ID: 930349094

View in Genome Browser
Species Human (GRCh38)
Location 2:50226509-50226531
Sequence GAGGAGAAGCACAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1909
Summary {0: 1, 1: 0, 2: 10, 3: 211, 4: 1687}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930349094 Original CRISPR GAGGAGAAGCACAAGGAGGA GGG Intronic
900103583 1:972975-972997 GAGGAGCAGCCCACGGTGGATGG - Exonic
900120190 1:1045576-1045598 GAGGAGAAGCACAGTGATGGGGG - Intronic
900264968 1:1752908-1752930 GAGGAGGAGGAGGAGGAGGAGGG - Exonic
900427014 1:2585539-2585561 AAGGGGAAGCACTAGGAGGGAGG - Intergenic
900626363 1:3610473-3610495 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
900656977 1:3763264-3763286 GAGGAGGAGGAAGAGGAGGAAGG + Exonic
900725557 1:4214204-4214226 GAGGAGGAGGAGGAGGAGGAAGG - Intergenic
900943074 1:5813717-5813739 GAGGAGGAGGACGAGGAGGAGGG + Intergenic
901060373 1:6469120-6469142 GAGGAGGAGGAGGAGGAGGAAGG - Exonic
901105041 1:6748690-6748712 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901145828 1:7064110-7064132 GAGAAGAAGAAGGAGGAGGAGGG - Intronic
901185289 1:7368958-7368980 AAACAGAAGCAGAAGGAGGAAGG - Intronic
901264919 1:7903041-7903063 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264928 1:7903068-7903090 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264937 1:7903095-7903117 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264946 1:7903122-7903144 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264951 1:7903140-7903162 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264960 1:7903167-7903189 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264965 1:7903185-7903207 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264974 1:7903212-7903234 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264983 1:7903239-7903261 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264988 1:7903257-7903279 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264997 1:7903284-7903306 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265006 1:7903311-7903333 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265011 1:7903329-7903351 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901305879 1:8232361-8232383 GAGGAGGACGAAAAGGAGGAGGG + Intergenic
901414640 1:9108257-9108279 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
901429130 1:9201780-9201802 GAGGAGGAGGAGGAGGAGGAAGG - Intergenic
901447913 1:9319418-9319440 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
901458986 1:9380313-9380335 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
901631062 1:10648364-10648386 GAGGAAGGGCACAAGTAGGAAGG - Intronic
901751705 1:11413945-11413967 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
901773416 1:11542917-11542939 GAGAAGAGGCAGGAGGAGGATGG - Intergenic
901927460 1:12575546-12575568 GAAGAGTAGTACAAGGAAGATGG - Intronic
902388153 1:16087952-16087974 GTGGGGAGGCACAGGGAGGAGGG - Intergenic
902819534 1:18935483-18935505 GAGGAAAAGGACAAAGGGGAAGG - Intronic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903352488 1:22726188-22726210 GAGAAGGAGAAAAAGGAGGAAGG - Intronic
903463553 1:23536067-23536089 TAGGAAAAGCACAAAGAAGATGG - Intergenic
904010052 1:27384075-27384097 TAGGAGAAGCAGATGGGGGAAGG - Intergenic
904273021 1:29362785-29362807 GTGGAGCAGAACAAGGATGAGGG - Intergenic
904286026 1:29453798-29453820 GAGGAGGAGGAGAAGGAGGGGGG - Intergenic
904295184 1:29515711-29515733 GAGGAGCAGGAGGAGGAGGAGGG - Intergenic
904295199 1:29515757-29515779 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
904295393 1:29516937-29516959 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295740 1:29518748-29518770 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295752 1:29518808-29518830 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904319951 1:29690083-29690105 GAGGAGAAGGAAAGTGAGGAAGG + Intergenic
904341941 1:29841177-29841199 GAGGAGAAGCATAAGGTGATTGG - Intergenic
904478994 1:30782547-30782569 GGGGAGACGGACAGGGAGGAAGG + Intergenic
904626089 1:31803816-31803838 GAGAAGAAGGAGGAGGAGGAGGG + Intronic
904801501 1:33096258-33096280 GAGGAGGAGCAGGAAGAGGAGGG + Intronic
904994321 1:34619123-34619145 GAGGAGAGGGAAAGGGAGGATGG + Intergenic
905004449 1:34698599-34698621 GGGGAGCCCCACAAGGAGGAAGG + Intergenic
905124568 1:35707885-35707907 GAGGAGACACAAAAGGGGGAGGG + Intergenic
905237817 1:36562181-36562203 GAGGAAGAGCAGAAGGAGGAAGG - Intergenic
905257366 1:36693465-36693487 GAGGAGAGACAAAAGGAGGAAGG + Intergenic
905260235 1:36712130-36712152 AAGGAGAAGAAAGAGGAGGAAGG - Intergenic
905387357 1:37613914-37613936 GGAGAGAAGGACAAGGAGGAGGG + Intronic
905589132 1:39147028-39147050 GAGGAGGAGAAGAAGAAGGAAGG - Intronic
905970292 1:42136753-42136775 GAGAAGGAGAAAAAGGAGGAGGG - Intergenic
905980561 1:42222001-42222023 GAGGAGGAGGAGAAGGAGAAGGG + Intronic
905980565 1:42222007-42222029 GAGGAGAAGGAGAAGGGGGAGGG + Intronic
906072842 1:43029640-43029662 GAGGAGGAGGACAGGGAGGAGGG - Intergenic
906125632 1:43425460-43425482 GTCGAGAAGCTAAAGGAGGAAGG - Exonic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
906180854 1:43817625-43817647 GAGGAGAAGGAGGAGGAGAAGGG - Intronic
906180868 1:43817697-43817719 GAGGAGAAGGAGAAGGAAGAAGG - Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906192113 1:43905280-43905302 GAAGAGGAGCAGAAGGAGGCAGG - Intronic
906192134 1:43905352-43905374 GAAGAGGAACAGAAGGAGGAGGG - Intronic
906192145 1:43905391-43905413 GAAGAGGAGCAGAAGGGGGAGGG - Intronic
906192313 1:43906003-43906025 GAAGAGGAACAGAAGGAGGAGGG - Intronic
906192456 1:43906509-43906531 GAAGAGGAGCAGGAGGAGGAGGG - Intronic
906192485 1:43906638-43906660 GAAGAGGAGCAGGAGGAGGAGGG - Intronic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
906646579 1:47479393-47479415 GAGGAGAAGGACAAGGCAGCGGG - Intergenic
906656038 1:47549036-47549058 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
906668095 1:47635818-47635840 GAAGAGAAGGAGGAGGAGGATGG - Intergenic
906764803 1:48418856-48418878 GAGGGGAAGGAGAGGGAGGAAGG + Intronic
906913043 1:49977155-49977177 GAGGTGAAGCTCATGGAAGATGG - Intronic
906913049 1:49977178-49977200 GAGGTGAAGCCCATGGAAGAAGG - Intronic
906913078 1:49977339-49977361 GAGGTGAAGCTCATGGAAGATGG - Intronic
907159773 1:52361538-52361560 GAGGAGGAGGAGGAGGAGGAAGG - Exonic
907303528 1:53502190-53502212 GAAGAGAGGGACAAGGAGGCGGG + Intergenic
907306899 1:53518244-53518266 GAGGAGCAGCACTAGCAGCAGGG + Intronic
907621282 1:55983437-55983459 AAGGAGAAGGACAAGGCGAAGGG + Intergenic
907787286 1:57625240-57625262 CAGGAGTAGAAGAAGGAGGAGGG - Intronic
907855214 1:58296579-58296601 GAGGAAGAGCACAAGGGTGAAGG - Intronic
908349138 1:63267006-63267028 GAGGAGGAGGAAGAGGAGGAGGG + Intergenic
908349165 1:63267111-63267133 GAGGAGAAGGAGGAGGAGGTGGG + Intergenic
908390591 1:63679951-63679973 GAGGAGAAGCAAAAAGAGAAGGG - Intergenic
908395913 1:63725542-63725564 GAGCAGAAGGAAAAGGAGCAAGG + Intergenic
908605123 1:65790448-65790470 GAGCAGAAGCAGAAGGAAGAAGG - Intergenic
908657145 1:66400505-66400527 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
908812890 1:68002011-68002033 GAGGAGAAGGAGGAGGAGAAAGG - Intergenic
909377792 1:74960041-74960063 GAGCAGAAGCAAAAGAAAGAGGG - Intergenic
909561834 1:77016181-77016203 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561842 1:77016205-77016227 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561850 1:77016229-77016251 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561858 1:77016253-77016275 GAGGAGATACAGGAGGAGGAGGG - Intronic
909779060 1:79520066-79520088 GAGGAGGAGAAAGAGGAGGAAGG + Intergenic
909779082 1:79520191-79520213 GAGGAGGAGAAAGAGGAGGAAGG + Intergenic
910278739 1:85475323-85475345 GAGGAGAAGGGGGAGGAGGAGGG + Intronic
910285184 1:85545775-85545797 GAGGAGATGCAGAGGGAGGAGGG + Intronic
910286120 1:85556141-85556163 GAGAAGGAGGAGAAGGAGGAAGG - Intronic
910333029 1:86097591-86097613 GAGGAGAAGGAGAAGGACGAGGG - Intronic
910479350 1:87641462-87641484 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
910484787 1:87701244-87701266 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
910490415 1:87763466-87763488 GAGGAGAAAAAGAAGGAGAAGGG + Intergenic
911184154 1:94886614-94886636 GAGCAGAACCACAAGCTGGAGGG - Intronic
911474309 1:98357482-98357504 GAGGAGGAGGAGAAGGAGGGGGG - Intergenic
911557415 1:99361690-99361712 GAGAAGCAGCACCAGGACGATGG + Intergenic
911594944 1:99788831-99788853 GAGTAGAAACAGAATGAGGAGGG - Intergenic
911636188 1:100238387-100238409 GAGGAGGAGGAAGAGGAGGAAGG - Intronic
911820311 1:102411259-102411281 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
911910191 1:103624361-103624383 GGGCAGAAGCAAAAGGATGATGG + Intronic
911913287 1:103663151-103663173 GGGTAGAAGCAAAAGGATGATGG + Intronic
911915167 1:103688796-103688818 GGGTAGAAGCAAAAGGATGATGG - Intronic
911917609 1:103718486-103718508 GGGCAGAAGCAAAAGGATGATGG + Intronic
911920700 1:103757289-103757311 GGGTAGAAGCAAAAGGATGATGG + Intronic
911988092 1:104657342-104657364 GAGGAGAAGAAAAAGTAGGGAGG - Intergenic
911991280 1:104699738-104699760 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
913163947 1:116168387-116168409 GAGGAGTAGAACAAAGAGGCGGG + Intergenic
913223401 1:116677636-116677658 GACGGGCAGCAGAAGGAGGAAGG - Intergenic
913305403 1:117425109-117425131 GAGGAGAAGGGAAAGGGGGAAGG + Intronic
914704881 1:150162446-150162468 GAGGAGAAGCACTGGGAGGAAGG - Intronic
914814396 1:151052891-151052913 GAGGAGAAGGGCAGGGAGGTAGG + Exonic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915049705 1:153055708-153055730 GAGGAGGAGGAGGAGGAGGATGG + Intergenic
915086314 1:153391242-153391264 TAGGAGAAGCGGAAAGAGGAAGG + Intergenic
915301066 1:154951926-154951948 GAGGAGAAGTGCAAGGAGAAGGG + Intronic
915393123 1:155562313-155562335 GAGGAGAAGGGAAAGGTGGAAGG + Exonic
915409278 1:155688219-155688241 GAGGAGAAGGGAAAGGTGGAGGG + Exonic
915462217 1:156076917-156076939 GAGGAGAAGAGCACGGAGGTGGG + Exonic
915480455 1:156181021-156181043 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
915515714 1:156411321-156411343 CAGCAGAAGCACAATGCGGAGGG + Intronic
915713043 1:157919613-157919635 GTGGGGAAGCAGAAGCAGGAGGG - Intergenic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
915935467 1:160087894-160087916 GAGGAGGAGGAGGAGGAGGAAGG + Exonic
916242913 1:162657796-162657818 GAGGAGAAGGGAAAAGAGGAAGG - Intronic
916254242 1:162770276-162770298 GAAGAGAAGAGCAAGGAGAAAGG - Intronic
916261263 1:162844650-162844672 GAGTAGATGCTCCAGGAGGAGGG + Intronic
916305742 1:163329589-163329611 GAGCAAAAGCACAATGGGGAAGG + Intronic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
916385549 1:164263470-164263492 GAAGAGAAGAACAAGGTAGATGG - Intergenic
916412306 1:164558902-164558924 GAGGAGGAGCTGAAGGAGGCTGG + Intronic
916612023 1:166400999-166401021 GAGGAGGAGGAAGAGGAGGAAGG - Intergenic
916797512 1:168180328-168180350 GAGGAGAAGCAGATGGGGGCAGG + Intronic
917730309 1:177868558-177868580 GAGGAGCAGGACAAGGACAAGGG - Intergenic
917920794 1:179747970-179747992 GAGGAAGAGGACTAGGAGGAGGG + Intronic
