57882611-57882633 GAAGAAAATCTACCTATAAGTGG - Intronic
1151039021 17:70836393-70836415 GAAGAAAATCTGTGTAGAAGTGG - Intergenic
1151145562 17:72037282-72037304 GAAGAAAATCCAAGTGTAAGTGG - Intergenic
1151150342 17:72079748-72079770 GAAGAAACTTGATGGATTAGTGG + Intergenic
1151636597 17:75353350-75353372 GAAAAAAATCCGTGTATAAGCGG + Intronic
1152007627 17:77692495-77692517 GAAGGAAATCTGTGCATAAGTGG + Intergenic
1152370153 17:79882621-79882643 GAAGGAAATCTGTGTATAAGTGG - Intergenic
1153137615 18:1934724-1934746 GAAGAAAATCCTTGTACAAGTGG + Intergenic
1153141518 18:1977851-1977873 GAAAAAACTCCACATATAAGCGG - Intergenic
1153166303 18:2265450-2265472 GAAGAAAATCTGCGTATAAGTGG - Intergenic
1153499708 18:5735926-5735948 GAAGAAAATTCATGTGTAAGTGG - Intergenic
1155106582 18:22672769-22672791 GAAGAAAATCCATGTATAACTGG - Intergenic
1155434498 18:25797414-25797436 GAAGAAATTTTATATTTAAGAGG + Intergenic
1155768306 18:29665894-29665916 AAAGAAAATCCATATATAAGCGG - Intergenic
1156009924 18:32484958-32484980 GAAGAAAATCTCAGCATAAGTGG + Intergenic
1156695322 18:39759433-39759455 GAATAAACTCCATATATGAGTGG + Intergenic
1157052283 18:44180070-44180092 GAAGAACCACAAGGTATAAGAGG - Intergenic
1157097826 18:44702293-44702315 GAAGAAAATCTTCATATAAGTGG + Intronic
1157216733 18:45790098-45790120 GAAAAAAATCTACATATAAGTGG + Intergenic
1157462180 18:47908371-47908393 GAATAAAATCTGTGTATAAATGG - Intronic
1157542348 18:48520406-48520428 GAAGAAAATCTGTGCATAAGTGG - Intergenic
1157638792 18:49190724-49190746 GAAGAAAATGCATGTATAAGTGG - Intronic
1157793134 18:50550780-50550802 GAAGAAAATCCACATATAAGTGG - Intergenic
1158089915 18:53698799-53698821 GAAGAAAATCTGTGAATATGTGG + Intergenic
1158091362 18:53717596-53717618 AAAGAAAATCTGTGTATAAGTGG - Intergenic
1158665133 18:59425686-59425708 GAAGGAAGTCCACGTATAAGTGG - Intergenic
1158833580 18:61306398-61306420 CAAGAAAGACTATGTATAAAAGG + Intergenic
1158835873 18:61331672-61331694 GGAGAAAATCCATGTCTAAGTGG - Intergenic
1158875155 18:61726533-61726555 GAAGAAAATCTGCATATAAGTGG + Intergenic
1159247494 18:65828390-65828412 GAAAAAAATCCATATATAAGTGG - Intronic
1160339804 18:78080080-78080102 GCAGAAACTCTATTTAAAACAGG + Intergenic
1160476162 18:79190388-79190410 GAAGAAAATTCATGTATAAGTGG + Intronic
1162289779 19:9770030-9770052 GAAGGAACTGAATGTATCAGAGG - Intronic
1162682058 19:12352513-12352535 GAAGAAAATTCATATATAAGTGG - Intronic
1162722717 19:12672121-12672143 GAAGAAAATCCACATATAAGTGG + Intronic
1163051595 19:14689019-14689041 GAAAAAAATCTACCTATAAGGGG - Intronic
1163347955 19:16756426-16756448 GAAGAAAATCCACATATAAGTGG + Intronic
1164962705 19:32448734-32448756 GAAGAAAATCTATGTATAATTGG + Intronic
1166621809 19:44307802-44307824 GAATACAATGTATGTATAAGTGG + Intergenic
1166649975 19:44565662-44565684 GAAGAAAATCTGCTTATAAGTGG - Intergenic
1166968361 19:46544906-46544928 GCAGAAACTCTGTCTCTAAGGGG - Intronic
1168053467 19:53847333-53847355 GAAGAAAATCCCTGGATAAGTGG + Intergenic
1168646804 19:58064356-58064378 GAAGAAAATCCATGTATAAATGG - Intronic
925365215 2:3306801-3306823 GAAGAAAATCCATGCGTAAGTGG + Intronic
925495454 2:4443808-4443830 GAAGAAAATCTACATATAAATGG + Intergenic
925553315 2:5100159-5100181 GAAGAAAATCTATGTATTTATGG - Intergenic
926377081 2:12241609-12241631 GAAGAAAATCTGCGTATAAATGG + Intergenic
926452101 2:13017387-13017409 GAAAAAAATCCACGTATAAGTGG - Intergenic
926480978 2:13393696-13393718 GAAGAAAATCTGTATATAAGTGG + Intergenic
926709287 2:15864420-15864442 GAAGAAAATCTGTTTATAAGTGG - Intergenic
926897033 2:17703563-17703585 GAAGAAAATCTGTGTATAAGTGG - Intronic
928063801 2:28142451-28142473 GAAGAAGTTATATGTATCAGTGG + Intronic
928470092 2:31567331-31567353 GAAAAAATTATATGTATATGTGG - Intronic
928539209 2:32268579-32268601 TCAGATACTCTATGTAAAAGAGG + Intergenic
928551593 2:32376665-32376687 GAAAAAAATTTATGTATGAGTGG + Intronic
928568133 2:32574693-32574715 GCAGAAAATCTGTATATAAGTGG + Intronic
928850745 2:35742562-35742584 GAAAAAAATCCATGTATAAATGG + Intergenic
929671125 2:43877014-43877036 GAAGAAACTGTGTGAATATGGGG + Intronic
929725365 2:44420505-44420527 GATGAAAATCCATGTATATGTGG + Intronic
929732067 2:44505716-44505738 GAAGAAAATCCATGTGTAAGTGG + Intronic
929741480 2:44605866-44605888 AAAGAAGCTCTATGTATGAGTGG - Intronic
929835968 2:45399990-45400012 GAATAAAACCTATGTATCAGAGG + Intronic
929912817 2:46106137-46106159 GAAAAAAATCCATGTATTAGTGG + Intronic
930309496 2:49720935-49720957 GTACAAACTCAAAGTATAAGAGG + Intergenic
930321739 2:49863256-49863278 CAAGAAAATCTATGTGTAATTGG - Intergenic
930343951 2:50154192-50154214 GAAGAAACTATATGTAGATTAGG - Intronic
930345190 2:50171177-50171199 GAAGAAACTCTATGTATAAGTGG + Intronic
930540658 2:52702613-52702635 GAAGAAGCTCAATGTTTAATTGG - Intergenic
930945696 2:57072266-57072288 GAAGAAAATCTGTGTGTAAGTGG - Intergenic
931529281 2:63195458-63195480 AAAAAAAATCCATGTATAAGTGG - Intronic
931831254 2:66053715-66053737 GAAGAAAATTCATGTATAAGTGG + Intergenic
931874996 2:66502839-66502861 GAAGAAAGTATAAGAATAAGGGG - Intronic
932051703 2:68404736-68404758 TAAGAAAGTTTATGTAAAAGAGG + Intergenic
932536507 2:72602997-72603019 GAAGCAACACTAGGTAGAAGAGG + Intronic
932864098 2:75323610-75323632 GAAGAAAATTCATGAATAAGTGG - Intergenic
932873081 2:75423375-75423397 GAAGAAAATCTAGGTATAAGTGG + Intergenic
932995460 2:76845960-76845982 GAAAAAAATCCGTGTATAAGTGG - Intronic
933244444 2:79959582-79959604 GAAGCAACTTCATGTATTAGTGG + Intronic
933448756 2:82418137-82418159 GAACAAAATTTATGTGTAAGTGG + Intergenic