918953574 1:191174388-191174410 GAGGAGGAGAACAAAGAGGAGGG + Intergenic
919016795 1:192048670-192048692 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
919367132 1:196675818-196675840 AAGGAGGAGGAGAAGGAGGAAGG + Intronic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919516741 1:198534289-198534311 GAGCAGACACACAGGGAGGAAGG + Intronic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
919763359 1:201111950-201111972 GAGGAGGAGGAAGAGGAGGAGGG - Intronic
919913630 1:202127061-202127083 GAGGCAAAGAACAAGGGGGAAGG + Intronic
920375204 1:205504598-205504620 GAGGAGGAGGAGGAGGAGGAAGG - Exonic
920843836 1:209577003-209577025 GAGGAGCAGCACCTGGAGGTAGG + Intergenic
920907913 1:210188937-210188959 GAGGAGCAGCCTAGGGAGGAGGG - Intergenic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921734505 1:218612007-218612029 GAGGAGAAGGAGAAGGGGGTAGG - Intergenic
921804807 1:219442165-219442187 GGGGAGAAAAACAGGGAGGAAGG - Intergenic
921945641 1:220884258-220884280 AAGGACAAGGACAAGGAGGCTGG + Exonic
921974145 1:221182767-221182789 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
921993827 1:221396073-221396095 GAAGAGATGGACAAGGAGGAAGG - Intergenic
922213263 1:223501200-223501222 GAGGGAAAGGAAAAGGAGGAGGG - Intergenic
922213268 1:223501218-223501240 GAGGAGGAGGAGAGGGAGGAGGG - Intergenic
922213277 1:223501245-223501267 GAGGAGAAGGAGGAGTAGGAGGG - Intergenic
922241005 1:223755524-223755546 GAGGATGAGGACGAGGAGGATGG + Exonic
922516377 1:226211144-226211166 GAGGATAAGGACAAGGACAAGGG - Intergenic
922651339 1:227341601-227341623 AAGGAGAAGCAGAGGGATGAGGG + Intergenic
922658515 1:227407645-227407667 GAGGAGGAAAAGAAGGAGGAGGG + Intergenic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
922936290 1:229425707-229425729 AAGGAGAAGAAAGAGGAGGAGGG + Intergenic
923072356 1:230577598-230577620 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923072378 1:230577679-230577701 GAGGAGAAGAAGGAGGAGGAAGG - Intergenic
923072397 1:230577757-230577779 GAGGAGAAGAAGGAGGAGGAGGG - Intergenic
923072437 1:230577889-230577911 AAGGAGAAGAAGAAGGAGAAGGG - Intergenic
923120018 1:230981125-230981147 GAGGTGAAGCAAAAGCAGAAAGG - Intronic
923254621 1:232210976-232210998 GAGGAGAAGCACAGTGTGGTTGG + Intergenic
923355137 1:233147463-233147485 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
923442612 1:234035648-234035670 GAGTAAAAGCACAAAGAGGTAGG - Intronic
923534425 1:234838168-234838190 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
923567180 1:235084988-235085010 GAGGAGGTGGACAAGGAGGAGGG + Intergenic
923658542 1:235939123-235939145 GAGGAGGAGGAGAAGGAGGGGGG + Intergenic
923754407 1:236777558-236777580 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
924010743 1:239662951-239662973 GAGGAGAAGGAAGAGGAGAAAGG - Intronic
924448775 1:244159018-244159040 GAGGAGAAGGAGAAGAAGAAGGG - Intergenic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1062925754 10:1314441-1314463 GAGGAGGAGGAGGAGGAGGAAGG - Intronic
1063051813 10:2457744-2457766 GAGGAGAGGCACCCTGAGGAGGG + Intergenic
1063606795 10:7529647-7529669 GAGGAGAGGGAAAGGGAGGAGGG + Intergenic
1063729636 10:8681611-8681633 GAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1063830354 10:9945531-9945553 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1063916055 10:10883872-10883894 GAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1064067554 10:12195702-12195724 GAGGAGAAGAAGAAGGGGAAAGG - Intronic
1064272711 10:13879793-13879815 GAGGAGGAGGAGGAGGAGGAAGG - Intronic
1064305127 10:14158639-14158661 GAGGAGAAGGAGGAGGAGAAGGG + Intronic
1064312879 10:14227215-14227237 GAAGAGAAGGAGGAGGAGGAAGG - Intronic
1064395931 10:14981920-14981942 GAGGAAAAGCGCAAAGAGAATGG - Intronic
1064993259 10:21274938-21274960 GAGGAGAAGGAAGAGGAGGAGGG + Intergenic
1065297330 10:24289437-24289459 GAGGAGAAGGTGGAGGAGGAGGG + Intronic
1065377463 10:25058155-25058177 GAGGACAAGTAGAGGGAGGAAGG - Intronic
1065967178 10:30779802-30779824 GAGAGGAAGCACAAGGAGGCAGG - Intergenic
1066074081 10:31855000-31855022 GAGGAGGAGCAGGAGGAGGATGG + Intronic
1066169710 10:32828413-32828435 AAGGAGAAGAAGAAGAAGGAAGG + Intronic
1066214399 10:33272497-33272519 GAGGAGAAAGAGGAGGAGGAGGG + Intronic
1066368363 10:34798342-34798364 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
1066370389 10:34814773-34814795 GAGGAGAGGCGCAGGGAGGCGGG - Intronic
1066547481 10:36516479-36516501 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067545313 10:47188463-47188485 GAGGAGAAGGAGAAGGAAGTGGG + Intergenic
1067558168 10:47286651-47286673 GAAGAGAAGGAGGAGGAGGAGGG - Intergenic
1067799600 10:49349923-49349945 GAGGTGGAGCAGAAAGAGGAAGG + Intergenic
1067807867 10:49405758-49405780 GAGGAGAGAGAAAAGGAGGAAGG - Intergenic
1067842025 10:49688640-49688662 GAGGATAGGCAGAAGCAGGAGGG - Intronic
1067996087 10:51274872-51274894 GAGTACAAACACATGGAGGATGG + Intronic
1068016643 10:51525164-51525186 GAAGAGAAGGAAGAGGAGGAGGG + Intronic
1068056380 10:52016869-52016891 GAGAAGAAGGAAAGGGAGGAGGG + Intronic
1068122116 10:52791764-52791786 GAGGAGGGGGAGAAGGAGGAAGG + Intergenic
1068152456 10:53150837-53150859 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1068203904 10:53822460-53822482 GAGGAGAAATAGGAGGAGGAGGG + Exonic
1068510055 10:57954402-57954424 GAGGAGGAGGAGAAGAAGGAGGG - Intergenic
1068948339 10:62752176-62752198 GAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1069291552 10:66786371-66786393 GGGTAGAAGCAAGAGGAGGAAGG - Intronic
1069668746 10:70183624-70183646 GAGGAGGAGGAGAAGGAGGAAGG + Intergenic
1069689148 10:70338194-70338216 AAACAGAAGGACAAGGAGGAGGG - Intronic
1069718521 10:70535600-70535622 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1070028183 10:72651644-72651666 GAGGAGGAGGAAGAGGAGGAGGG + Intergenic
1070051131 10:72891003-72891025 GAGCTGAAGTTCAAGGAGGAGGG - Intergenic
1070339726 10:75486711-75486733 GAGAGAAAGCCCAAGGAGGAGGG - Intronic
1070444615 10:76484153-76484175 GAGAGGAAGAAGAAGGAGGATGG - Intronic
1070511638 10:77166591-77166613 GAGGGGAAGGACATGGAGGAGGG + Intronic
1070906335 10:80076762-80076784 GAGGAGAAGAATAAAGAGGGTGG + Intergenic
1070914108 10:80141841-80141863 GAGGTGAAGCCCAGGGAGGAAGG - Intronic
1071024559 10:81097465-81097487 GAGGGAAAGAATAAGGAGGAAGG - Intergenic
1071093292 10:81945313-81945335 GAGGAGGAGTAAGAGGAGGAAGG - Intronic
1071110774 10:82152766-82152788 AAGGAGAAGGAGAAGAAGGAAGG - Intronic
1071503935 10:86221885-86221907 GAGGAGGAGAAGGAGGAGGAGGG - Intronic
1072092093 10:92138422-92138444 GAGGAGCAGCAGGAGGCGGAAGG + Intronic
1072156730 10:92730525-92730547 GAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1072456909 10:95584460-95584482 AAGGAGTAGAACAAGGAGTATGG - Intergenic
1072834353 10:98695270-98695292 GAGGAGAAGGAGGACGAGGACGG + Intronic
1072841355 10:98777750-98777772 AAGAAGAAGGACAAGGAGGCAGG - Intronic
1073048949 10:100655867-100655889 AAGGAGGAGGACGAGGAGGAAGG - Intergenic
1073164172 10:101429523-101429545 GAGGAGGAGGAGGAGGAGGAAGG - Intronic
1073340915 10:102743990-102744012 GAGGAGAGGGAGGAGGAGGAGGG + Exonic
1073513887 10:104060360-104060382 GAGAAGAAAGAGAAGGAGGAGGG + Intronic
1073855266 10:107666241-107666263 GAGGAGGAGAAAGAGGAGGAGGG - Intergenic
1074169613 10:110919595-110919617 GAGGAGGAGGAAGAGGAGGAAGG + Exonic
1074532241 10:114305639-114305661 GAGGAGATGCAGATGCAGGAGGG + Intronic
1074532268 10:114305726-114305748 GAGGAGATGCAGATGCAGGAGGG + Intronic
1074532403 10:114306211-114306233 GAGGAGATGCAGATGCAGGAGGG + Intronic
1074570858 10:114622749-114622771 GAGGAGAAGGAAGAAGAGGAGGG - Intronic
1074691126 10:116005054-116005076 GAGGAGAAGGAGATGGAGGGGGG - Intergenic
1074732160 10:116390739-116390761 GAGGAGAAGGAGGAGGAAGAAGG + Intergenic
1074732174 10:116390825-116390847 AAGGAGAAGAAGAAGAAGGAAGG + Intergenic
1075575134 10:123572518-123572540 GAGGAGGAGGACGAGGAGGAAGG + Intergenic
1075644162 10:124086653-124086675 GAGGAGGAGGAGGAGGAGGAAGG - Intronic
1076077354 10:127545062-127545084 GAGGAGAGGGAAAAGGAGGGAGG - Intergenic
1076319033 10:129564695-129564717 GAGGAGGAGGAAGAGGAGGAAGG - Intronic
1076457127 10:130608267-130608289 TGGGAGAAGCACCAGGGGGAGGG - Intergenic
1076489253 10:130845838-130845860 GAGGATGAACACAAGGAGGGTGG + Intergenic
1076568591 10:131415921-131415943 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1076634727 10:131874892-131874914 GAGGAGGAGCTCGAGGAGGAGGG + Intergenic
1076809181 10:132877912-132877934 AAAGAGAAGGACAAGGAGAAGGG - Exonic
1076809432 10:132878943-132878965 GAGGAGCAGGACAAGGAGGGGGG + Intronic
1077165863 11:1137999-1138021 GAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1077360371 11:2138070-2138092 GAGGAGGAGGAGGAGGAGGACGG - Intronic
1077392592 11:2306993-2307015 GAGGAGAAGAAAGAGGGGGAGGG + Intronic
1077392601 11:2307022-2307044 GAGGAGGAGGAAGAGGAGGAAGG + Intronic
1077491712 11:2863857-2863879 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1077621007 11:3723408-3723430 GATGAGAATCACCAGCAGGATGG - Exonic
1077640621 11:3878188-3878210 GGGGAGAAGGGAAAGGAGGAGGG + Intronic
1077924437 11:6666746-6666768 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1078001410 11:7499680-7499702 TAGGAGAAGCAGAAGGAACATGG + Intronic
1078048552 11:7940775-7940797 GAGAAAAAGCATAAGGAGGAAGG + Intergenic
1078135795 11:8650450-8650472 GAGCAGAAGGAAAAGGAGGAAGG + Intronic
1078245262 11:9568412-9568434 GAGAACAAGCATAAGGAGAAAGG + Intergenic
1078308012 11:10210377-10210399 GAGGAGGAAGAGAAGGAGGAAGG + Intronic
1078413780 11:11148860-11148882 GGGGAGAAGCAGAATGAGGCAGG - Intergenic
1078468146 11:11565524-11565546 GAGCAGAAGAAAAAGGAGGCTGG + Intronic
1078473955 11:11614375-11614397 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1078659662 11:13277266-13277288 GGGGAGAAGAAGAAGGAGGAGGG + Intronic
1079373210 11:19869831-19869853 GCAGAGAAGAACAATGAGGAAGG + Intronic
1079528184 11:21415739-21415761 GAGGTTAAGCAAAAGGAGAAGGG + Intronic
1079689243 11:23401747-23401769 TAGGAGAAGCAAAACTAGGATGG - Intergenic
1079703936 11:23589047-23589069 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1079834072 11:25309045-25309067 GAGCAGGAGCAAGAGGAGGAAGG - Intergenic
1079885021 11:25976731-25976753 GAGGAGAAGCAGAAAGAGAAGGG + Intergenic
1080478364 11:32619857-32619879 GAAGGGAAGGAGAAGGAGGAGGG + Intronic
1081135510 11:39435639-39435661 GAAGACAAGCACAAGAAAGATGG + Intergenic
1081997867 11:47376662-47376684 GGGGAGGAGGACAGGGAGGAGGG - Intronic
1082669795 11:56020878-56020900 GAGGAAGAGCAGGAGGAGGAGGG + Intergenic
1082762060 11:57136786-57136808 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1082775221 11:57239444-57239466 CAGGAGAAGAACCAAGAGGATGG + Intergenic
1082892418 11:58154159-58154181 AAGGAGGAGGAGAAGGAGGAGGG + Intronic
1083045318 11:59729249-59729271 CAGGAGAACCACAATGAGGTGGG - Intronic
1083169291 11:60913371-60913393 GAGGAGAAGCAGCTGGATGAGGG - Intergenic
1083270464 11:61569714-61569736 GAGAGGAAGGACAGGGAGGAAGG + Intronic
1083573437 11:63772154-63772176 GGGAAGAAGGAGAAGGAGGAGGG + Intergenic
1084093760 11:66896572-66896594 GAGCAGAGGGGCAAGGAGGATGG + Intronic