933830681 2:86205502-86205524 GAAAAAAATCTGTGTGTAAGTGG + Intronic
934028887 2:88023781-88023803 GAAGAAAATCTGTGTATAAGTGG + Intergenic
934158414 2:89225125-89225147 GAAGAAATTTGCTGTATAAGGGG + Intergenic
934208857 2:89957302-89957324 GAAGAAATTTGCTGTATAAGGGG - Intergenic
934995971 2:98960753-98960775 AAAAAAAATCCATGTATAAGTGG - Intergenic
935037333 2:99391327-99391349 GAAGAAAATCTGAGTATAAGTGG + Intronic
935556030 2:104510456-104510478 GAAGAAAATCCATCTATAAGTGG + Intergenic
935714246 2:105926061-105926083 AAAGAAAATCCATATATAAGTGG + Intergenic
936115515 2:109699702-109699724 GAAGAAAATCCTTGTATATGTGG + Intergenic
936444053 2:112582363-112582385 GAAGAAAATCTGAGTATAAGTGG + Intergenic
936454815 2:112664843-112664865 AAAGTAAGTCTGTGTATAAGTGG + Intergenic
936666710 2:114605291-114605313 GAAGAAAATCCACGTATAGGTGG - Intronic
937474171 2:122200119-122200141 GAAAAAAATCTGTGCATAAGTGG + Intergenic
937498163 2:122447845-122447867 GAAGAAAATCCAGGTATAAGTGG - Intergenic
937528384 2:122798931-122798953 GAAGAAAATCTTTGTGTAAATGG - Intergenic
937766843 2:125671288-125671310 GAAGAAAATCCACATATAAGTGG - Intergenic
937854887 2:126665160-126665182 GAAGAATCTCTATGGGGAAGAGG + Intronic
939018684 2:136932757-136932779 GAAGAAAATCCACATATAAGCGG + Intronic
939200528 2:139028715-139028737 GAAGAAAATCTGCATATAAGTGG - Intergenic
939279642 2:140045783-140045805 GAAGGAAATCCAAGTATAAGTGG + Intergenic
939713559 2:145554933-145554955 GAAGAAAATCCACATATAAGTGG - Intergenic
939773946 2:146361032-146361054 GAAGAAAATCCACGTATAAGTGG + Intergenic
940074765 2:149729108-149729130 GAATAAAGTCTATGTGTAAAGGG + Intergenic
940102003 2:150051188-150051210 GAATAAAATCTGTGTATAAAAGG - Intergenic
940376103 2:152960533-152960555 GAAGAAACAATGTGTATAAAGGG + Intergenic
940875983 2:158897587-158897609 GAGGAAAATCTATGTATATATGG - Intergenic
941109272 2:161400455-161400477 GAGAAAAATCCATGTATAAGTGG - Intronic
941128803 2:161620835-161620857 GAAGAAAATCTACATATAAGTGG - Intronic
941296975 2:163751104-163751126 GAACATATTCTATGTATAAATGG + Intergenic
941872325 2:170398899-170398921 GAAAAATATCTATGTATAGGAGG + Intronic
941909820 2:170753853-170753875 AAAGAAACTCCATGTCTAGGTGG + Intergenic
941981858 2:171467160-171467182 GAAAAAAATCTGTGTATAAGTGG - Intronic
942009333 2:171743346-171743368 GAAGAAAATATGAGTATAAGTGG + Intronic
942266630 2:174233996-174234018 GAAAATAATCTGTGTATAAGTGG - Intronic
942350787 2:175050754-175050776 GAAGAAAATCTGTTTATAAATGG + Intergenic
942361344 2:175175212-175175234 GAAAAAAATCTGTGTATAAGTGG + Intergenic
942478978 2:176361919-176361941 GAAGAAAATCCATATGTAAGTGG + Intergenic
943153284 2:184141065-184141087 GATGAGAATCTATATATAAGTGG + Intergenic
943597455 2:189875450-189875472 GAAAAACATCCATGTATAAGTGG + Intronic
943901473 2:193443405-193443427 GAAGAAACTCTTAGTAGAAAAGG + Intergenic
943901607 2:193445617-193445639 AAAGAAAATCCATGTATAAATGG + Intergenic
943975929 2:194477028-194477050 GAAGTAAATACATGTATAAGCGG - Intergenic
944658893 2:201903814-201903836 GAAGAAAATCCACTTATAAGTGG + Intergenic
945128512 2:206540292-206540314 GAAAAAAGTCTACATATAAGTGG - Intronic
945275272 2:207981955-207981977 GAAGAAAATCCAGGTATAAGTGG - Intronic
945735832 2:213599378-213599400 GAAGAAGGTCCAAGTATAAGTGG - Intronic
945766793 2:213990736-213990758 GAGGAAAATCTATGTATAAGTGG + Intronic
945820244 2:214655299-214655321 GAAGAAAATCCATTTATAAGTGG - Intergenic
946495431 2:220191733-220191755 GAAGATTCTCCATGTATAAATGG + Intergenic
946637133 2:221741948-221741970 GAAGAAACTTAATGTATTGGTGG - Intergenic
946690341 2:222304570-222304592 AAAGAAACTTTATTTAAAAGAGG - Exonic
946693386 2:222327378-222327400 GAAGAAAATCCATGTATAAATGG - Intergenic
946699912 2:222402051-222402073 GAAGAAAATCCACATATAAGTGG - Intergenic
946911028 2:224460906-224460928 AAAAAAAATCTACGTATAAGTGG + Intergenic
946970506 2:225085869-225085891 GAAGTAAATCTGTGTGTAAGTGG - Intergenic
947069029 2:226265336-226265358 GAAGAAAGTCCATAGATAAGGGG - Intergenic
947309725 2:228788045-228788067 GAAGAAAATCCACATATAAGTGG - Intergenic
948069964 2:235112859-235112881 GAAGAAAATCCATGTATAAGTGG - Intergenic
948926244 2:241100324-241100346 GAAGAAAATCCACATATAAGTGG - Intronic
948931543 2:241135442-241135464 GAAAAGAATCTGTGTATAAGTGG + Intronic
1169184202 20:3599574-3599596 GAAAAAAGTCTACGTGTAAGTGG - Intronic
1169322753 20:4647686-4647708 GAAAAAAATCTGCGTATAAGTGG - Intergenic
1169657703 20:7943216-7943238 AAAGAAAATCTACATATAAGTGG - Intergenic
1169765725 20:9145984-9146006 GAAGAAACTCCATGTTCTAGAGG + Intronic
1169784233 20:9341672-9341694 AAAAAAAATCCATGTATAAGTGG + Intronic
1170027250 20:11902993-11903015 GAAAAAAATCTAGATATAAGTGG + Intronic
1170419320 20:16176877-16176899 GAAGAAAATCTATGAATATGTGG - Intergenic
1170433014 20:16294536-16294558 GATGAAAGTCTGTGGATAAGTGG - Intronic
1170602740 20:17854118-17854140 GAAAAAAATCCATGTAGAAGAGG + Intergenic
1170682266 20:18537018-18537040 GAAGAAAATCCACATATAAGTGG + Intronic
1170951372 20:20939151-20939173 GAAGAAAATCTGCATATAAGTGG - Intergenic
1171040328 20:21756887-21756909 GTAGAAAATCCATGTATAAGTGG + Intergenic
1172015827 20:31872190-31872212 GGAGAACCTCTCTGAATAAGTGG + Intronic
1172123157 20:32610323-32610345 AAAGAAAATCTAAGTAGAAGAGG + Intergenic
1172194805 20:33084565-33084587 GAGGAACCTATATGTATAGGAGG + Intronic
1172724699 20:37029399-37029421 GAAAAAAATCTGTATATAAGTGG + Intronic
1172921014 20:38482310-38482332 GAAGAAAATCCATATGTAAGTGG + Intronic
1174059524 20:47822714-47822736 GAAGAAAATCTGCGTATATGTGG - Intergenic
1174520378 20:51125284-51125306 GAAAAAACTCCTTCTATAAGTGG - Intergenic
1174839640 20:53889567-53889589 AAAAAAAATCTACGTATAAGTGG + Intergenic
1175371189 20:58494195-58494217 GAAGAAAATCTGGGGATAAGTGG + Intronic
1176917316 21:14642150-14642172 AAAGAAAATCTGTGTATAAGTGG + Intronic
1177219876 21:18178778-18178800 GAAGAAAATCTGTATATAAATGG + Intronic
1177297362 21:19193662-19193684 GAAGAAAATCTGTGTAAAATCGG - Intergenic
1177345537 21:19863748-19863770 TAAGAAAATCCATGTATAAGTGG - Intergenic
1177362937 21:20097673-20097695 GAAGAGAATTTGTGTATAAGTGG + Intergenic
1177366714 21:20149160-20149182 GGAGAAAATCTGTGTATAAGTGG + Intergenic
1177499101 21:21927872-21927894 GAAAAAACTACATGTAGAAGAGG - Intergenic
1177544755 21:22542472-22542494 GAAGAAAATCTGCATATAAGTGG - Intergenic
1177750470 21:25277290-25277312 GAAAAAAATCTACATATAAGTGG + Intergenic
1177909978 21:27018980-27019002 GAAGAAAATCTCTGTACCAGTGG + Intergenic
1177946569 21:27478201-27478223 AAAAAAAATCCATGTATAAGTGG - Intergenic
1178449839 21:32687740-32687762 GAAAAAAATCCATATATAAGTGG - Intronic
1179519992 21:41936635-41936657 GGAAAAAATCTATGTATTAGTGG - Intronic
1181020196 22:20096354-20096376 GAAGAAAATTTTTGTATAAGTGG + Intronic
1181820795 22:25473959-25473981 GAAGAAAATCCAGGAATAAGTGG + Intergenic
1182138964 22:27935418-27935440 AAAAAAAATCCATGTATAAGTGG - Intergenic
1185183267 22:49376350-49376372 GAAGAAAATCCAAGTATTAGTGG - Intergenic
949152709 3:789813-789835 GAAAATAATGTATGTATAAGTGG + Intergenic
949248709 3:1957185-1957207 AAAGAAAATCCATGTATAAGTGG - Intergenic
949335614 3:2971233-2971255 GAAGAAAATGTGTGTATTAGTGG + Intronic
949647707 3:6116613-6116635 GTAGAAAATCTTTGTATAAGTGG + Intergenic
949994754 3:9607869-9607891 GAAGAAAATCCACATATAAGTGG - Intergenic
950156936 3:10728535-10728557 GAAGAAAATCTGGGTATAAGGGG - Intergenic
950571779 3:13804859-13804881 GAAGAAACTCTGAGGATAATTGG - Intergenic
950818642 3:15734044-15734066 GAAAAAAATCCATATATAAGTGG - Intronic
950820857 3:15756975-15756997 GAAGAAAATCTACATATAAGTGG - Intronic
951079893 3:18441561-18441583 GAAGAAACTATGTGTGTAAAGGG + Intronic
951131345 3:19049088-19049110 GAAGAAAATCCATGTAGAAGTGG - Intergenic
951141230 3:19163689-19163711 GAAGAAAATCCTTGTATAAGTGG - Intronic
951478408 3:23133156-23133178 GAAGAAACTCTTTGGATATCAGG + Intergenic
951568054 3:24031951-24031973 GAAGAAAATCTACATATAAGTGG + Intergenic
951834092 3:26961843-26961865 GAAGAAAATCCATAGATAAGAGG - Intergenic
951854653 3:27181507-27181529 GAAGAAAATTCATGTATAAGTGG + Intronic
951942741 3:28098753-28098775 GAAGAAAATCCATGTGTAAGTGG - Intergenic
952098720 3:29985938-29985960 GAAGAAATTCTGTGAATTAGAGG - Intronic
952388173 3:32858131-32858153 GAAGAAAATCTATGTATAAGTGG + Intronic
952464293 3:33565003-33565025 GAAGAAAATCCACGTGTAAGTGG - Intronic
953938252 3:47066016-47066038 GAAGAAAATCCACATATAAGTGG - Intronic
953947037 3:47158346-47158368 GAAAAAAATCTGTGTATAAGTGG - Intronic
953965558 3:47302649-47302671 GAAGAAAATTTGTGTACAAGTGG + Intronic
954751531 3:52816913-52816935 GAAGAAGCTCTGCGTACAAGTGG - Exonic
954761313 3:52876500-52876522 GGAGAAAATCCGTGTATAAGTGG - Intronic
954946676 3:54431509-54431531 GAAGAAAATCCACATATAAGTGG + Intronic
955261883 3:57399662-57399684 GAGGAAAATCTACATATAAGTGG - Intronic
955552311 3:60097494-60097516 AAAGAAAATCCATGTGTAAGTGG - Intronic
955660461 3:61293514-61293536 GAAGAAAATTCATGTATAAGTGG + Intergenic
955810212 3:62780028-62780050 CCATAAACTCTATGTACAAGGGG - Intronic
956028775 3:65013056-65013078 GAAGTAAGACTATGGATAAGGGG - Intergenic
956794526 3:72705687-72705709 AAAGAAAATCCATGTGTAAGTGG - Intergenic
957389522 3:79545937-79545959 GAAGAAACTCTGTGAATAAGTGG - Intronic
957569115 3:81923651-81923673 AAAGAAACTCTTTGGACAAGTGG - Intergenic
957681720 3:83444438-83444460 GAAGAAAACTTATGTATAATGGG + Intergenic
958071728 3:88622818-88622840 AAAGAAAATCCAAGTATAAGTGG - Intergenic
958574696 3:95933746-95933768 GAAAAAAATCTGTATATAAGTGG + Intergenic
959153832 3:102641823-102641845 GAAAAAATTCCGTGTATAAGTGG - Intergenic
959596999 3:108139660-108139682 AAAGAAAACCCATGTATAAGTGG - Intergenic
959732040 3:109615585-109615607 GAATAAAATTCATGTATAAGTGG - Intergenic
959795301 3:110420508-110420530 GAAGAAAACTCATGTATAAGTGG - Intergenic
959830918 3:110861562-110861584 AGAGAAAGTCTGTGTATAAGTGG - Intergenic
959837275 3:110934631-110934653 GAAAAAATTCCATGTGTAAGTGG + Intergenic
960326173 3:116298809-116298831 GCAGAAACTCTAAATATAACGGG - Intronic
962708874 3:138069083-138069105 GAAGAAAATCCACGTATAAGTGG - Intronic
963146339 3:141999084-141999106 GAAGAAAATCCATGTATAAGTGG - Intronic
963469301 3:145718315-145718337 GAAGAAAATCTGTATATAAGTGG + Intergenic
963490800 3:145998060-145998082 GAGGAAAATCTGAGTATAAGTGG - Intergenic
963743635 3:149104104-149104126 GAAGAAAATCTGCATATAAGTGG - Intergenic
963814809 3:149817662-149817684 GAAGACACTCAAAGGATAAGAGG + Intronic
964817034 3:160728356-160728378 GAAGAAAAGCCATGTATAAATGG - Intergenic
964836570 3:160945706-160945728 GAAGAAAATCTGTGTGTACGTGG - Intronic
965319816 3:167239379-167239401 GAAGAAAATCCATGTATAAGTGG - Intergenic
965471807 3:169102736-169102758 GAAAAAACTAAATGTATAGGAGG + Intronic
966125167 3:176567867-176567889 GATGAAACACTGTGTCTAAGGGG + Intergenic
966370950 3:179250206-179250228 GAAGAAAATCCATTTATAAGTGG + Intronic
966545375 3:181140715-181140737 GAAGAAACTATATGTTTAGGAGG - Intergenic
966563149 3:181345895-181345917 GAAGAAAATCTGTATTTAAGTGG - Intergenic