1084104869 11:66974969-66974991 GAGAAGGAGGAGAAGGAGGAGGG + Intergenic
1084287299 11:68140589-68140611 AAGGAGGAGCTCAAGGAGGCAGG + Intergenic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1084859893 11:72011446-72011468 GAGGAAGAGCACAGGGAGTAGGG + Intronic
1085197615 11:74682034-74682056 GAGGAGGAGAACAAGGCGGGAGG - Intergenic
1085244484 11:75089048-75089070 GGAGAGAAGCACCAGGAGAAGGG + Exonic
1085249240 11:75131315-75131337 GGAGAGAAGCACCAGGAGAAGGG + Intronic
1085502887 11:77039174-77039196 GCTGAGAAGGACAAGGAAGAAGG + Intronic
1085745809 11:79113242-79113264 GAGGAGAAGCAAGAGAGGGAAGG + Intronic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086154243 11:83648236-83648258 GAGAGGAAGTACAAAGAGGATGG + Intronic
1086316665 11:85602103-85602125 GAGGAGAAGCAGACTGAGGGTGG - Intronic
1086550992 11:88051423-88051445 TAGGTGGAGCACAAGCAGGACGG + Intergenic
1086775519 11:90827330-90827352 GAGGAGGAATACAAAGAGGATGG - Intergenic
1086890025 11:92246554-92246576 GAGGAGGAGAAGAAGGAAGAAGG + Intergenic
1086910060 11:92461703-92461725 GAGGTGAGGCACAGGGAAGAGGG + Intronic
1086952596 11:92906235-92906257 GAGGAAAAGGAAGAGGAGGAGGG + Intergenic
1087058144 11:93953264-93953286 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1087512419 11:99114462-99114484 GAAGAAAAGGAGAAGGAGGAAGG - Intronic
1088047610 11:105472782-105472804 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1088462048 11:110092862-110092884 GAGGAGAAGGAAAAGAGGGAAGG + Intergenic
1088645450 11:111913216-111913238 GAGGAGGAGAAGGAGGAGGAGGG - Intronic
1088815841 11:113420179-113420201 GAGGAGGAAGACAGGGAGGAAGG - Intronic
1089074428 11:115727057-115727079 GAGGAGGAGGAAGAGGAGGAAGG + Intergenic
1089118861 11:116117855-116117877 GTGGAGAAGCACAGGGAAGGAGG + Intergenic
1089217548 11:116843928-116843950 GTGGAGAAGGACAAGGTGCATGG + Intronic
1089384254 11:118057639-118057661 TGGGAGAAGAACAAGGATGAAGG + Intergenic
1089593768 11:119561554-119561576 GAGGGGAAGGAAAAAGAGGAAGG - Intergenic
1089610282 11:119664967-119664989 GAGGAGGAGGAGGAGGAGGAGGG - Exonic
1089634238 11:119802081-119802103 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1089690281 11:120182862-120182884 GAGGAGGAGGAGGAGGAGGAAGG + Intronic
1089711643 11:120319130-120319152 AAAGAGAAACACAGGGAGGAAGG - Exonic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090464628 11:126923293-126923315 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464635 11:126923344-126923366 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1090606123 11:128424552-128424574 GAGGGGCAGCACCAGGGGGAAGG + Intergenic
1090622450 11:128572993-128573015 TACAGGAAGCACAAGGAGGAGGG + Intronic
1090838845 11:130472680-130472702 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1090848613 11:130550835-130550857 GAGGAGGAGGAATAGGAGGAAGG - Intergenic
1090892710 11:130940398-130940420 AAGGAGAAGAACAAGGTGGAAGG + Intergenic
1090927036 11:131258544-131258566 TAGGAGCAGCCCAGGGAGGAGGG + Intergenic
1090934151 11:131326931-131326953 GAGGAGAGGCATCAAGAGGATGG - Intergenic
1090990020 11:131808743-131808765 GAGAAGCAGCACAAATAGGAGGG + Intronic
1091209171 11:133842118-133842140 GAGGAGAAGGGCCAGGTGGAGGG + Intronic
1091332736 11:134743445-134743467 GAGGAGAAACACAGTCAGGAGGG - Intergenic
1091337143 11:134780705-134780727 GAGAAGAAGGAGAAAGAGGAGGG - Intergenic
1091398920 12:171198-171220 GAGAAGAAGAACAAGGGGGCAGG - Intronic
1091635553 12:2194102-2194124 GAGGAGCAGGAGGAGGAGGACGG - Intronic
1091651423 12:2313153-2313175 GTGGAGAAGCCCAAGCTGGATGG - Intronic
1091687355 12:2572826-2572848 GAGGAGGAAGAGAAGGAGGAGGG - Intronic
1091832304 12:3558239-3558261 GAGGAGAAGGAAGGGGAGGAAGG - Intronic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1092222511 12:6724544-6724566 GATGGGAAGCACAAGGCTGAGGG - Intronic
1092989455 12:13881116-13881138 GAGGAATAGAACAAAGAGGATGG - Intronic
1093508374 12:19896631-19896653 GAGGAGGAGGAAGAGGAGGAGGG - Intergenic
1093561974 12:20552514-20552536 GAGGAGGAGCAGCAGGAGGGGGG + Intronic
1093611469 12:21164401-21164423 GAGGAGAACCAACAGGAGGTGGG - Intronic
1093918317 12:24831099-24831121 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1094076987 12:26488068-26488090 CAGGAGAAGCAGTAGGAGGTAGG + Intronic
1094351211 12:29527422-29527444 GAGGAGAAGCACAAGGTATGTGG + Intronic
1095196880 12:39329591-39329613 GAGGAGAAGCAAGAGAGGGAGGG + Intronic
1096028624 12:48390652-48390674 CAGGAGATGCTCAAGGAGAATGG - Intergenic
1096152841 12:49325467-49325489 GAGGAGAAGGAAAAGGAAGGGGG - Intronic
1096528358 12:52227873-52227895 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096558596 12:52419494-52419516 GAGGAGAGGAACAGGGAGAAAGG + Intergenic
1096595024 12:52689515-52689537 GAGGAGGAGGAAGAGGAGGAAGG + Intergenic
1096648974 12:53052774-53052796 GAGGAGAATGAGGAGGAGGAAGG + Intronic
1096694123 12:53338117-53338139 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1096717353 12:53499491-53499513 GAGGAGAAGGAGGAGGAGGCGGG - Intronic
1096721484 12:53526315-53526337 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1097091390 12:56508153-56508175 GAGGAGAAGAAGAAGGAAGAAGG - Intergenic
1097616641 12:61891682-61891704 TAGGAGGAGGAGAAGGAGGAGGG + Intronic
1097794223 12:63844655-63844677 GAGGAGAAGTAGGAGGAGGAGGG - Exonic
1097863012 12:64536626-64536648 AAGGAGAAGCACATGGAATAAGG + Intergenic
1098035642 12:66299608-66299630 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1098070413 12:66668538-66668560 GAGGAGGAGGGGAAGGAGGAAGG + Intronic
1098116545 12:67184733-67184755 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098450610 12:70614030-70614052 GAGGAAAAGGAGAAGGAGGAGGG + Intronic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098588981 12:72187517-72187539 GAGGAGGAGGAGGAGGAGGATGG + Intronic
1098595870 12:72272722-72272744 GAGGAGGAGGAGGAGGAGGAGGG + Exonic
1098603188 12:72358288-72358310 GAGGAGGAGAAGAAAGAGGAGGG - Intronic
1098622072 12:72613758-72613780 GAGAAGGAGCAGAAGGAGGAGGG + Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098860163 12:75700325-75700347 GAGGAGGAGGAGTAGGAGGAGGG + Intergenic
1098918459 12:76280868-76280890 GAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1099079426 12:78157810-78157832 GAGGAGAAAAAGAAGGAAGAGGG + Intronic
1099163838 12:79276934-79276956 GAGAAGAAGAAGAAGGAAGAAGG + Intronic
1099239015 12:80116345-80116367 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1099643391 12:85319524-85319546 GAGGAGGAGGACAAAGAGGAGGG - Intergenic
1099868076 12:88309543-88309565 GAGGAGAAAGAGAAGGAGGAGGG - Intergenic
1099959182 12:89380414-89380436 GAGGAGGAGGAGAAGGGGGAGGG - Intergenic
1100098749 12:91076588-91076610 GAGGAGAAGGAGACGGAGAAGGG + Intergenic
1100449926 12:94696063-94696085 GAGGAGCAGCAGCAGGGGGAAGG + Intergenic
1100550736 12:95644376-95644398 AAGGAGAAGAAGAAGGGGGAAGG - Intergenic
1100550763 12:95644462-95644484 GAGGAGGAGCAGGAGGAAGAGGG - Intergenic
1100661287 12:96701771-96701793 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1100673572 12:96842745-96842767 GAGAAGAGGAAAAAGGAGGAAGG - Intronic
1100677657 12:96885852-96885874 GGGGAGAAGGAGGAGGAGGAAGG - Intergenic
1101152354 12:101894823-101894845 GAGGAGAAGCGCTGGGAAGAAGG - Intronic
1101234849 12:102778150-102778172 GAGGAGAAAGAGAAGGAGAAGGG - Intergenic
1101746714 12:107547204-107547226 GAGAAGAAGGAGAAGGGGGAGGG + Intronic
1101837738 12:108306997-108307019 GGGGAGAGGCACAAGCTGGATGG - Intronic
1101901192 12:108792395-108792417 GAGGAGACGGAAAGGGAGGAGGG - Exonic
1102180134 12:110906325-110906347 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1102258398 12:111429049-111429071 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1102704865 12:114872256-114872278 GAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1102709878 12:114916547-114916569 GAGGGGAAGAAGAAGGAGGAAGG - Intergenic
1102808097 12:115799708-115799730 GAGGAGGAGGAAGAGGAGGAGGG + Intergenic
1102822962 12:115923841-115923863 GAGGAGAAGGAGAAGGGGGTGGG - Intergenic
1102823068 12:115924443-115924465 GAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1102887670 12:116534065-116534087 GGGGAGAAGGAGGAGGAGGAGGG - Intergenic
1102974966 12:117200150-117200172 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1103080936 12:118023457-118023479 GAGGAGAAGGCGGAGGAGGAGGG + Intronic
1103131954 12:118477026-118477048 GAGGAGAAAGAAAGGGAGGAAGG - Intergenic
1103163230 12:118748459-118748481 GAGGAGGAGAAGAAAGAGGAGGG + Intergenic
1103410858 12:120710547-120710569 GAGGAGAAGAAGAAGGCGGGCGG + Exonic
1103563372 12:121803957-121803979 GAGGAGGAGGAAGAGGAGGAGGG + Intergenic
1103851560 12:123936920-123936942 CAAGAGAAGCAGAAGGAGAATGG + Exonic
1103904064 12:124318549-124318571 GAGGAGAAGCTGCAGGAGGTCGG - Intergenic
1103926473 12:124426295-124426317 GAGGAGAAGCACAGAGACAAAGG + Intronic
1104239266 12:126971712-126971734 GGGGAGAAAGAGAAGGAGGAAGG - Intergenic
1104616356 12:130273306-130273328 GAGGAGGAGAGGAAGGAGGAGGG - Intergenic
1104616408 12:130273509-130273531 GAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1104637436 12:130447073-130447095 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1104721876 12:131048944-131048966 GAAAGGAAGCACAAGGAGAATGG + Intronic
1104903195 12:132200054-132200076 GAGTAGAAGCACAGGGAGGCTGG + Intronic
1104998501 12:132673995-132674017 GGGGAGAGGCCCAAGGAGGTGGG - Intronic
1105344231 13:19559569-19559591 GAGGAGGAGCAAAGGGAGCATGG + Intergenic
1105519177 13:21116242-21116264 GAGCAGGACCACAGGGAGGAAGG - Intergenic
1105535800 13:21262005-21262027 GAGGAGGAGCAAAGGGAGCATGG - Intergenic
1105544861 13:21343982-21344004 GAGGAGGAGAAGAAGGAGAAGGG - Intergenic
1105826202 13:24125718-24125740 GAGGTGAGGAATAAGGAGGAGGG + Intronic
1105967724 13:25399723-25399745 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1106042063 13:26103094-26103116 GAGGGCAAGCAGAAGCAGGATGG + Intergenic
1106243061 13:27925387-27925409 GAGGAGGAGGAGAAAGAGGAGGG - Exonic
1106358477 13:29007614-29007636 GAGGAGGAGGAGAAAGAGGAGGG - Intronic
1106389962 13:29325504-29325526 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1106525750 13:30539856-30539878 GAGGAAAAGAAAAAGAAGGACGG - Intronic
1107106620 13:36650040-36650062 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1107795466 13:44046933-44046955 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1107824711 13:44318111-44318133 GAGGAGAATAACACCGAGGATGG + Intergenic
1108083130 13:46757766-46757788 GAAGAGAGGGACAGGGAGGAAGG + Intergenic
1108216255 13:48187689-48187711 GAGGGGGACCACAAAGAGGAAGG + Intergenic
1108320363 13:49283657-49283679 CAAGAGAAGCAGAAGGAGGCAGG + Intronic
1108698594 13:52924829-52924851 GAGGAGAGGCAAAAGCTGGAAGG + Intergenic
1108717062 13:53091566-53091588 GAGGAGAAGCAAAGTGGGGAGGG + Intergenic
1108753304 13:53471112-53471134 GAGGAGAATTACAATGAGCATGG - Intergenic
1108892956 13:55284703-55284725 AAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1108923077 13:55700943-55700965 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1109149152 13:58823140-58823162 GAGCAGAAGAACAAGGTGGAAGG + Intergenic
1109757119 13:66775529-66775551 GAGGAGGAGAAGAAAGAGGAGGG - Intronic
1110041291 13:70762383-70762405 GAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1110367703 13:74706025-74706047 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1110627412 13:77666873-77666895 GAGGAGGAGCAGAAGGAAGTTGG + Intergenic
1110637552 13:77783395-77783417 GAGGAGAAGGAGAGGGAGGAGGG + Intergenic
1110666159 13:78119493-78119515 GAGGAGGAGGACAAGGAGGGAGG - Intergenic
1110860555 13:80341192-80341214 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1111396468 13:87673486-87673508 GCGGGGAAGCACAGGGAGGGAGG + Intronic
1111622851 13:90746719-90746741 GAGGAAGAGGAGAAGGAGGAGGG - Intergenic
1111854825 13:93624531-93624553 GAGGAAAACCACAAGGATGCTGG - Intronic
1111912709 13:94329769-94329791 GAGGAGGAGGAGTAGGAGGAAGG - Intronic
1111954497 13:94741801-94741823 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1112164729 13:96906148-96906170 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1112203973 13:97305898-97305920 GAGGAGCGGAACAGGGAGGAAGG + Intronic
1112490766 13:99861234-99861256 GAGGAGGAGGAGGAGGAGGATGG + Intronic
1112542282 13:100326671-100326693 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
1112622628 13:101067260-101067282 GAGGAGGTGGACGAGGAGGAGGG + Intronic
1112622660 13:101067347-101067369 GAGGAGGAGGAGTAGGAGGAAGG + Intronic
1112733095 13:102388744-102388766 GAGGGGCAGTACTAGGAGGAAGG - Intronic
1112884510 13:104152082-104152104 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1113163936 13:107416428-107416450 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
1113166272 13:107447149-107447171 AAGGAGAAGAGGAAGGAGGAAGG - Intronic
1113200930 13:107867123-107867145 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1113433318 13:110268834-110268856 CAGGTGAGACACAAGGAGGAGGG + Intronic
1113605546 13:111602663-111602685 GAGGAGAGGCATCTGGAGGAGGG - Intronic
1113657563 13:112077958-112077980 GGGTAGAAGCACATGGAGGCAGG + Intergenic
1113669453 13:112165765-112165787 GAGGAGGAGGAGAAGGAAGAGGG - Intergenic
1113803810 13:113101807-113101829 GAGCAGAGGCAGGAGGAGGAGGG + Intergenic
1114354021 14:21887770-21887792 GAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1114364242 14:22010019-22010041 GATGAGGAGGAGAAGGAGGAAGG + Intergenic
1114531660 14:23400320-23400342 CAGGAGGAGTACAAGAAGGAGGG - Exonic
1114536878 14:23428564-23428586 CAGGAGGAGTACAAGAAGGAGGG - Exonic
1114554115 14:23551685-23551707 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1114653373 14:24300650-24300672 GAGGAGGAGGAGGAGGAGGATGG + Exonic
1115095383 14:29629943-29629965 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115300646 14:31881544-31881566 GAGGAGAAGGACAAGGTGACGGG - Intergenic
1115421474 14:33199706-33199728 GAGGGGAAGAAGAAGGGGGAGGG - Intronic
1115546010 14:34465324-34465346 CAGGAGAAGCTAATGGAGGAAGG + Intergenic
1115546018 14:34465374-34465396 GAGGATAAGCAAAATAAGGAAGG + Intergenic
1115619423 14:35126518-35126540 GAGGAGAACCACAGGGAAGAAGG + Intronic
1115815567 14:37160957-37160979 GAGGAGGAGGAGAAAGAGGAAGG + Intronic
1115936723 14:38560751-38560773 GAGCAGAAGCAAAAGAGGGAGGG + Intergenic
1116023795 14:39491937-39491959 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1116255843 14:42554258-42554280 GAGGAGAAGAAGAAAGAGGAAGG + Intergenic
1116416962 14:44689796-44689818 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1116416968 14:44689811-44689833 GAGGAGGGGCAGGAGGAGGAGGG + Intergenic
1116416974 14:44689826-44689848 GAGGAGGGGCAGGAGGAGGAGGG + Intergenic
1116416980 14:44689841-44689863 GAGGAGGGGCAGGAGGAGGAGGG + Intergenic
1116422724 14:44751827-44751849 GAGGACAATACCAAGGAGGATGG - Intergenic
1116717941 14:48451333-48451355 GAGGAGAAGAAGAAGAAAGAAGG - Intergenic
1116947995 14:50853989-50854011 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1117111822 14:52465241-52465263 GAAAAGAAAAACAAGGAGGAGGG + Intronic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117785640 14:59281532-59281554 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1117978701 14:61321695-61321717 GAGGAGAAGCAAGAGGAGGCGGG + Exonic
1118394082 14:65321006-65321028 GAGGAGGAGCGGGAGGAGGATGG + Intergenic
1118459552 14:65976033-65976055 GAGGAGGAGGAGAAGAAGGAGGG + Intronic
1118459571 14:65976093-65976115 GAAGAGGAGGAGAAGGAGGAAGG + Intronic
1118557767 14:67044736-67044758 GAGGAGGAGGAGGAGGAGGAAGG - Intronic
1118656244 14:67952706-67952728 GAGGAAAAGGAGAAGGAAGAGGG + Intronic
1119004360 14:70910031-70910053 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1119004373 14:70910064-70910086 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1119004415 14:70910154-70910176 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1119067422 14:71542704-71542726 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1119740776 14:77012448-77012470 GTGGTGAAGCCGAAGGAGGAGGG - Intergenic
1119812195 14:77531481-77531503 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1119996831 14:79262438-79262460 GAGGAGAAAGAGGAGGAGGAAGG + Intronic
1120193981 14:81463372-81463394 GAGGAGAAGGACAATTAGGAGGG - Intergenic
1120880811 14:89413979-89414001 GAGGAGGAGAAGAAGGAGGAGGG + Intronic
1120899878 14:89566755-89566777 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1121006379 14:90493207-90493229 GAGGAGGAGGAAAAAGAGGAGGG - Intergenic
1121117964 14:91356883-91356905 GAGGGGGAGCACCAGCAGGAAGG + Intronic
1121153669 14:91663074-91663096 GAGGAGAAGGAGGTGGAGGAGGG - Intronic
1121170971 14:91854397-91854419 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1121171015 14:91854516-91854538 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1121216616 14:92253460-92253482 GTGGAGATGCACAAGGAGTCAGG + Intergenic
1121310469 14:92932807-92932829 GAGGAGAAGAAAGAGGAGGAGGG + Exonic
1121346638 14:93141018-93141040 GAGCAGAGGCAAATGGAGGAAGG + Intergenic
1121488159 14:94336347-94336369 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1121662702 14:95647234-95647256 GTGGAGGAGTAGAAGGAGGAGGG + Intergenic
1121683195 14:95811415-95811437 AAGAAGAAGGACAAGGAGCAGGG - Intergenic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1121874133 14:97435328-97435350 GAGGAGAGACGCAGGGAGGAAGG - Intergenic
1121978124 14:98425094-98425116 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
1122016785 14:98803276-98803298 GAGGAGGAGAAGGAGGAGGAAGG - Intergenic
1122123775 14:99568408-99568430 GAGAGGAAGGCCAAGGAGGAAGG - Intronic
1122347066 14:101067341-101067363 GAGGAGGAGGACAAGGGGGAGGG - Intergenic
1122594996 14:102884249-102884271 GAGGACATGCACTAGGAAGACGG - Intronic
1122688526 14:103521145-103521167 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1123022665 14:105408958-105408980 GAGGAGGAGGAGCAGGAGGAGGG - Intronic
1123539257 15:21271709-21271731 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic
1124957761 15:34370870-34370892 GAAGAGGAGGAAAAGGAGGAGGG - Intergenic
1124957816 15:34371077-34371099 GAGGAGGAGGAAGAGGAGGAGGG - Intergenic
1125003891 15:34796813-34796835 GAGGAGAGGGAGAAGGAAGAGGG + Intergenic
1125024817 15:35019525-35019547 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1125311103 15:38378949-38378971 GAGTAGCAGCAACAGGAGGAAGG - Intergenic
1125381304 15:39090389-39090411 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1125487544 15:40122872-40122894 GAGGAGAAGTACAGGGAAAATGG + Intergenic
1125521459 15:40350155-40350177 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1125657654 15:41371192-41371214 GAGGAGGAGGAGGAGGAGGAAGG + Intronic
1125697553 15:41651803-41651825 GAGGAGAAGGGAAAGGAAGAGGG - Intronic
1126052308 15:44697158-44697180 GAGGAGAAGGAGGAGGAGGAAGG - Intronic
1126072732 15:44879958-44879980 GAGGAGACTCCCATGGAGGATGG - Intergenic
1126085518 15:45007643-45007665 GAGGAGATTCCCATGGAGGATGG + Intergenic
1126099401 15:45110730-45110752 GAGGGGAGGCACAAGTTGGATGG + Intronic
1126129302 15:45325021-45325043 TAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1126361068 15:47846588-47846610 GAGGAGGAGAAGAAGGAGTAAGG + Intergenic
1126361073 15:47846609-47846631 GGGGAGAAGAAGAAGGAGTAGGG + Intergenic
1126390459 15:48144169-48144191 GAGGAGAAAAAAAAGGAGAAAGG + Intronic
1126411806 15:48379948-48379970 GATCAGAAGCATAAGGAGGAGGG + Intergenic
1126837352 15:52679815-52679837 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1126966703 15:54062345-54062367 TAGGAGAATCACACAGAGGATGG - Intronic
1127142698 15:55993623-55993645 GAGGAGAAGCGGGAGGAGGCGGG + Intronic
1127566601 15:60195377-60195399 GAGGAGGAAGACGAGGAGGAGGG + Intergenic
1127566608 15:60195401-60195423 GAGGAGGAAGACGAGGAGGAAGG + Intergenic
1127822659 15:62673399-62673421 GAGGCGAAAAACAAGGAGAAGGG - Intronic
1127986663 15:64077782-64077804 GAGGAGCAGAGCCAGGAGGAGGG + Intronic
1128053702 15:64684398-64684420 GAGGAGAAGCTAAAGAGGGAGGG + Exonic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128704580 15:69829227-69829249 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1128734705 15:70046684-70046706 GGGGAGACGCAGCAGGAGGAAGG + Intergenic
1128797760 15:70477834-70477856 GAGGAGATGGAGGAGGAGGAGGG + Intergenic
1128869821 15:71145864-71145886 GAGGAGGAGCAGGAGGAGGAGGG + Intronic
1129327672 15:74809713-74809735 GAGGAGGAGCAGATGGAGGCAGG + Intergenic
1129410921 15:75349851-75349873 GAGGAGAGCCAAGAGGAGGATGG + Intronic
1129675895 15:77632403-77632425 GAGGAGGAGGAAACGGAGGAGGG - Exonic
1129834407 15:78692930-78692952 GAGGAGGAGCAAGAGGAGGAAGG + Intronic
1130042537 15:80417506-80417528 GAGAAGAAGCAGAGGGGGGATGG - Intronic
1130225956 15:82058687-82058709 GAGGAGGAGAAGAGGGAGGATGG - Intergenic
1130536271 15:84787145-84787167 TAGAAGATGCACAAGGAGGCGGG - Intronic
1130622474 15:85477966-85477988 GAGGAGAAGCACAGGATAGAAGG - Intronic
1130744380 15:86635300-86635322 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1130956281 15:88629515-88629537 GAAGAGAATGACAAGGAGGCTGG - Intronic
1130959842 15:88652423-88652445 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1131139823 15:89968109-89968131 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1131158578 15:90090083-90090105 GAGGAGGAGGAGGAGGAGGAAGG - Intronic
1131430147 15:92380754-92380776 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1131625957 15:94120934-94120956 GAGGAGAAGGAAGAAGAGGAGGG - Intergenic
1131690411 15:94820973-94820995 GAGGAGGAGGAAGAGGAGGAGGG + Intergenic
1131701627 15:94942985-94943007 GAGGAGGAGGAAAGGGAGGAGGG + Intergenic
1131701663 15:94943097-94943119 GAGGAGAAGAATGAGGAGAATGG + Intergenic
1131701670 15:94943134-94943156 GAGGAGAAGAATGAGGAGAATGG + Intergenic
1131960041 15:97780612-97780634 GTGGGGAAGGACAAGAAGGAAGG + Intergenic
1132014263 15:98301844-98301866 GAGGAGGAGGATGAGGAGGAGGG + Intergenic
1132028069 15:98419644-98419666 GAGGAGAGGGAGGAGGAGGAGGG + Intergenic
1132275890 15:100563633-100563655 GGGGAGAAGGCCAGGGAGGATGG + Intronic
1132399310 15:101495776-101495798 GAGGGGAAGAACAAGAGGGAAGG + Intronic