966760520 3:183413943-183413965 GAAGAAAATCCACGTATAAGTGG + Intronic
967041035 3:185692288-185692310 GAGGAAGCTCTAGGTAAAAGTGG + Intronic
967232548 3:187354042-187354064 GAAGAAAACCCATGTATAAGTGG + Intergenic
967525384 3:190486761-190486783 GAAGCCACTCTATTTAGAAGAGG + Intergenic
968532670 4:1102437-1102459 GAAAAATCTCTATGTATACATGG + Intronic
969665524 4:8555070-8555092 GGTGAAAATCCATGTATAAGTGG - Intergenic
970000437 4:11359952-11359974 GAAAAAGATCTATGTATCAGTGG - Intergenic
970687267 4:18582849-18582871 GAAGAAAGCCTATGAATAATGGG + Intergenic
971025228 4:22582778-22582800 GAAGAAAATTCACGTATAAGTGG - Intergenic
971032642 4:22657705-22657727 GAAGGAAATCTGTGTACAAGTGG - Intergenic
971491084 4:27212671-27212693 GAAGAAAACGCATGTATAAGTGG - Intergenic
971551292 4:27959881-27959903 GAATAAAATCTATGCATAGGTGG + Intergenic
971606980 4:28670440-28670462 GAAGAATTTCTATGAATATGAGG - Intergenic
971885314 4:32438437-32438459 GAAAAAAATATATGTATAAGGGG + Intergenic
971928908 4:33052634-33052656 GAAGAAAACTTATGTATAAATGG - Intergenic
972392896 4:38629844-38629866 GAAGAAAATCCATGCGTAAGTGG + Intergenic
972478145 4:39472350-39472372 GAAGAAAATCCTTGTATAAGTGG + Intronic
972925873 4:44006453-44006475 GAAGAAAATCCATGTATAAGTGG - Intergenic
972963312 4:44480124-44480146 CAAGAAACCCTATGTGAAAGAGG + Intergenic
973161194 4:47018862-47018884 GAAGAAAATCCGCGTATAAGTGG + Intronic
973285001 4:48404956-48404978 TAACAAAGTTTATGTATAAGTGG - Intronic
973740392 4:53914137-53914159 GAAGAAACTCTCTAAAAAAGAGG - Intronic
973827584 4:54724141-54724163 GAAGAAACCCTTTTTAAAAGCGG - Intronic
973865840 4:55112188-55112210 GAAGAAAATCTGCTTATAAGTGG - Intronic
974337990 4:60576401-60576423 GAAAAATATCTGTGTATAAGTGG - Intergenic
974379552 4:61120961-61120983 GGAGACAGTCTATGTAAAAGGGG - Intergenic
974407308 4:61490776-61490798 GGAGAAACTCTATGAATAATGGG + Intronic
974460718 4:62184337-62184359 GAAAAATATCCATGTATAAGTGG + Intergenic
974483570 4:62476446-62476468 AAACAAACTCTTTGTATATGGGG + Intergenic
974623188 4:64386438-64386460 GAAGAAAATCCATTTATAGGTGG + Intronic
974853825 4:67435307-67435329 GAAGAAAATCCATGTGTAAGTGG - Intergenic
974896277 4:67943194-67943216 ACAGAAACTCTATTTAAAAGTGG - Intronic
975032776 4:69642786-69642808 GAATAATCTCTATATATTAGAGG - Intronic
975443912 4:74440882-74440904 GAAAAAAGTCTCTGTTTAAGTGG - Intergenic
975527084 4:75362680-75362702 GAAGAAAATCCACATATAAGGGG + Intergenic
975567831 4:75778474-75778496 GAAGAAAACATATATATAAGTGG + Intronic
975601984 4:76110735-76110757 AAAAAAAATCCATGTATAAGTGG - Intronic
975663062 4:76706630-76706652 GAAAAAAATCTGCGTATAAGAGG + Intronic
975908243 4:79241089-79241111 GAAGAAAATCTATGTACAAGTGG - Intronic
976204975 4:82616101-82616123 GCAGGAACTCTATGTTCAAGAGG - Intergenic
976459744 4:85296033-85296055 GAAAAAAATCCATGTATAAGTGG - Intergenic
976486908 4:85616932-85616954 GAAAAAACTTTATTTATAAAAGG - Intronic
976691660 4:87874565-87874587 GAAGGAAATCCATGTGTAAGTGG + Intergenic
976737573 4:88326173-88326195 GAAGAAAATCCATGTATAATTGG - Intergenic
977512825 4:97983077-97983099 GAAGAAAATTTGTGTATAAGTGG - Intronic
977550357 4:98435592-98435614 GAAGAAAATCCAGGTATAATTGG + Intronic
977788518 4:101069643-101069665 GAAGAAAATCTGCATATAAGTGG - Intronic
977805985 4:101298404-101298426 GAAAAAAATTCATGTATAAGTGG - Intronic
978148513 4:105406764-105406786 GAAAGAAATCCATGTATAAGTGG + Intronic
978243584 4:106546087-106546109 GAAGAAAATCTACATATAAGTGG + Intergenic
978468939 4:109040314-109040336 GAAGCCACCCTTTGTATAAGAGG + Intronic
978556326 4:109984636-109984658 GAAAAAAATCCAGGTATAAGTGG + Intronic
978872739 4:113599948-113599970 GAGGAAAATCCACGTATAAGTGG + Intronic
978935600 4:114371349-114371371 GAAGAAAATCTGTATATAAGTGG - Intergenic
979125926 4:116971301-116971323 GAAGAAAATCCATGTTTAGGTGG + Intergenic
979535754 4:121818612-121818634 GAAAAAAATCCATGTGTAAGTGG + Intronic
979601403 4:122590074-122590096 GAAAAAAATTCATGTATAAGTGG - Intergenic
980445244 4:132897536-132897558 GAAATAAATCTATGTACAAGTGG - Intergenic
980701520 4:136438118-136438140 TAAGAAAATTTATGTATGAGCGG - Intergenic
980827050 4:138086645-138086667 GAAGAATGTCTTTGTAGAAGTGG - Intergenic
980907560 4:138963036-138963058 GAAGAAAATCCACTTATAAGTGG + Intergenic
981041338 4:140225146-140225168 GAAGAAAGTCCATGTATAAGTGG + Intergenic
981114539 4:140974892-140974914 GAAAAAAATCCATGTATTAGCGG - Intronic
981411580 4:144438486-144438508 GAAGCAACTCTTTTTATATGTGG - Intergenic
981505652 4:145496550-145496572 GAAAAAAATCTGAGTATAAGTGG - Intronic
981856435 4:149298967-149298989 GAAAAAAATGTGTGTATAAGCGG + Intergenic
982022336 4:151215262-151215284 AGAGAAACTCTAGGTAGAAGAGG - Intronic
982377335 4:154707556-154707578 GAAGATACTATTTGTTTAAGTGG + Intronic
982571384 4:157054451-157054473 TAAAAAATTCTGTGTATAAGAGG - Intergenic
982591211 4:157314095-157314117 GAAGAAAATCCATGTATAAGTGG + Intronic
982769385 4:159381970-159381992 GAAGAAAATCCAGGTATAAGTGG + Intergenic
982815826 4:159883153-159883175 GAAGAAAATCCATGTGTAAGTGG - Intergenic
982837379 4:160137288-160137310 GGAGAAAATCTGTGTATAAGTGG + Intergenic
982980065 4:162121769-162121791 GAAGAAAATTTGTGTATAAATGG - Intronic
983344849 4:166515117-166515139 GAAGAAAATCCATGTATAAGTGG + Intergenic
983539664 4:168895713-168895735 GAAGAAAATCCATATATAAGTGG + Intronic
983544343 4:168947088-168947110 GACTAAACTCTATGTCTATGAGG - Intronic
983791752 4:171807396-171807418 GAACAAAATCTGTGTAGAAGTGG + Intergenic
983868868 4:172801808-172801830 GAAGAAAATCCATGCATAAGGGG - Intronic
983966206 4:173814530-173814552 CAGGAAACTCTGTGTCTAAGTGG - Intergenic
984047917 4:174825007-174825029 GAAGAAAAACTATATAGAAGAGG + Intronic
984251382 4:177339611-177339633 GAAAAAAATCTGCGTATAAGTGG + Intronic
984342493 4:178475248-178475270 GAAAAAAATCCATATATAAGTGG - Intergenic
984379252 4:178969279-178969301 GAAGAAAATCTGTTTTTAAGTGG + Intergenic
984433113 4:179674052-179674074 GAAGAAAGTGAATGTAAAAGAGG - Intergenic
984438339 4:179733451-179733473 GAAGAAAATCCATGTAAAAGTGG + Intergenic
984902100 4:184594583-184594605 GAAGAAAATCCATGTATAAGTGG + Intergenic
986696308 5:10358642-10358664 GAAAAAAATCCATGTGTAAGTGG - Intronic
987428624 5:17803602-17803624 AAAAAAAATCCATGTATAAGTGG + Intergenic
987448149 5:18047369-18047391 GAAGAAAATCTGCATATAAGTGG + Intergenic
987728908 5:21742267-21742289 GAAGAAAATCTACAAATAAGTGG - Intergenic
987843462 5:23251998-23252020 GAATAAAATATATGTGTAAGTGG - Intergenic
987906024 5:24078359-24078381 GAAGAAAATCCATACATAAGTGG + Intronic
988030500 5:25757367-25757389 GAAGAAAATCTACATATAAGTGG + Intergenic
988234583 5:28524859-28524881 GAACAAACACAATGTCTAAGAGG - Intergenic
988324571 5:29746158-29746180 GAAAAAACTATATGTAGAAGGGG - Intergenic
988445314 5:31279749-31279771 GAAGAAAATCTAAGTATAAGTGG + Intronic
988669452 5:33365334-33365356 GAAGAAACTCCGTGTGTAAGTGG - Intergenic
988670925 5:33380601-33380623 GAAGAAATTATATGGATGAGAGG - Intergenic
988822476 5:34901253-34901275 GAAAAAAATCTGTGTATAAGTGG + Intergenic
988940212 5:36138205-36138227 TAAGAACCTGTATGTATAAGTGG + Intronic
988954164 5:36297361-36297383 GAAGAAAATCCACATATAAGTGG + Intronic
989051699 5:37326897-37326919 GAAAAAAATCTGTGTATAAGTGG - Intronic
989483733 5:41963780-41963802 GAATAAAATCCATGTATATGTGG + Intergenic
989647754 5:43654154-43654176 GAAGAAATACTATGTATCAGTGG + Intronic
989650074 5:43678231-43678253 GAAGAAAATCTGTGGATAAGTGG + Intronic
989714483 5:44445226-44445248 GAATAAAATCTGTGTATAAGTGG + Intergenic
990002196 5:50907543-50907565 GAAGAGACTTTATGCCTAAGAGG + Intergenic
990249452 5:53898162-53898184 GAAGAAAATCTGCATATAAGTGG + Intronic
990571007 5:57078829-57078851 GAAGAAAATCTGTGTCTAAGTGG + Intergenic
990588238 5:57233749-57233771 GAAGAAAATCTAGATGTAAGTGG + Intronic
990628653 5:57642474-57642496 GAAGAAAGTGTATGCATCAGGGG + Intergenic
991098376 5:62763753-62763775 GAAGAAAATCCATCTGTAAGTGG + Intergenic
992485995 5:77195912-77195934 GAAGAAAATCTGCGTGTAAGTGG + Intergenic
993517069 5:88850819-88850841 GAAGAAAATTCATGTGTAAGTGG - Intronic
993596335 5:89860911-89860933 GAAAAAAATCCATGTATAAATGG + Intergenic
993708814 5:91201718-91201740 GAAGAAAATCCGTGTATAAGTGG - Intergenic
993856067 5:93077012-93077034 GGAGAAACTCCATGTACTAGAGG + Intergenic
994031774 5:95151451-95151473 GAAGAAAATCCATGTATAAGTGG + Intronic
994129944 5:96215572-96215594 GAAAAAAATCCATGTATAAGTGG - Intergenic
994332965 5:98528822-98528844 CAAGGAACTCTATGAATAACTGG + Intergenic
994805307 5:104439545-104439567 GAAGAAAATCTGCCTATAAGTGG + Intergenic
994846743 5:104998653-104998675 GAAGAAAGTCAATCTATAAATGG - Intergenic
995164151 5:109018291-109018313 GAAGACAATCTATTTCTAAGTGG - Intronic
995609830 5:113897681-113897703 GAAAAAGATCCATGTATAAGTGG - Intergenic
995650987 5:114368037-114368059 AAAAAAAATCTGTGTATAAGTGG - Intronic
995673842 5:114639770-114639792 GAAGAAAATCTACATATAAGTGG + Intergenic
995807147 5:116065742-116065764 GAAGAAAATCTGTGTATATGTGG + Intergenic
995830735 5:116352600-116352622 GAAAAAAATCCATCTATAAGTGG + Intronic
996156593 5:120110354-120110376 GAAGAAAATCCCTGTGTAAGTGG + Intergenic
996173669 5:120328698-120328720 GAAGAATTTCTATTTTTAAGTGG + Intergenic
996178998 5:120395737-120395759 GAAGAAACTCTCTGGTAAAGGGG - Intergenic
996611035 5:125380895-125380917 GAAGAAAATCCACGTGTAAGTGG + Intergenic
996844711 5:127886428-127886450 GAAGGAAATCTGGGTATAAGTGG - Intergenic
996922840 5:128788961-128788983 GAAGATAATCTGTGGATAAGTGG + Intronic
996969417 5:129345526-129345548 GAAGTAACTCTTTGTAAAACTGG + Intergenic
997192535 5:131951357-131951379 AATGAAACCCTATGTATCAGTGG - Exonic
998194747 5:140058655-140058677 GAAAAAAATCTGTGTATATGTGG - Intergenic
998668251 5:144323741-144323763 GAAGAAAATCTTTCTATATGTGG - Intronic
998680967 5:144466731-144466753 GAAGAAACTGTAGCTAAAAGTGG - Intronic
999011422 5:148045144-148045166 GAAAAAACTCTGTGTATAAATGG + Intronic
999044850 5:148455979-148456001 GAAGAAAATCCATGCGTAAGTGG + Intronic
999170866 5:149593864-149593886 GAAGAAATTCTGTGTATAAGTGG + Intronic
999505269 5:152188149-152188171 GAAAAAAATCTATGTCTAAGTGG + Intergenic
999876839 5:155816544-155816566 GAAGAAACTCTACATATAAGTGG + Intergenic
1000266081 5:159639722-159639744 GGAGAATATCCATGTATAAGTGG + Intergenic
1000512588 5:162202311-162202333 GAAAAAAATCCATATATAAGTGG + Intergenic
1000664283 5:163975580-163975602 GAAGAAAATCCATGAATAAGTGG - Intergenic
1000776524 5:165426482-165426504 GAAGAAAATCCAAATATAAGTGG - Intergenic
1000801340 5:165730328-165730350 GAAGAAAATCCACGTATAAGTGG - Intergenic
1001345042 5:170887021-170887043 GAAAAAAATCCATGCATAAGTGG + Intronic
1001423257 5:171603125-171603147 GAAGAAAATCCATGTATAAGTGG + Intergenic
1001430081 5:171653135-171653157 GAAAAAAATCCATGCATAAGTGG + Intergenic
1001925393 5:175632624-175632646 GAAGAAAATCCACGTAGAAGTGG + Intergenic
1002766320 6:242006-242028 GAAAAAAATTCATGTATAAGTGG - Intergenic
1002803196 6:546536-546558 GAAGAAAATGCGTGTATAAGTGG - Intronic
1002842345 6:917076-917098 GAAGAAAATCTACATGTAAGTGG - Intergenic