1132500650 16:283275-283297 GAGGAAATCCCCAAGGAGGATGG + Exonic
1132549152 16:547232-547254 GAGGAGCAGGAGGAGGAGGAGGG + Exonic
1132599703 16:768054-768076 GAGGAGGGGCACATGGAGGGGGG + Intronic
1132612726 16:825293-825315 TCGGAGAGGGACAAGGAGGAAGG - Intergenic
1132744964 16:1432714-1432736 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1133139179 16:3731771-3731793 ATGGAGAAGCACAAGGAGGTAGG - Exonic
1133392416 16:5420982-5421004 GAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1133404767 16:5514720-5514742 GAGGAGCAGGAGGAGGAGGAGGG + Intergenic
1133460662 16:5983888-5983910 GAGGAGGAGGAGAACGAGGAGGG - Intergenic
1133460758 16:5984197-5984219 GAAGAGAAGAAGAAGGGGGAGGG - Intergenic
1133507030 16:6422389-6422411 GAGGGGAAAGACAGGGAGGAGGG - Intronic
1133582618 16:7160834-7160856 GAGGAGGAGGAGGAGGAGGAAGG - Intronic
1133673856 16:8050913-8050935 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1133742288 16:8660809-8660831 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1133773838 16:8883229-8883251 GAGGAGGACCATAGGGAGGAGGG - Intergenic
1133779944 16:8930292-8930314 GCGGAGGAGGACATGGAGGATGG - Exonic
1133914485 16:10096757-10096779 TAGGGGAAGTACAAGGAGAATGG - Intronic
1134066585 16:11232443-11232465 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1134070062 16:11255384-11255406 GAGGAGGAGGAAGAGGAGGAAGG + Exonic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134510837 16:14845649-14845671 GAAGAGAAGGACAGGAAGGAAGG - Intronic
1134610268 16:15602637-15602659 GAGGAGAAAGAAAAGGAGGAGGG + Intronic
1134698478 16:16244136-16244158 GAAGAGAAGGACAGGAAGGAAGG - Intronic
1134973356 16:18550542-18550564 GAAGAGAAGGACAGGAAGGAAGG + Intronic
1135232064 16:20717865-20717887 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
1135694706 16:24575793-24575815 GAGGAGAGGGAGAGGGAGGAGGG + Intergenic
1135694758 16:24575915-24575937 GAGGAGAGGGAGAGGGAGGAGGG + Intergenic
1135942448 16:26834304-26834326 GAGGAGGAGAAGAAGAAGGAGGG + Intergenic
1135987453 16:27194453-27194475 GAGGAGAAGGCCAAAGGGGAAGG + Intergenic
1136136024 16:28257464-28257486 GAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1136428320 16:30183657-30183679 GAGGAGGAGGAAGAGGAGGAAGG - Exonic
1136498887 16:30659843-30659865 GAGGAGGAGGAGGAGGAGGAGGG + Exonic
1136539128 16:30918976-30918998 GAGGAGAAGGAGAAGAAGAAAGG - Intergenic
1137317100 16:47337050-47337072 CAGGAGAATCACAGGGAGGCGGG + Intronic
1137386460 16:48047351-48047373 GAGGAGAAGGAGGTGGAGGATGG + Intergenic
1137504494 16:49041327-49041349 GAGCAGAAGCCCAGGGAGGAAGG + Intergenic
1137557035 16:49477251-49477273 GAGGAGGAGGGGAAGGAGGAGGG + Intergenic
1137557046 16:49477275-49477297 GAGGAGGAGGGGAAGGAGGAGGG + Intergenic
1137617498 16:49856230-49856252 GAGGAGGAGAAGGAGGAGGAGGG - Intronic
1137859320 16:51830454-51830476 GAGGAGGAGGAAGAGGAGGAGGG - Intergenic
1137884396 16:52086926-52086948 CACTAGAAGCAGAAGGAGGAGGG + Intergenic
1138070649 16:53989833-53989855 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1138105448 16:54285216-54285238 GAAGAGGAGGACGAGGAGGACGG - Exonic
1138126174 16:54440503-54440525 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
1138153974 16:54685892-54685914 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1138217152 16:55214467-55214489 GAGGAGAAGAACAGGAAGGAGGG + Intergenic
1138241856 16:55433882-55433904 GAGGAGAAGGAAAATGAGGCAGG + Intronic
1138295803 16:55884240-55884262 GAGGAGTAGCACAAGGCTGAGGG - Intronic
1138536747 16:57664195-57664217 GAGGAGAACCCCAGGGAAGATGG - Exonic
1138722155 16:59094882-59094904 CAGAAGAAACACAAGGAGGGAGG + Intergenic
1138747281 16:59378035-59378057 GAGGAGTAGCTCCAGGAGGCAGG - Intergenic
1138830882 16:60373515-60373537 GAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1138928979 16:61629159-61629181 CGGGAGAAAGACAAGGAGGAAGG + Intergenic
1138969574 16:62128685-62128707 GAGGAGCAGCAGGAGGAGGAGGG - Intergenic
1139060948 16:63250702-63250724 GAGGGGAAGGGGAAGGAGGAGGG + Intergenic
1139328467 16:66169600-66169622 GAGGAGGAGGAGAGGGAGGAAGG + Intergenic
1139413922 16:66790302-66790324 GAGGAGAAGGGAAAGGAGGGAGG + Intronic
1139513198 16:67438885-67438907 GGGGGGAAGCACAAGCATGAGGG + Intronic
1140205092 16:72927292-72927314 GAGAAGGAAGACAAGGAGGAAGG - Intronic
1140728943 16:77838843-77838865 GGGGAGAAAGAGAAGGAGGAAGG - Intronic
1140903546 16:79391914-79391936 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141007136 16:80363136-80363158 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1141148375 16:81547617-81547639 GAGGAGGAGGAGGAGGAGGAAGG + Intronic
1141514578 16:84535154-84535176 GAGGAGTGGGAGAAGGAGGAGGG - Intronic
1141518135 16:84559883-84559905 GGGGAGAAGCAACTGGAGGAGGG + Intergenic
1141535267 16:84674942-84674964 GAGGAGAAGAAGGAAGAGGAGGG - Intergenic
1141635674 16:85312745-85312767 GAGGAGAAGGAGGGGGAGGAAGG + Intergenic
1141646994 16:85372865-85372887 GATGAGAAGGCTAAGGAGGAGGG + Intergenic
1141703609 16:85653261-85653283 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1141749211 16:85946971-85946993 GTGGACCAGCACAGGGAGGAGGG - Intergenic
1141845133 16:86603444-86603466 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845144 16:86603501-86603523 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845155 16:86603558-86603580 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845166 16:86603615-86603637 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845177 16:86603672-86603694 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845188 16:86603729-86603751 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141856222 16:86683103-86683125 GGGGAGAAGGAAAAGAAGGAAGG + Intergenic
1141891752 16:86930858-86930880 GAAGAGGAGGAGAAGGAGGAGGG - Intergenic
1141983695 16:87565903-87565925 GAGGGGAGGGACAGGGAGGAAGG - Intergenic
1142264448 16:89057390-89057412 GAGGAGGAGGACAGGAAGGAGGG - Intergenic
1142264476 16:89057478-89057500 GAGGAGGAGGACAGGAAGGAGGG - Intergenic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1142704244 17:1684471-1684493 GAGGAGAAGCTGCAGGAGAAAGG - Exonic
1142863420 17:2776837-2776859 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1143115879 17:4581723-4581745 GAGCAGAAGCACAGTCAGGAAGG + Intergenic
1143236525 17:5406353-5406375 GAGGCAAAGTACAAGGTGGAAGG + Intronic
1143270030 17:5668597-5668619 GAGGAGAAGTAAGAGGAGGAGGG - Intergenic
1143270041 17:5668653-5668675 GAAGAGAAGAAAGAGGAGGAAGG - Intergenic
1143361127 17:6372186-6372208 GAGGAGAAGAAGCAGCAGGAGGG + Intergenic
1143361128 17:6372189-6372211 GAGAAGAAGCAGCAGGAGGGAGG + Intergenic
1143370649 17:6436884-6436906 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1143391265 17:6560654-6560676 GAGGAGGAGGAAGAGGAGGAGGG - Intergenic
1143391349 17:6561031-6561053 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391375 17:6561128-6561150 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1143391467 17:6561436-6561458 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391473 17:6561468-6561490 GAGGAGGAGGAAGAGGAGGAGGG - Intergenic
1143583207 17:7838324-7838346 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1143929828 17:10410841-10410863 CAGGAGGAGTACAAGAAGGAAGG - Exonic
1143938213 17:10509549-10509571 CAGGAGGAGTACAAGAAGGAAGG - Exonic
1143940663 17:10537729-10537751 CAGGAGGAGTACAAGAAGGAAGG - Exonic
1143952281 17:10642890-10642912 CAGGAGGAGTACAAGAAGGAAGG - Exonic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144200286 17:12934868-12934890 CAGGAGTACCACAAGGAGGCTGG + Intronic
1144208302 17:12994507-12994529 GAGAAGCAGCACAAGGATCAGGG + Intronic
1144235673 17:13258100-13258122 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144235679 17:13258127-13258149 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1144410408 17:14995108-14995130 GAGGAGGAGGAAGAGGAGGAAGG - Intergenic
1144838506 17:18171260-18171282 AAGGAGAAGCAAAAGCCGGAGGG - Intronic
1144967346 17:19086028-19086050 AAGGAGAAGGATGAGGAGGAGGG + Intergenic
1144980573 17:19166038-19166060 AAGGAGAAGGATGAGGAGGAGGG - Intergenic
1144987649 17:19212195-19212217 AAGGAGAAGGATGAGGAGGAGGG + Intergenic
1145059962 17:19726685-19726707 GAGGAGGAGAACGAGGAGGAGGG + Intergenic
1145105310 17:20110549-20110571 GAGGAGCGGCACAGGTAGGAGGG + Exonic
1145274766 17:21422868-21422890 GGGGAGCAGCCCAAGCAGGAAGG + Intergenic
1145366825 17:22272133-22272155 GAGGAGAAGCACAAGAGTGCTGG + Intergenic
1145839345 17:27981148-27981170 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1146476365 17:33165755-33165777 GAGGAGAGGAACAAGGAAAAAGG + Intronic
1146534314 17:33637010-33637032 GGGGAGGAGAAGAAGGAGGAAGG - Intronic
1146569896 17:33943239-33943261 GAGGAGAAGCGCAGGGAAGAAGG + Intronic
1146987346 17:37232891-37232913 GAGGAGGAGGACAAGGGGGATGG - Intronic
1147195360 17:38762921-38762943 AAGTAAAAGGACAAGGAGGATGG - Intronic
1147267587 17:39244268-39244290 GAGGAGCAGCAGGAGGAGGAGGG - Intergenic
1147383904 17:40070905-40070927 GAGGAGAGACACATGAAGGAGGG - Intronic
1147498868 17:40942866-40942888 GAGGAGGAGGAAGAGGAGGAAGG - Intergenic
1147572089 17:41577577-41577599 CAGGAGAAGGACAAAGGGGAGGG + Intergenic
1148107977 17:45129576-45129598 GACGGGAAGCTCAAGGCGGAGGG - Intronic
1148492537 17:48032603-48032625 CAGGAGAAAAACAGGGAGGAAGG + Intronic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1149107066 17:52982544-52982566 GAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1149107083 17:52982591-52982613 GAGGAGGGGGAGAAGGAGGAAGG - Intergenic
1149114165 17:53071729-53071751 GAGAAGAAGAAAAAGGAGGGAGG + Intergenic
1149304499 17:55335049-55335071 GTGGAGGAGCACCAGGAGGCAGG - Intergenic
1149699424 17:58643176-58643198 GAGGAGTAGAATAAGAAGGAAGG - Intronic
1149785795 17:59433889-59433911 GAGGAGAGGGGAAAGGAGGAGGG - Intergenic
1149785804 17:59433926-59433948 GAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1150089440 17:62310017-62310039 GAGGAGGAGGAGCAGGAGGAAGG - Intergenic
1150143996 17:62752772-62752794 GAGCAAAAGCAAAAGGAAGAGGG - Intronic
1150278042 17:63912149-63912171 GAGGAGGAGAAAAAAGAGGACGG - Intronic
1150279357 17:63920034-63920056 GAGGAGGAGAAAAAAGAGGAGGG - Intergenic
1150364827 17:64573141-64573163 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1150364876 17:64573254-64573276 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150466829 17:65400698-65400720 AAGGAGAAACAAAAGAAGGAAGG - Intergenic
1150702649 17:67461150-67461172 GAGAAGAAGCAGGAGGAGGCAGG - Intronic
1150747375 17:67826151-67826173 GAGGAGGAGGAGGAGGAGGACGG + Exonic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1150871471 17:68916655-68916677 GAGGAGAAGAACAAGAAAGAAGG + Intronic
1150964023 17:69947225-69947247 GAGGAGCAGGAGGAGGAGGAGGG - Intergenic
1151320304 17:73348824-73348846 GAGGAGGAGCACAGGGTGGCAGG - Intronic
1151362078 17:73595202-73595224 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1151441467 17:74132078-74132100 GAGGAGCAGCAGAAGCGGGAAGG - Intergenic
1152055582 17:78023400-78023422 GAGGAGGAGCAGGAGAAGGAAGG - Intronic
1152277624 17:79367345-79367367 GAGGAGGAGTAGGAGGAGGAGGG - Intronic
1152328569 17:79657134-79657156 GAGGAGAAGAATGAGGAGGAAGG + Intergenic
1152461234 17:80443597-80443619 GAGCAGAGGCGCAGGGAGGAGGG + Intergenic
1152494945 17:80664471-80664493 GAGGAGAAGGAGAAGGGGGCAGG - Intronic
1152565126 17:81096954-81096976 GAGGAGGAGAAGAAGGAGAAAGG + Intronic
1153331306 18:3878460-3878482 GAGGAGGAGGAAAAGGAGGAAGG - Intronic
1153396732 18:4630513-4630535 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1153575535 18:6516535-6516557 GAGGAGGAGGAAGAGGAGGAGGG + Intronic
1153797498 18:8637929-8637951 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1153915212 18:9738788-9738810 GAGGCCTAGCACAAGGAGGAAGG - Intronic
1153917071 18:9755575-9755597 GAGCTGAAGCTCAAAGAGGAGGG - Intronic
1153919878 18:9779033-9779055 GAGGAGGAGCAGGAAGAGGAGGG + Intronic
1153987180 18:10362851-10362873 GAGGAAGAGAACAAGGGGGAAGG - Intergenic
1153987778 18:10368551-10368573 GAGGAGAGGGAGAGGGAGGAAGG + Intergenic
1154050734 18:10954595-10954617 GATGAGAAGAAGAGGGAGGAGGG + Intronic
1154279178 18:12986925-12986947 GAGGAGGAGGAGGAGGAGGAAGG - Exonic
1154299277 18:13178795-13178817 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1154370814 18:13761784-13761806 CAGGCAAAGCTCAAGGAGGAAGG - Exonic
1154964957 18:21347397-21347419 AAGGAGCAGCAGAAGCAGGAAGG - Intronic
1155064725 18:22258397-22258419 GAGGAGGAGGAAAAGGAGGAAGG - Intergenic
1155066493 18:22273660-22273682 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1155066625 18:22274016-22274038 GAGGAGGAGGAAGAGGAGGAGGG - Intergenic
1155163516 18:23214660-23214682 CAAAAGGAGCACAAGGAGGAAGG - Intronic
1155512711 18:26593758-26593780 GAGGAGAAGGACAAGGAGGGAGG + Intronic
1155512724 18:26593816-26593838 GAGGAGAAGGACAAGGAGGGAGG + Intronic
1155759054 18:29541369-29541391 GAGGAGAGGGAGAAAGAGGAAGG - Intergenic
1155844307 18:30686355-30686377 GAGGAAAAGAAGAAAGAGGAGGG + Intergenic
1155857432 18:30850569-30850591 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1155923565 18:31630013-31630035 GTGGAGAAGGAGAAGCAGGAAGG + Intronic
1156036706 18:32772465-32772487 AGGGAGAAGAACAAGAAGGAAGG - Intronic
1156078182 18:33305742-33305764 AAGGAGGAGAAGAAGGAGGAGGG - Intronic
1156368508 18:36451601-36451623 GAGGAGAAGGAAGAGGAGGGAGG - Intronic
1156472850 18:37388372-37388394 GAGGAGAAGCAAAGGGCAGAGGG - Intronic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1156782751 18:40870757-40870779 GACGGGAAGCACAAGGGGAAAGG - Intergenic
1156883513 18:42108115-42108137 AAGGAAGAGAACAAGGAGGAGGG + Intergenic
1157276069 18:46311896-46311918 GAGGAGGAGGAGAAGGAGGAAGG + Intergenic
1157470287 18:47983173-47983195 GGGGAGGAGAAGAAGGAGGAAGG - Intergenic
1157559923 18:48638833-48638855 GGGGAGGAGCCCAAGGAGGGTGG + Intronic
1157656326 18:49393030-49393052 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1157837119 18:50915089-50915111 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1158275190 18:55759216-55759238 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1158279601 18:55808508-55808530 AAGGAGAAGGACTAGGAGGCTGG - Intergenic
1158794423 18:60826008-60826030 AAGGAGAATAACAAGGTGGAAGG + Intergenic
1158958553 18:62566675-62566697 GAGGAGAAGCACGTGGACGTTGG + Intronic
1158963469 18:62604811-62604833 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1158985126 18:62807423-62807445 GGGGAGAAGCATAAAGAAGAAGG + Intronic
1159310258 18:66698457-66698479 GAGGAGAAGGAGGAGGAGAAAGG + Intergenic
1159357160 18:67350998-67351020 GAGGAAAAGCATAAGAAGAAAGG - Intergenic
1159768644 18:72521976-72521998 GAGGAGAACAACAGGGTGGAGGG - Intergenic
1159934283 18:74349986-74350008 GTATAGGAGCACAAGGAGGAGGG + Intronic
1160174569 18:76582189-76582211 GAGGAGAAGGAGGAAGAGGAGGG - Intergenic
1160337731 18:78057528-78057550 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1160556612 18:79729652-79729674 GAGGAGAAGCACACGGGCCAAGG - Intronic
1160845622 19:1164803-1164825 GAGGAGGAGGAGCAGGAGGAGGG + Intronic
1160845623 19:1164806-1164828 GAGGAGGAGCAGGAGGAGGGAGG + Intronic
1160900231 19:1424305-1424327 GAGGAGGAGGAAGAGGAGGAGGG - Intronic
1160983427 19:1827029-1827051 GAGGAGGAGGAGGAGGAGGATGG + Exonic
1161286051 19:3468870-3468892 GAGGAGAAGTAGGAGGAGGAGGG - Intronic
1161403794 19:4080919-4080941 GAGGAGGAGGAGAAGGGGGAGGG + Intergenic
1161428956 19:4219741-4219763 AAGGAGAAGGACAAGAAGGTGGG + Exonic
1161467887 19:4442284-4442306 GAGGAGGAGGAAGAGGAGGAGGG + Exonic
1161535649 19:4817279-4817301 GAGGAGGAGGAGGAGGAGGAGGG + Exonic
1161557802 19:4954416-4954438 GAGGAGGAGCAGCAGGAGGGGGG + Exonic
1161756673 19:6138804-6138826 GGGAAGAAGCAAAGGGAGGAAGG + Intronic
1162053054 19:8046701-8046723 GAGGAGGAGAAGGAGGAGGAAGG - Intronic
1162053089 19:8046797-8046819 GAGGGGGAGGAGAAGGAGGAGGG - Intronic
1162053096 19:8046815-8046837 GAGGAGGGGGAGAAGGAGGAGGG - Intronic
1162053115 19:8046863-8046885 AAGGAGGAGGAGAAGGAGGATGG - Intronic
1162176797 19:8836386-8836408 GAGGACAAGGAGGAGGAGGAAGG - Intronic
1162181460 19:8871895-8871917 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1162198818 19:9006708-9006730 GAACAGAAGCTCAAAGAGGAAGG - Intergenic
1162304738 19:9865146-9865168 GAGGAGAAGAAGAAGAAGGGAGG - Intronic
1163022091 19:14487621-14487643 GAGGAAATGCACAGGGAGCAGGG + Intronic
1163105766 19:15122369-15122391 GAGGAGAAGAGGAAGGAAGAGGG + Intronic
1163153015 19:15425796-15425818 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1163260333 19:16185768-16185790 GAGCAGAAGCAGAAGGCGGCGGG + Intronic
1163389306 19:17020680-17020702 GGGGAGAGGAACAAGGAGAAGGG + Intronic
1163442391 19:17328583-17328605 GAAGAGGAGGACGAGGAGGAGGG - Exonic
1163510686 19:17733345-17733367 CAGGACCAGCGCAAGGAGGAAGG + Exonic
1163609320 19:18292830-18292852 GAGGGGAAGCTGAAGCAGGAAGG - Intergenic
1163630443 19:18415575-18415597 GAGGAGGAGGAAGAGGAGGAGGG + Intergenic
1163690896 19:18737723-18737745 GAGGAGCAGCAGCAGGAGGGCGG - Intronic
1163690897 19:18737726-18737748 GAGGAGGAGCAGCAGCAGGAGGG - Intronic
1163956333 19:20645152-20645174 GAGGAAAATAACAAAGAGGAAGG + Intronic
1164234935 19:23323582-23323604 GAAAAGAAGGAAAAGGAGGATGG - Intronic
1164250190 19:23469049-23469071 GAGAAGAAGGAAAAAGAGGATGG - Intergenic
1164250274 19:23469629-23469651 GAGGAGATGGAGAAGGAGGGGGG - Intergenic
1164292383 19:23879995-23880017 GAGAAGAAGGGAAAGGAGGAGGG + Intergenic
1164292696 19:23881842-23881864 GAGGAGAAGGAGGAGGAAGAGGG + Intergenic
1164567673 19:29339512-29339534 GAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1164592311 19:29513550-29513572 GATGAGGAGGATAAGGAGGAAGG + Intergenic
1164592326 19:29513599-29513621 GATGAGGAGGATAAGGAGGAAGG + Intergenic
1164696574 19:30249337-30249359 GAGAAGGAGGAGAAGGAGGAGGG + Intronic
1164696578 19:30249343-30249365 GAGGAGAAGGAGGAGGGGGAGGG + Intronic
1164696584 19:30249358-30249380 GGGGAGGGGGACAAGGAGGAGGG + Intronic
1164868667 19:31625731-31625753 GAGGAAGAGGAAAAGGAGGAGGG - Intergenic
1165069753 19:33248494-33248516 GAAGAGGAGCAGGAGGAGGAAGG + Intergenic
1165470812 19:36003466-36003488 GAGGAAGAGGATAAGGAGGAAGG + Exonic
1165773638 19:38392223-38392245 GAGGAGGAGGAGGAGGAGGAGGG - Exonic
1165782207 19:38441297-38441319 GACCTGGAGCACAAGGAGGAGGG + Intronic
1165925623 19:39324392-39324414 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1165925645 19:39324531-39324553 GAGGAGAAGGAGGAGGAAGAAGG + Intergenic
1166034961 19:40161420-40161442 GAAGAGAAGCAGAAGGGGAAGGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166502450 19:43352344-43352366 GAGGAGAAGCAGAAGAGGGAAGG - Intergenic
1166624436 19:44337186-44337208 AAGAAGAAACACAAGAAGGAAGG - Intronic
1166652131 19:44582648-44582670 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1166752192 19:45169640-45169662 GAGGAGAACCCCAGGAAGGAAGG + Intronic
1166773818 19:45300414-45300436 GATGAGAGGCAAAAGGAGGTGGG - Intronic
1166868032 19:45852917-45852939 GAGCAGAAGCAGAAGGAGAGTGG - Intronic
1167056047 19:47112300-47112322 GAGGAGGAGGAGGAGGAGGAAGG - Intronic
1167098661 19:47390464-47390486 GGGGAGGAGCACAGGGAGGGAGG - Intergenic
1167134493 19:47608840-47608862 GAGGAGGAGGAGGAGGAGGAAGG + Intronic
1167153919 19:47726554-47726576 GAGAAGAAGGAGGAGGAGGAGGG - Intronic
1167191252 19:47991625-47991647 GAGGGGAAGGAGGAGGAGGAGGG - Intronic
1167409487 19:49336663-49336685 GAGGAGGAGCTGAAGGAGGAAGG + Intronic
1167608138 19:50492703-50492725 GAGGAGGAGGAGAAGGAAGAAGG + Intergenic
1167608258 19:50493209-50493231 GAGGAGAGGTAGAAGGAGAATGG + Intergenic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
1167686496 19:50960009-50960031 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1167775639 19:51552998-51553020 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1167791216 19:51683479-51683501 GAGGAGAAGCACCTGGTGAATGG + Intergenic
1168063268 19:53906041-53906063 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1168124668 19:54276865-54276887 GAGGAGGAGCAGTAGGACGACGG + Exonic
1168177318 19:54634683-54634705 GAGGAGGAGCAGTAGGATGACGG - Exonic
1168181621 19:54665875-54665897 GAGGAGGAGGAAGAGGAGGAGGG - Exonic
1168417373 19:56177122-56177144 GAGGAGGAGGACCAGGGGGACGG - Exonic
1168464942 19:56594844-56594866 GAAGAGATGGAGAAGGAGGAGGG - Intergenic
1168510984 19:56973395-56973417 GAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1168694324 19:58396204-58396226 GAGGAGGAGGAGGAGGAGGAAGG + Exonic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925246196 2:2385534-2385556 GATGAGGAGAATAAGGAGGAAGG + Intergenic
925402563 2:3586022-3586044 GAGGAGAGGAAAAAGGAGGAGGG + Intergenic
925482647 2:4293224-4293246 GTGGAGAAGGATAAGGATGAGGG - Intergenic
925562821 2:5216544-5216566 GAGGAGGAGAAAAAGGAAGAGGG - Intergenic
925703712 2:6664221-6664243 GAGATGAAGGAGAAGGAGGAAGG + Intergenic
925717560 2:6798258-6798280 CAGGAAAAGCAAAATGAGGAGGG + Intergenic
925721301 2:6830325-6830347 GAGGAGGAGTAAATGGAGGAGGG + Intergenic
925901797 2:8514116-8514138 GATGAGAAGCAGAATTAGGATGG + Intergenic
925984389 2:9204307-9204329 AAGGCGAAGAAAAAGGAGGAAGG - Intergenic
926219744 2:10926713-10926735 GAAGAGAAGCAAAGGGAGAAAGG + Intergenic
926231583 2:11008234-11008256 GAGCTGCAGCAGAAGGAGGAAGG - Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926558306 2:14386564-14386586 GAGGAGAAGCAGGAGGGGGAGGG + Intergenic
926619471 2:15034043-15034065 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
926753639 2:16219281-16219303 GGGGAGGAACAGAAGGAGGAGGG - Intergenic
926860492 2:17303733-17303755 GATGAGAAGCACAAGGAAGGAGG - Intergenic
926873014 2:17444223-17444245 GAGGAAAAGGAGAATGAGGAAGG + Intergenic
926888571 2:17619724-17619746 GAGGAAATGCATAAGGAGGGAGG - Intronic
927187354 2:20491316-20491338 GAAGAGAAGGAGGAGGAGGAGGG - Intergenic
927612661 2:24557491-24557513 GAGGAGGAGCAGGAGGAGGAGGG - Intronic
927647018 2:24884281-24884303 GAAGAGAATCACCTGGAGGAGGG - Intronic
927648586 2:24897234-24897256 GAGGAGGAGAAAAAGGAGAAGGG - Intronic
927699980 2:25261841-25261863 GAGGGGACGCACAGGCAGGAGGG - Intronic
927709348 2:25315174-25315196 GAGGAGAAGCCCAGGAGGGAGGG - Intronic