1002913751 6:1511500-1511522 GAAGAAAATCCATGTCTAGGTGG - Intergenic
1003105949 6:3216071-3216093 GAAGAAAATCTTTGTATGCGTGG + Intergenic
1003384514 6:5654775-5654797 GAAGAAAATCCACGTATAAGTGG - Intronic
1003605604 6:7557738-7557760 GGAAAAACTCTGTGCATAAGAGG + Intronic
1003664224 6:8094722-8094744 GAAGAAAATTTGTGTTTAAGTGG - Intronic
1004034610 6:11911120-11911142 GAAGAAAATCTACGTATAACTGG + Intergenic
1004173190 6:13315187-13315209 GAAGAAAATCCATGTTTAAGGGG - Intronic
1004335863 6:14763906-14763928 GAAAAAAATCCATGAATAAGTGG - Intergenic
1004486728 6:16073210-16073232 GAAAAAAATCCGTGTATAAGTGG + Intergenic
1004584010 6:16982005-16982027 AAAGAAAATCCGTGTATAAGTGG + Intergenic
1005069289 6:21849667-21849689 GAAGAAAATCTGCCTATAAGTGG - Intergenic
1005335589 6:24792843-24792865 GAAGAAAATCTTCATATAAGTGG + Intergenic
1005635161 6:27746161-27746183 AAAAAAAATCCATGTATAAGTGG + Intergenic
1007089600 6:39174002-39174024 GAAGAAGATCCGTGTATAAGTGG - Intergenic
1007156182 6:39746548-39746570 GAAAAAAATCTCTGTATAAGTGG - Intergenic
1007264952 6:40588924-40588946 GATGAAACTCAAGGTATATGGGG + Intergenic
1007883602 6:45197403-45197425 GAAGAAACACCATGTAAAACAGG - Intronic
1008096163 6:47341833-47341855 CAAGAAAATCTTTTTATAAGGGG - Intergenic
1008119112 6:47590508-47590530 GAAAAAAATCTGTGTATACGTGG - Intronic
1008585984 6:52949908-52949930 GAAGAAAATTCATGTATAAGTGG - Intergenic
1008639792 6:53450104-53450126 GAAAAACATCTTTGTATAAGAGG - Intergenic
1008835786 6:55827045-55827067 GAAGAAACTAAATGCATAGGAGG - Intronic
1009058890 6:58373684-58373706 GAAGAAAATCTGAGTGTAAGTGG + Intergenic
1009231952 6:61073429-61073451 GAAGAAAATCTGGGTATAAGTGG - Intergenic
1009439320 6:63657678-63657700 GAAGAAAATCGATGTATAAGTGG + Intronic
1009858990 6:69301031-69301053 GAAAAAAATCTACTTATAAGTGG - Intronic
1010500872 6:76598436-76598458 AAAGAAACTATATGTAAATGAGG + Intergenic
1010943284 6:81945123-81945145 GGAGAGACTTGATGTATAAGTGG - Intergenic
1011083147 6:83511361-83511383 AAAAAAAATCTGTGTATAAGTGG - Intergenic
1011636259 6:89376910-89376932 GAAGAAAATCCATGTATAAGTGG - Intronic
1012051712 6:94354351-94354373 GAAGAAAATCTGCATATAAGTGG - Intergenic
1012107208 6:95178178-95178200 GAAGAAAATGTGTGTATGAGTGG + Intergenic
1012787595 6:103651763-103651785 GAAGAAAGTTCATGTATAAGTGG + Intergenic
1012857039 6:104514333-104514355 GAAGAAAATCTATATATAAGTGG + Intergenic
1013205667 6:107943516-107943538 GAAAAAAATCCACGTATAAGTGG + Intronic
1013901144 6:115157071-115157093 AAAGAAAATTCATGTATAAGTGG - Intergenic
1014467131 6:121770363-121770385 TTAAAAACTCTATGTATAAAAGG + Intergenic
1014534747 6:122601540-122601562 GAAGAAACTCTACAGATAAGTGG - Intronic
1015001104 6:128216798-128216820 GAAGAAACTATACATATAAAGGG + Intronic
1015233981 6:130949735-130949757 GAAGAAAATCTAGGTGTAAGTGG - Intronic
1015327212 6:131936766-131936788 GAAAAAAATTCATGTATAAGTGG + Intergenic
1015336239 6:132042436-132042458 GAAGAAAATTCATGTATAAGTGG + Intergenic
1015699475 6:136019958-136019980 GAAGAAAATCTACTTATAAGTGG + Intronic
1015891205 6:137971266-137971288 GAAGAAAATCTGCATATAAGTGG + Intergenic
1016236720 6:141877032-141877054 GAAAAAAATCTGTGTATAAGTGG + Intergenic
1016725353 6:147358884-147358906 GAGGAAAATCCATGTGTAAGTGG + Intronic
1017056140 6:150436890-150436912 GAAAAAAATCTGTGTATAAGTGG - Intergenic
1018014378 6:159698959-159698981 GAAGAAAATCTACATAGAAGTGG + Intronic
1018050231 6:160002558-160002580 AAAGAAAATCTGTGTATAAGTGG + Intronic
1018175962 6:161179608-161179630 GAAGAAAATCTGTATATAAGTGG - Intronic
1018217360 6:161541981-161542003 GAAGAAAATCTACATACAAGTGG - Intronic
1018344263 6:162884342-162884364 GAAAAAAATCCTTGTATAAGTGG + Intronic
1018562330 6:165114694-165114716 GAGGAAAGTCTATGTAACAGAGG - Intergenic
1018861776 6:167715686-167715708 GAAGAAAATCCACATATAAGTGG + Intergenic
1020597797 7:10231142-10231164 GAAGAAACTCAAAATATAAGTGG + Intergenic
1020845911 7:13283353-13283375 GAAGAATCTCTATGAATAGATGG + Intergenic
1020894235 7:13919209-13919231 GAAGAAACTGGAGGCATAAGGGG + Intronic
1021171188 7:17399599-17399621 GAAGAAAACCTACTTATAAGTGG + Intergenic
1021325536 7:19262353-19262375 GAAGGAAATCCACGTATAAGTGG + Intergenic
1021482642 7:21134404-21134426 GAAATAAATCCATGTATAAGTGG - Intergenic
1021686563 7:23192714-23192736 GAAGAAAATCCCTGTACAAGTGG + Intronic
1021759551 7:23890366-23890388 GAAAAAAATCCATGTAGAAGCGG - Intergenic
1022047711 7:26636033-26636055 GAAAAAAGCCCATGTATAAGTGG - Intergenic
1022306694 7:29153345-29153367 GAAAAAAATCCGTGTATAAGTGG - Intronic
1022515598 7:30973287-30973309 GAAGAAAATCTATGTGTAAATGG + Intronic
1022751287 7:33228874-33228896 GAAGAAACTCCACGTATAAGGGG + Intronic
1023296777 7:38723195-38723217 GAAGAAAATCCATGTATAAGTGG + Exonic
1023316962 7:38948030-38948052 GAAAAAAATCCGTGTATAAGTGG - Intergenic
1023375463 7:39551138-39551160 GAAGAAAATCCGTGTATCAGTGG - Intergenic
1024052252 7:45633316-45633338 GAAAAAAATCCATGTATAAGTGG - Intronic
1024413474 7:49075845-49075867 GAAGAAAATCCTTGTATAAGTGG + Intergenic
1024749677 7:52450769-52450791 AAAGAAAATCCATGTACAAGCGG + Intergenic
1025235381 7:57231279-57231301 GAAGAAAATCTGCGTATATGTGG + Intergenic
1025271204 7:57519097-57519119 GAAAAAAATCCATGTATTAGTGG - Intergenic
1026176340 7:68001105-68001127 GAAAAAAATTCATGTATAAGAGG + Intergenic
1026523937 7:71138477-71138499 GAAAAAAATCTATGTACAGGTGG + Intronic
1026537176 7:71248407-71248429 GAAGAAAATCCATGTATAAGTGG + Intronic
1026542070 7:71288383-71288405 GAAGGAAATCCATGTAGAAGTGG + Intronic