927810855 2:26179566-26179588 GAGGGCAAGGACAAGGAGGAGGG + Intronic
927946669 2:27138856-27138878 GAGGAGAGGAATAAGGAGGAAGG + Intronic
928108440 2:28488172-28488194 GAGGAGAAGGAGGAGAAGGAGGG + Intronic
928148980 2:28809690-28809712 GTGTGGAAGCACAAGAAGGAAGG + Intronic
928199761 2:29240086-29240108 GAGGAAAAGGGCAGGGAGGAGGG + Intronic
928218197 2:29380073-29380095 GAGGAAAAGAGCAATGAGGAAGG + Intronic
928268281 2:29831105-29831127 GAGGAGAAGAAGAAGAAGAAGGG + Intronic
928320566 2:30279978-30280000 GAGGAGAAGAAGAAGAAGAATGG - Intronic
928781927 2:34833779-34833801 GAGGAGGAGGAATAGGAGGAAGG + Intergenic
928904558 2:36356043-36356065 GAGGAGGAGGAGGAGGAGGAGGG + Exonic
929401691 2:41590217-41590239 GACAAGAAGCACCAGAAGGAAGG + Intergenic
929458647 2:42085019-42085041 GGGAAGAAGAATAAGGAGGAGGG + Intergenic
929581667 2:43085395-43085417 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
929778885 2:44944773-44944795 GAGGGGAAGGAGAGGGAGGAGGG - Exonic
929996305 2:46828233-46828255 GACGAGGAGGACGAGGAGGATGG - Intronic
930349094 2:50226509-50226531 GAGGAGAAGCACAAGGAGGAGGG + Intronic
930374745 2:50551084-50551106 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
930411621 2:51032161-51032183 GAGGAGGAGAAGGAGGAGGAGGG + Exonic
931040429 2:58292099-58292121 GACGATAAGCACAGGGAGGGAGG + Intergenic
931134819 2:59386422-59386444 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
931265163 2:60653979-60654001 GAGGAGAAGAAGATGGAGAAAGG + Intergenic
931512848 2:63019776-63019798 GAGGAGAAGGGAAAGGGGGAGGG + Intronic
931517246 2:63057202-63057224 GAGGAAGAGCAGAAGGGGGACGG - Exonic
931799657 2:65746492-65746514 GAGCAGAAGGAGCAGGAGGAAGG + Intergenic
931835881 2:66097937-66097959 GAAGAGAAGCCCACAGAGGAGGG + Intergenic
931992776 2:67807774-67807796 GAGAAGAAGGAGAAGGAAGAAGG - Intergenic
932402223 2:71488958-71488980 GAGGAGCAGCTGAAGGAGGAAGG - Intronic
932624106 2:73284395-73284417 GAGGAGGAGGAGGAGGAGGAGGG + Exonic
932752031 2:74377371-74377393 GAGGGGAAGGAGAAAGAGGAGGG - Intronic
932772526 2:74508340-74508362 GAGCAGATGCCGAAGGAGGAGGG + Exonic
932805165 2:74777259-74777281 GAGGAGGAGGACAAGAGGGAAGG + Intergenic
933196043 2:79391270-79391292 GAGGAGGAGGAGAAGGAGGAGGG - Intronic
933249598 2:80014256-80014278 GAGCAGAAGCTGCAGGAGGAAGG + Intronic
933275881 2:80283881-80283903 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
933441103 2:82315394-82315416 GAGGAGAAGGAAGAGGGGGAGGG - Intergenic
933441113 2:82315418-82315440 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
933481374 2:82861217-82861239 GAGGAGGAGAAAAAGAAGGAAGG - Intergenic
933895373 2:86806437-86806459 CAGGCCAAGGACAAGGAGGAAGG - Intronic
934035859 2:88088098-88088120 GAGGAGACAGACAGGGAGGATGG - Intronic
934616094 2:95772192-95772214 GAAGAGAAGCAGAGGCAGGAGGG - Intergenic
934644802 2:96052368-96052390 GAAGAGAAGCAGAGGCAGGAGGG + Intergenic
934652382 2:96099915-96099937 GGGAAGAAGGACAAAGAGGAGGG + Intergenic
934753575 2:96809973-96809995 GAGGAGGAGGAGGAGGAGGAAGG - Exonic
934838213 2:97608457-97608479 GAAGAGAAGCAGAGGCAGGAGGG + Intergenic
935051832 2:99530876-99530898 CTGGAGCAGCACAAGGAGGGTGG - Intergenic
935860292 2:107321931-107321953 GAGTACAAGTACAAGAAGGATGG + Intergenic
935972100 2:108539795-108539817 GAGGAAAAGAACCAGGATGATGG - Intronic
936055980 2:109262318-109262340 GTGGAAAAGCACCAGGAGGGTGG + Intronic
936122497 2:109758941-109758963 GAGGGGAAGAAAAAAGAGGAGGG + Intergenic
936222196 2:110612531-110612553 GAGGGGAAGAAAAAAGAGGAGGG - Intergenic
936379439 2:111970828-111970850 GAGAAGGAGGAGAAGGAGGAGGG - Intronic
936395578 2:112125697-112125719 GAGGAGAAGGAAAGGAAGGAAGG + Intergenic
936495554 2:113017494-113017516 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
936514534 2:113173636-113173658 GGGCAGAAGCGCAGGGAGGAAGG + Intronic
936714006 2:115162915-115162937 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
936832824 2:116669801-116669823 GAAGAGGAGGAGAAGGAGGAAGG - Intergenic
937075748 2:119105143-119105165 GTGGAGAAGAACAATCAGGAGGG - Intergenic
937130908 2:119512340-119512362 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
937247849 2:120505034-120505056 GACCAGGAGGACAAGGAGGAGGG + Intergenic
937313696 2:120917685-120917707 CAGGAGAAGCCCAAGGCAGAAGG - Intronic
937327142 2:120996801-120996823 GAGGAAAAGGAGAAGGAGGAGGG - Intergenic
937345966 2:121125482-121125504 AAGGAGAAGGAGAAGAAGGAAGG + Intergenic
937490222 2:122359444-122359466 GAGGAGGAGGAAGAGGAGGAGGG - Intergenic
937490232 2:122359471-122359493 GAGGAGAAGACGGAGGAGGAGGG - Intergenic
937528390 2:122798986-122799008 GAGGGGAAGGAGAAAGAGGAGGG - Intergenic
937686802 2:124706816-124706838 GAGGAGGAGGAAGAGGAGGAGGG + Intronic
937686812 2:124706847-124706869 GAGGAGGAGGAGAAGGAGAAGGG + Intronic
937686814 2:124706853-124706875 GAGGAGAAGGAGAAGGGGAAAGG + Intronic
937917268 2:127105467-127105489 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
937988172 2:127647937-127647959 GAGGAGAGGTAAAAGGAGGGAGG - Intronic
938265612 2:129926006-129926028 GAGGTGAAGCCCAGGGAGGAAGG + Intergenic
938380038 2:130831506-130831528 GAGCAGGGGCACAAGGAGGCAGG + Intergenic
938397949 2:130964322-130964344 GAGGAGAAGGAAAGGCAGGAGGG - Intronic
938627571 2:133127992-133128014 GAGGAACAGGACAAGAAGGATGG - Intronic
938965642 2:136386068-136386090 GGGGAGAAGGACAGGGAAGAAGG + Intergenic
938980548 2:136522233-136522255 AAGGAGAAGCACAGTGAGAAGGG - Intergenic
939004004 2:136765479-136765501 GAGGAGGAGGAGGAGGAGGAAGG - Intergenic
939280071 2:140052541-140052563 GAGAAGAAGAAAGAGGAGGAAGG + Intergenic
939462913 2:142519673-142519695 GAGGTGAAGGAGTAGGAGGAGGG + Intergenic
939983241 2:148805691-148805713 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
940391939 2:153142352-153142374 GATGATAAACACATGGAGGAAGG + Intergenic
940696375 2:156984666-156984688 GAGGAGGAGGAGGAGGAGGAAGG + Intergenic
940696406 2:156984730-156984752 GAGGAGAAGGAAGGGGAGGAGGG + Intergenic
941038196 2:160590516-160590538 GAGGGGAAGGAGAAGGGGGAGGG - Intergenic
941038226 2:160590594-160590616 GAGGAGAAGGGGAAGGGGGAGGG - Intergenic
941208325 2:162602895-162602917 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
941396478 2:164980275-164980297 GAGGAGAAGAAGGAGGAGGTGGG - Intergenic
941591148 2:167422123-167422145 GAGGAGAAGGGGGAGGAGGAGGG + Intergenic
941684768 2:168437120-168437142 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
941847105 2:170143942-170143964 GGGGAGAGAGACAAGGAGGAAGG - Intergenic
942432298 2:175925404-175925426 GAGGAAAAGCTCAAGAAGGCTGG + Exonic
942507326 2:176656932-176656954 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
942764003 2:179432432-179432454 TAGGAGAGGTACAAGGAGGCTGG - Intergenic
942898379 2:181085748-181085770 TAGGAGCAGCATAAGAAGGAAGG + Intergenic
942965861 2:181891919-181891941 GAGGAGGAGGAGGAGGAGGAGGG - Exonic
942985412 2:182134778-182134800 GAGGAGGAGCAGCAGGATGAGGG + Intergenic
943089973 2:183362700-183362722 GAGGAGATGTCCAAGGAGAAGGG + Intergenic
943278271 2:185896885-185896907 GAGGAGAAGGAAGAAGAGGAGGG + Intergenic
943733184 2:191325039-191325061 GAAGAGAAGGAAAAGGAGAAAGG - Intronic
943834366 2:192500424-192500446 GAGGAGAAGCAGCTGGATGATGG + Intergenic
944037219 2:195309388-195309410 GAAGAGGAGGAAAAGGAGGAGGG - Intergenic
944155266 2:196600947-196600969 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
944396364 2:199272296-199272318 GAGGAGAACGACAGCGAGGAAGG - Exonic
945155162 2:206830426-206830448 GAGGAGAAGAAGAAGAAGAAGGG + Intergenic
945257335 2:207813493-207813515 GAGGAGAAGGAGGAGGAGGACGG + Intergenic
945517050 2:210775281-210775303 CAAGAGCAGCACTAGGAGGATGG - Intergenic
945599340 2:211839173-211839195 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
945699235 2:213150455-213150477 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
945995534 2:216432839-216432861 CAGGTGAAGCGCACGGAGGATGG - Exonic
946053205 2:216880819-216880841 GTGGGGAAGCAGAAGGGGGAGGG - Intergenic
946370788 2:219280149-219280171 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
946621334 2:221566935-221566957 AAGGAGAAGGAGAAGGAGAAGGG + Intronic
946857670 2:223968899-223968921 GAGGAGGAGGAAAAGGGGGATGG - Intergenic
946996660 2:225400321-225400343 GAGGAGAAAGAGAAGCAGGAAGG + Intergenic
947190952 2:227504085-227504107 GAGGAGGAGGAAGAGGAGGAGGG + Intronic
947228978 2:227866494-227866516 GAGGAGGAGGAGAAGGAAGAAGG - Intergenic
947248341 2:228074976-228074998 GAGGAAAAAGAGAAGGAGGAAGG + Intronic
947295663 2:228627759-228627781 AAGGAGAAGAAGAAGAAGGAGGG - Intergenic
947536533 2:230943335-230943357 GAGGAGGTGCACAGGAAGGAGGG - Intronic
947970601 2:234319924-234319946 GAAGAGAAGAAGGAGGAGGAGGG - Intergenic
948053004 2:234992414-234992436 GAGGAGTGTCACAAGGAGGAAGG + Intronic
948200262 2:236124461-236124483 GAGGCGAGGAACAAGGAGAAGGG + Exonic
948209595 2:236183052-236183074 AAGGAGGAAGACAAGGAGGAGGG - Intergenic
948234178 2:236375048-236375070 GAGGAAAGTCCCAAGGAGGATGG + Intronic
948458425 2:238117972-238117994 GAGGAGAAATAGATGGAGGAAGG + Intronic
948488314 2:238295350-238295372 GAGAAGAAGTAGAAGAAGGAGGG - Intergenic
948493407 2:238329028-238329050 AAGGAGAAGGCCAAGGAGAATGG + Exonic
948494487 2:238338078-238338100 GAGGAGGAGGAAGAGGAGGAGGG + Intronic
948538971 2:238672223-238672245 GAGGAAGAGGAGAAGGAGGAGGG - Intergenic
948539007 2:238672382-238672404 GAGAAGAAGGAGAAGGAGAAGGG - Intergenic
948558582 2:238835312-238835334 GAGGAGGAGGAGGAGGAGGAAGG - Intergenic
948577573 2:238964639-238964661 GAGGAGAAACGCAGAGAGGAAGG + Intergenic
948863165 2:240762718-240762740 GAGGAGGAGCCCGAGGATGAAGG - Exonic
948923808 2:241081391-241081413 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1168847151 20:953148-953170 GCCGAGAAGCACCACGAGGAAGG - Intergenic
1168870122 20:1120407-1120429 GAAGAGCAGCACAAAGAGAAAGG - Intronic
1169045541 20:2531884-2531906 GGAGAGAAGGAGAAGGAGGAGGG + Intergenic
1169561215 20:6802838-6802860 GAGGAGAAGGAGAAGGAGAACGG - Intergenic
1169636113 20:7693762-7693784 GGAGAGAAGGAAAAGGAGGAGGG - Intergenic
1169792058 20:9421631-9421653 GAGGAGAACCAAAAGGAGGCAGG - Intronic
1169984189 20:11423418-11423440 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1170061718 20:12265928-12265950 GAGGAGGGGCGCAAGGAGCATGG + Intergenic
1170158493 20:13289653-13289675 GAAGAGAAGGAGGAGGAGGAGGG + Intronic
1170579235 20:17685238-17685260 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1170821338 20:19758158-19758180 GAGGAGAGGAAAGAGGAGGAGGG - Intergenic
1170821357 20:19758207-19758229 GAGGAGGAGGAAGAGGAGGAAGG - Intergenic
1170841131 20:19925042-19925064 GAGGAGGAGCACAAAGAGGTGGG - Intronic
1170875766 20:20248563-20248585 GAGGAGAAGGAACAGGAGGCAGG + Intronic
1171116812 20:22531831-22531853 GAGGAGAGAGAAAAGGAGGAAGG + Intergenic
1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG + Intergenic
1171941186 20:31331312-31331334 GAGGAGCAGGAGAAGGAGGAGGG + Intergenic
1172061458 20:32189956-32189978 GAGGACGCGAACAAGGAGGAGGG - Intergenic
1172174505 20:32963986-32964008 AAGGAGAAGGAGAAGGAGAAAGG - Intergenic