1026677486 7:72439963-72439985 GAAAAAGATCCATGTATAAGTGG + Intronic
1027347364 7:77275131-77275153 GAAAAAAATCTGTGTATAAATGG - Intronic
1027788938 7:82615099-82615121 GATGTAACTCTATTTAGAAGAGG + Intergenic
1028307452 7:89283819-89283841 GAAAAAAATCTATGTATAAGTGG - Intronic
1028956613 7:96700540-96700562 GAAAAAAATCTGTGTATAAATGG + Intronic
1029338768 7:99925693-99925715 CAAAAAACTCTATTTATAAATGG + Intronic
1029962371 7:104701636-104701658 TAAGAAAGTTCATGTATAAGCGG + Intronic
1029994394 7:104992874-104992896 GAAGAAAATTTGTGTATAAGTGG - Intergenic
1030068737 7:105680413-105680435 GAAGAAACTCTCTCAACAAGAGG - Intronic
1030235848 7:107261165-107261187 GAAAAATATCTGTGTATAAGTGG + Intronic
1030251365 7:107448741-107448763 GAAAAAAATCTGTGTATATGTGG - Intronic
1031050519 7:116940287-116940309 GAAGAAAATCCACGTATAAGTGG - Intergenic
1031200483 7:118677961-118677983 GAAGAAAATTTGTGTATAAGTGG - Intergenic
1031565489 7:123291948-123291970 GAAGAAAATCCACCTATAAGTGG + Intergenic
1031766240 7:125781286-125781308 GAAGTAGCTCTCAGTATAAGGGG + Intergenic
1031786885 7:126044824-126044846 GAAGAAAAACTAAGTATAAGAGG + Intergenic
1032274014 7:130439052-130439074 GAAGAAAATCTGGGTATAAGTGG - Intronic
1032292785 7:130604137-130604159 GAAGAAAATCCATGTGTAAGTGG + Intronic
1032774082 7:135091462-135091484 GAAAAATATCTGTGTATAAGTGG + Intronic
1033352483 7:140572916-140572938 GATGAAACTCCATGTAAAAGAGG + Intronic
1033444959 7:141412558-141412580 GCAGAATCTAAATGTATAAGTGG - Intronic
1033882956 7:145909918-145909940 GCATATACTCTATGTATCAGGGG - Intergenic
1034047914 7:147949374-147949396 GAAGAAAATCCATGTATAAGTGG + Intronic
1034113593 7:148562635-148562657 GAAGAAAATCTGTATATAAGTGG - Intergenic
1034227020 7:149492166-149492188 GAAGAAAATCCATTTATAAGTGG - Intronic
1034823572 7:154239344-154239366 GAAGAAAATCCACATATAAGTGG - Intronic
1036200718 8:6769208-6769230 GAAGAAAATCTATGTCTTAGTGG + Intergenic
1036216690 8:6885641-6885663 GAAGAAAATCCATGTGTAAATGG - Intergenic
1036657924 8:10689915-10689937 GAAGAAAATCTATGTGTAAGTGG + Intronic
1037208517 8:16355667-16355689 GAAGAAAATCCATATATAAGTGG - Intronic
1037215205 8:16442636-16442658 GAAGAAAACTTATATATAAGTGG - Intronic
1037242942 8:16798057-16798079 GAAAAAAATCCATATATAAGTGG - Intergenic
1037382569 8:18302984-18303006 GAAGAAAATCTGTGTGTAAGTGG + Intergenic
1037749258 8:21669593-21669615 GAAGAAAATCCGTGTATAAGTGG - Intergenic
1040062699 8:43117499-43117521 GAAGAAAATCTGTGTGTAAGTGG + Intronic
1040453980 8:47577485-47577507 GAAAAAAATCTGTGTACAAGTGG - Intronic
1040636564 8:49281244-49281266 GAAGAAAATCTGGGTATAAGTGG + Intergenic
1040740374 8:50567557-50567579 AGAGAAACTCTATGTATCGGTGG + Intronic
1040765123 8:50900339-50900361 GAAGAAAATTCATGTACAAGTGG + Intergenic
1041033514 8:53762820-53762842 TAAGAAAATCCATGTGTAAGTGG - Intronic
1041160521 8:55037832-55037854 GAAAAGAATCTGTGTATAAGTGG + Intergenic
1041407748 8:57518875-57518897 GAAGAAAATCTGTGTATAAGTGG + Intergenic
1041612383 8:59866729-59866751 GAAGAAAATTCATGTATAAGTGG + Intergenic
1042054291 8:64747614-64747636 GAAGAAAATCCATGTATAAGTGG + Intronic
1042182634 8:66107104-66107126 GAAAAAAATCTATGTATGAATGG + Intergenic
1042248713 8:66734595-66734617 AAAGCAACACTATGGATAAGGGG - Intronic
1042914217 8:73859117-73859139 GAAGAAAATCCATGTATAAGTGG - Intronic
1043077729 8:75723009-75723031 GAAGAAAATTTATGTATAAGTGG - Intergenic
1043141097 8:76591486-76591508 GAAGAAACACTATCTTGAAGGGG + Intergenic
1043962962 8:86438300-86438322 GAAGAAAATTCAAGTATAAGTGG + Intronic
1043980081 8:86627849-86627871 GAAGAAAATTCTTGTATAAGTGG - Intronic
1043986895 8:86704345-86704367 GAAGAAAATCCAGGGATAAGTGG + Intronic
1044092046 8:88014449-88014471 GAAGAAAATCCATGCAAAAGTGG - Intergenic
1044489052 8:92790385-92790407 GAAGAAAAGCTATGTGTAAGTGG + Intergenic
1044762210 8:95532420-95532442 GAAAAATATCTATGTATAAGTGG + Intergenic
1045668776 8:104523150-104523172 GGAAAAAATCCATGTATAAGTGG - Intronic
1045691866 8:104767661-104767683 GAAGAACCTCTACTTAGAAGAGG - Intronic
1045703280 8:104891893-104891915 GAAGAAACTCTATCTGTATGTGG - Intronic
1045874379 8:106962005-106962027 GAAGAAACTTTAAATATCAGAGG - Intergenic
1046159039 8:110334869-110334891 GTATAAACTTTATGTAAAAGAGG + Intergenic
1046281649 8:112041106-112041128 GAAAAAAATCTATGTGCAAGTGG + Intergenic
1046569198 8:115941556-115941578 GAAGAAGCTATAGGTATAACAGG + Intergenic
1047086740 8:121525751-121525773 GAAGAAACTTTTTTTAAAAGGGG + Intergenic
1047096896 8:121635657-121635679 GAAGAGACGCAATGAATAAGAGG - Intronic
1047299869 8:123604471-123604493 GAAGAAAATCTGTGTACCAGTGG + Intergenic
1047491811 8:125381099-125381121 GAAGAAAATATATGTCTAAAAGG + Intergenic
1047664014 8:127070170-127070192 GATAAAAATCTATGTATAGGTGG - Intergenic
1047806561 8:128367104-128367126 CAAGAAGCTCTATGGATAATAGG - Intergenic
1047902438 8:129438124-129438146 GAAGAAAATTCCTGTATAAGTGG - Intergenic
1047992138 8:130297384-130297406 GAAGAAAATCCACATATAAGTGG + Intronic
1048142252 8:131805823-131805845 AAAAAATCTCTGTGTATAAGTGG - Intergenic
1048337772 8:133515547-133515569 GAAAAAACTTTATGGAAAAGGGG - Intronic
1048684930 8:136893917-136893939 GAAGAAAATCCATATATGAGTGG - Intergenic
1049816668 8:144606292-144606314 GAAGAAAATCCATGTATATGTGG - Intergenic
1050447222 9:5737989-5738011 GAAGAAAATACATGTATAAGTGG + Intronic
1050935495 9:11389827-11389849 GAAGAAAATCTGTGTATAAGTGG + Intergenic
1050975344 9:11929826-11929848 GCAGAAAACCTATGCATAAGTGG - Intergenic
1051318087 9:15865450-15865472 GAAGAAGATCCACGTATAAGTGG - Intronic
1051360796 9:16279919-16279941 GAAGAAAATCCACTTATAAGTGG + Intergenic
1051489698 9:17647856-17647878 GAAGAAAATCTGCATATAAGTGG - Intronic
1051562854 9:18462035-18462057 AAAAAAAATCTGTGTATAAGTGG + Intergenic
1051782702 9:20707737-20707759 GAAGAAAAGCCACGTATAAGTGG + Intronic
1052170383 9:25388199-25388221 TAAGAAATTCTGTGTATAATGGG + Intergenic
1052559430 9:30065473-30065495 GATGAAAATTTGTGTATAAGTGG + Intergenic
1052609390 9:30752290-30752312 GCAGATAGTCTATGAATAAGTGG - Intergenic
1052617952 9:30866978-30867000 GAAGAAAATTCACGTATAAGTGG - Intergenic
1052968082 9:34357044-34357066 GAAGAAAATCTGCCTATAAGTGG + Intergenic
1054740963 9:68805311-68805333 GAAGAAACTCCAGGTATTCGAGG - Intronic
1054946395 9:70800504-70800526 GAAGAAAATCTACATATAAGTGG - Intronic
1055413769 9:76060513-76060535 GAAGAAAATCCATATATAAGTGG + Intronic
1055519185 9:77063074-77063096 GAAAAAAATCTTTGTATAAGTGG - Intergenic
1056085052 9:83139666-83139688 GAAGAAAATCCATATATAAGTGG + Intergenic
1056258083 9:84820669-84820691 GAAAAAAATTTGTGTATAAGCGG + Intronic
1056464680 9:86842196-86842218 GGAGAACATCTATGTATAAGTGG - Intergenic
1056964460 9:91154480-91154502 GAAGAAAATCTGCATATAAGTGG + Intergenic
1058282392 9:103131831-103131853 GAAGAGACTCCATGGATAGGAGG + Intergenic
1058320374 9:103622539-103622561 GAAGAATACTTATGTATAAGTGG - Intergenic
1058392656 9:104513453-104513475 GAAGAAAATCCATGCATAAGTGG - Intergenic
1058579972 9:106445044-106445066 GAAAAAAATTCATGTATAAGTGG - Intergenic
1058607326 9:106736736-106736758 GAAGACAGTCTATGTTTGAGGGG + Intergenic
1058660957 9:107268341-107268363 GAAGATAATTCATGTATAAGTGG - Intergenic
1059024663 9:110613055-110613077 GAAAAAAGTCTGTGTATAAGTGG + Intergenic
1060371827 9:123080902-123080924 GAAAAAAATCCACGTATAAGTGG - Intronic
1061644353 9:131988384-131988406 GAAGAAAATCTGAGTATAAGTGG - Intronic
1185720620 X:2378394-2378416 GAAGAAAATCCACATATAAGGGG - Intronic
1185797266 X:2977125-2977147 GAAGAAAATTCTTGTATAAGTGG - Intergenic
1185948700 X:4406365-4406387 GAAGGAAATCCACGTATAAGTGG + Intergenic
1186029218 X:5348547-5348569 GAAGAAAATCCATGCATGAGTGG - Intergenic
1186040005 X:5465518-5465540 GAAGAAAATCCTTATATAAGTGG - Intergenic
1186089931 X:6035685-6035707 GAAGAAAATCCACATATAAGTGG - Intronic
1186288873 X:8074763-8074785 GAAGAAACTCTGTGTATAAGTGG - Intergenic
1186304422 X:8240155-8240177 GAAGAAAATCCATGTATGAGTGG + Intergenic
1186368775 X:8925428-8925450 GAAGAAAATCCACGTATAAGTGG + Intergenic
1186405215 X:9295875-9295897 GAAGAAAAATTACGTATAAGTGG - Intergenic
1186645437 X:11501894-11501916 GAAGAAAATCTACATACAAGTGG + Intronic
1186729998 X:12399784-12399806 GAAGAAAATTCATATATAAGTGG + Intronic
1186737620 X:12482139-12482161 GAACAAAATCTGTGTATAAGTGG + Intronic
1186748099 X:12591412-12591434 GAAGAAAATCCATGTATATGTGG + Intronic
1186749739 X:12609255-12609277 GAAGAAAATCTATGTATAAGTGG + Intronic
1186812618 X:13205174-13205196 GAAGAAAATCTACATATAAGTGG + Intergenic
1187453025 X:19415613-19415635 AAAAAAAATCCATGTATAAGTGG - Intronic
1187489017 X:19732498-19732520 GAAAAAAATCTACATATAAGTGG + Intronic
1187984789 X:24798340-24798362 GAAGAACATTTATGTATAGGTGG - Intronic
1189192933 X:39126549-39126571 GAAGAAAATCCACGTACAAGTGG - Intergenic
1189512888 X:41681050-41681072 GAAAACAATCCATGTATAAGTGG - Intronic
1189558579 X:42169876-42169898 GAAGAAAATCTGTGTCTAAGTGG + Intergenic
1189681962 X:43526357-43526379 GAAGAAACACAAGGTATAACTGG + Intergenic
1189899651 X:45692965-45692987 GCAGAAACTCTATGTATATGTGG - Intergenic
1189979774 X:46497501-46497523 GAAGAAAATCCACATATAAGTGG + Intergenic
1191025746 X:55911285-55911307 GAAGAAAATCCATGTATAAGTGG + Intergenic
1191102482 X:56746827-56746849 GGAGAAATTCTAAGTATGAGAGG - Intergenic
1192113810 X:68392106-68392128 GAAGAAAATCTTCATATAAGTGG - Intronic
1192459956 X:71308512-71308534 GAAGAAAATCCACATATAAGTGG + Intergenic
1192763000 X:74115217-74115239 GAAAAAGCTCTTTGTATTAGAGG + Intergenic
1193319814 X:80108030-80108052 GAAGAAAATCTGTGTATAAGTGG + Intergenic
1193738700 X:85191835-85191857 GAAGAAAATCTGTGTAAAAGTGG + Intergenic
1193744645 X:85261148-85261170 GAAGAAAATTCATGGATAAGTGG + Intronic
1194190043 X:90824222-90824244 GAAGAAAATACATGTATAAGTGG + Intergenic
1194490445 X:94539838-94539860 GAAGAAAATCTGTATATAAGTGG + Intergenic
1194573941 X:95588049-95588071 GAAGAAAATTCATGTATAAATGG + Intergenic
1195207269 X:102614676-102614698 GAAGAAAATCTGCATATAAGTGG - Intergenic
1195873642 X:109514635-109514657 GAAGAAAATCCATGTATATATGG + Intergenic
1197037641 X:121895741-121895763 GGAGAAAATCCATGTATAAGTGG - Intergenic
1197308745 X:124878073-124878095 GAAGAAAATGTATGTATAAGTGG + Intronic
1197354206 X:125416031-125416053 GGAAAAAATCCATGTATAAGTGG - Intergenic
1198483245 X:137060447-137060469 GAAGAAAATCTATGTATAAGTGG - Intergenic
1198670174 X:139071685-139071707 GGAGAAATTCTATGAATAACAGG - Intronic
1198673373 X:139105566-139105588 GAAGAAACTATGTCTTTAAGAGG - Intronic
1199336973 X:146629870-146629892 GAAGACACACCTTGTATAAGTGG - Intergenic
1199481811 X:148305935-148305957 GAAGAAACTCCATGTATAAGTGG - Intergenic
1199498894 X:148487450-148487472 GAATAAAATCCACGTATAAGTGG - Intergenic
1199568980 X:149248155-149248177 GAAGAAAATCTGTGTATAAGTGG + Intergenic
1199605011 X:149570319-149570341 GAAGAAAATCCATGCATAAGTGG - Intergenic
1199641354 X:149865542-149865564 GAAGAAAGTTCATGTATAACTGG + Intergenic
1200360020 X:155594898-155594920 GAAAAAATTCTGTGTATAAGTGG - Intronic
1200536642 Y:4406341-4406363 GAAGAAAATACATGTATAAGTGG + Intergenic