1172357081 20:34287717-34287739 GAGAAGATGAACAAGGAGAAGGG + Intronic
1172644585 20:36461701-36461723 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1172798040 20:37556806-37556828 GAGGAGAAGGACAGGGAAGATGG - Intergenic
1172806181 20:37613460-37613482 GAGGAGAAGCAAAAGAGTGAGGG - Intergenic
1173134202 20:40424905-40424927 GAAGAGGAGGAGAAGGAGGAGGG + Intergenic
1173360254 20:42337823-42337845 GAGGAAAAGCAAAGGCAGGACGG + Intronic
1173556984 20:43973288-43973310 CAGGAGAAGCAGCCGGAGGAGGG - Intronic
1173666909 20:44769621-44769643 GAGGAGGAGGAGGAGGAGGAAGG - Intronic
1173701284 20:45074169-45074191 GATGAACAGCCCAAGGAGGAGGG - Intronic
1174110631 20:48195556-48195578 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1174400901 20:50275272-50275294 GAGGAGGAGAAGGAGGAGGAAGG - Intergenic
1174641774 20:52050482-52050504 GAGGAGAAAGAGGAGGAGGAAGG - Intergenic
1174709531 20:52690281-52690303 AAGGAGAAGAAAAAGGAGAAGGG - Intergenic
1174755127 20:53150716-53150738 GAGGAAAAGAAAAAGAAGGAGGG + Intronic
1174908424 20:54577812-54577834 GAGTTGAAGCTCAAGGAGGGAGG + Intronic
1174923231 20:54727644-54727666 AAGGAGAAAAACAATGAGGATGG - Intergenic
1175100624 20:56576247-56576269 GAGGAGTAGGAGGAGGAGGAGGG - Intergenic
1175102232 20:56587480-56587502 GAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1175199272 20:57266664-57266686 GAGGAGGAGGAGGAGGAGGACGG + Intergenic
1175298837 20:57928590-57928612 GAGGAGAAGGAGGAGGAGAAGGG - Intergenic
1175298908 20:57928882-57928904 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
1175457386 20:59125667-59125689 GGGGAAAAGCTCAGGGAGGAAGG + Intergenic
1175794928 20:61765574-61765596 GAGGAGGAGGAGGAGGAGGACGG + Intronic
1176290836 21:5043815-5043837 GAGGAGGAGGAAGAGGAGGAGGG - Intergenic
1176877337 21:14145654-14145676 GAGGAGAAGAAGGAGGAGAAAGG + Intronic
1177249368 21:18572253-18572275 GAGGAGGAGGAGAAGGAGAAAGG + Intergenic
1177631673 21:23736469-23736491 CATGACAAGCACAAGGTGGAGGG + Intergenic
1177758344 21:25373784-25373806 GAGGGGAAGGAGGAGGAGGAGGG - Intergenic
1178005140 21:28210365-28210387 GAGGAGAACCAGATGGATGATGG - Intergenic
1178038756 21:28615337-28615359 GAAGAGAAGGAAGAGGAGGAGGG - Intergenic
1178201058 21:30405756-30405778 GAGGAGAAGAATAAGAAAGAGGG - Intronic
1178219696 21:30642302-30642324 GAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1178715023 21:34956756-34956778 GAGGAGGAGAACGAGCAGGATGG - Intronic
1178745265 21:35243448-35243470 GAGGAGATGGAGAAGGAAGAGGG - Intronic
1179133679 21:38661022-38661044 GAGGAGGAGGAAGAGGAGGAGGG + Intronic
1179185399 21:39081804-39081826 AAGGAGAAGGAGAAGAAGGAGGG + Intergenic
1179236725 21:39554093-39554115 GAGCAGAAGGAAGAGGAGGAGGG - Intergenic
1179866419 21:44219826-44219848 GAGGAGGAGGAAGAGGAGGAGGG + Intergenic
1180301617 22:11040954-11040976 GAGGAGAAGGAGGAGGAGGAAGG + Intergenic
1180581505 22:16843448-16843470 GAAGAGAAGAACATGGAGAAGGG + Intergenic
1180872540 22:19154653-19154675 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
1181359621 22:22324366-22324388 GAGAAGATGGACAAGGAGGTAGG + Intergenic
1181369693 22:22406104-22406126 GAGAAGATGGACAAGGAGGTAGG + Intergenic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181813626 22:25420851-25420873 GAGGAGAAGGAGGAGGCGGAGGG + Intergenic
1181934354 22:26428591-26428613 GAGGGGAAGTACAGGCAGGACGG - Intergenic
1181959976 22:26616066-26616088 GAGGAGAAGAAGGAGGAGGAGGG + Intronic
1181977211 22:26738473-26738495 AAGGAGGAGAACAAGGAGGAGGG - Intergenic
1182043666 22:27258021-27258043 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1182051831 22:27318157-27318179 GAGGAGAAGCAGGAGGCGGGTGG + Intergenic
1182185833 22:28401171-28401193 GAGGAGAAGGAAAAGGAGGGGGG + Intronic
1182744266 22:32593605-32593627 GAGGAGGAGGAGAAGGAGGGAGG + Intronic
1182754582 22:32668516-32668538 AAGGAGAAGGAGAAGGAGAAAGG - Intronic
1182773989 22:32817590-32817612 GACCAGAAGAAAAAGGAGGAAGG + Intronic
1182806159 22:33072282-33072304 GAGGAGAAGGAGGAGGAGGTGGG + Intergenic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1183266199 22:36827339-36827361 GAGGAGGAGAGGAAGGAGGAAGG - Intergenic
1183359434 22:37375836-37375858 GAGGAGGAGGAGGAGGAGGAGGG - Exonic
1183404842 22:37625295-37625317 GAGGACAGGCAGAAGAAGGAAGG + Intronic
1183539741 22:38423144-38423166 GAGGAGCGGCACGAGGAGGGAGG + Intergenic
1183615707 22:38944075-38944097 GAGGAGAAGGAGAGGGAGGAAGG - Intergenic
1183645452 22:39123766-39123788 GCAGAGGAGCACAAGGAGGAAGG + Intronic
1183961341 22:41413610-41413632 GAGGAGAAAAAGGAGGAGGAGGG + Intergenic
1183987858 22:41579141-41579163 GAGGAGAGACACGAGTAGGAAGG + Intronic
1184047211 22:41978910-41978932 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1184092329 22:42299235-42299257 GAGGACAATCACAGGGAGGACGG + Intronic
1184121191 22:42451653-42451675 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1184280615 22:43435387-43435409 GAGGAGAGGTCCAAGGTGGATGG - Intronic
1184426328 22:44411193-44411215 GGGGAGAAGCACAGAGTGGACGG - Intergenic
1184449683 22:44575628-44575650 GAGGAGGATGACAAGGAGAAGGG + Intergenic
1184449793 22:44576077-44576099 GAGGAGGAGGAAGAGGAGGAGGG + Intergenic
1184505604 22:44899629-44899651 GAGGAGGAGAAGAAGAAGGAAGG - Intronic
1184526672 22:45027990-45028012 GAGGAGAAGGAGGAGGTGGAAGG + Intergenic
1184600212 22:45539056-45539078 GAGGAGGAGGAGAAGGAGAAAGG - Intronic
1184883819 22:47329815-47329837 GAAGAGGAGCAGAAGGAGGAAGG + Intergenic
1185016788 22:48348044-48348066 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1185188538 22:49418009-49418031 GGGGAGCAGCACCAGGAAGACGG + Intronic
1185201284 22:49507074-49507096 GAGGAGGAGGAGGAGGAGGAAGG + Intronic
1185234770 22:49705352-49705374 CAGGAGAACCACGAGGAGGACGG + Intergenic
1185398204 22:50603340-50603362 GAGGAGGAGGAGGAGGAGGAGGG + Exonic
949102541 3:163459-163481 AAGGAGAAGAAGATGGAGGAGGG - Intergenic
949127947 3:469091-469113 GAGGAAAAGGAGAAGGGGGACGG - Intergenic
950008444 3:9705620-9705642 GAGGAGAGGGACCAGGAGGGTGG - Intronic
950089546 3:10285932-10285954 GAAGAAAAGCACTAGCAGGACGG - Intronic
950283302 3:11725192-11725214 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
950283318 3:11725246-11725268 GAAGAAAAGGAGAAGGAGGAGGG - Intergenic
950729987 3:14948243-14948265 GAGGAGGAGGATAAGGAGGAAGG - Intronic
950841660 3:15973949-15973971 GAGGAAGAGGAGAAGGAGGAAGG - Intergenic
950962399 3:17119803-17119825 GAGGAGGAGGAGAAGGAGAAAGG - Intergenic
951033010 3:17903788-17903810 GAGGAGGAGGACAAAGAGGAAGG - Intronic
951271637 3:20632047-20632069 GAAGAGAAGTTCAATGAGGAGGG - Intergenic
951914082 3:27781140-27781162 CAAGAGAAGCACAAGGAGACAGG + Intergenic
952046488 3:29327486-29327508 AAGGAGGAGGAAAAGGAGGAAGG - Intronic
952107584 3:30087733-30087755 GAGGAGAAGGAGGAGGAGGGAGG - Intergenic
952107585 3:30087736-30087758 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
953025674 3:39143590-39143612 GAGGAGGAGGAAGAGGAGGAAGG - Exonic
953230239 3:41058297-41058319 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
953350278 3:42210096-42210118 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
953355744 3:42254919-42254941 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
953365400 3:42340417-42340439 GAGAAGGAGGAGAAGGAGGAGGG + Intergenic
953405829 3:42659340-42659362 GAGGAGGAGGAAGAGGAGGAAGG + Exonic
953577157 3:44122013-44122035 GAGTGGAAGCACAAGCAGCAAGG + Intergenic
953855655 3:46497592-46497614 GAGGAGAGGCACAGGGAAGAAGG - Exonic
954000135 3:47550011-47550033 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
954038456 3:47866404-47866426 GAGGGGAAGAAAAAGGAGGAAGG + Intronic
954152028 3:48662563-48662585 GAGGAGAAGGAGCAGGAGTATGG + Exonic
954264492 3:49461850-49461872 GAGGAGGAGGAGAAGGAGGGTGG - Intergenic
954386352 3:50246101-50246123 GGGGAGCAGCACCTGGAGGAAGG + Intronic
954389833 3:50262892-50262914 GAGGACAGGCACAGGGAGGCGGG - Intergenic
954524862 3:51261260-51261282 GAGGGCAAGCAGAAGGAGGGTGG + Intronic
954581043 3:51703112-51703134 GAGCTGAAGTACGAGGAGGATGG - Intronic
955006845 3:54976597-54976619 AAGAAGAAGAATAAGGAGGATGG - Intronic
955307393 3:57848145-57848167 GAGGAGAAGAAGAAGGAAGAAGG - Intronic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955514294 3:59711510-59711532 GAGAAGGAGGAGAAGGAGGAGGG - Intergenic
955643864 3:61115402-61115424 AAGGCCAAGCACAAGGAGGCTGG + Intronic
955660124 3:61289865-61289887 GAGGAGAAGAAATAGGACGAAGG + Intergenic
955753240 3:62203569-62203591 GAGCGGGAGCACGAGGAGGATGG + Exonic
955840773 3:63110445-63110467 GAGGAGGAAGAGAAGGAGGAGGG + Intergenic
956176302 3:66476358-66476380 GAGGAGAGGCTAAGGGAGGAAGG - Intronic
956290418 3:67654645-67654667 GAGGAGGAGCAGCGGGAGGAGGG + Intergenic
956440926 3:69279752-69279774 GGGGAGGAGGAGAAGGAGGAGGG - Intronic
956547776 3:70424958-70424980 GAGGAGGAGAAAAAGAAGGAGGG + Intergenic
956680426 3:71774447-71774469 GAAGAGAAGCAAAAGGAAAAAGG - Exonic
956737619 3:72250195-72250217 GGGGAGAAGCAGGAGGAGGCTGG + Intergenic
956784427 3:72630576-72630598 GGGGAGAAGCAGAAGGAAGAAGG + Intergenic
956952264 3:74296253-74296275 GAGGAGAAGAAAAATGAGGGAGG + Intronic
956974191 3:74561255-74561277 GAGGAGAATAGCAAGGAGGATGG - Intergenic
957328501 3:78728208-78728230 GAGGAGAAGGAAAAGGAGGAAGG + Intronic
957520342 3:81311215-81311237 GAGGAGGAAGAAAAGGAGGAAGG + Intergenic
957663255 3:83188486-83188508 GTGGAGATGCACATGGATGAGGG + Intergenic
957788353 3:84908984-84909006 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
957805892 3:85148871-85148893 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
957813154 3:85254745-85254767 GAGGAGGAACACAAGAAGGTTGG + Intronic
957899926 3:86476169-86476191 GAGGAGGAGAAGGAGGAGGAAGG + Intergenic
957899945 3:86476258-86476280 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
958075835 3:88677033-88677055 GAGGAGGAGCAGAAAAAGGAAGG - Intergenic
958154597 3:89740355-89740377 GAGGAGGAGGAGAAGGAGGGGGG + Intergenic
959172274 3:102857911-102857933 GAGGAGGAGGAAGAGGAGGAGGG - Intergenic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959539903 3:107525327-107525349 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
959662434 3:108883942-108883964 GTGCAAAAGCACAAGGGGGAAGG - Intergenic
959725081 3:109533626-109533648 GAGGAGAAGGAAAAGCAGGGAGG - Intergenic
959963891 3:112332608-112332630 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960121677 3:113953672-113953694 CAGAAAAAGCACAAAGAGGAGGG - Intronic
960723648 3:120648974-120648996 GAGGAGAAGCCCAAAGTTGAAGG - Intronic
960760163 3:121064267-121064289 GAGGAGGAGCAGAAGCAGGGTGG - Intronic
960972372 3:123149069-123149091 GAGGACAAAGACAGGGAGGAAGG + Intronic
961094711 3:124144480-124144502 GAGGAGGAGGACGAGGATGATGG - Intronic
961345475 3:126260747-126260769 TGGGAGAAGAACAGGGAGGAAGG - Intergenic
961487516 3:127227276-127227298 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
961712864 3:128840610-128840632 GAGGAGCAGCCCAGGGAGAAGGG + Intergenic
962391277 3:134974876-134974898 CAGGAGCAGCTCAAGCAGGAAGG - Intronic
962498405 3:135965681-135965703 GAGGAGGAGGAGAAGGAGGTAGG + Exonic
963049325 3:141128034-141128056 GAGGAGAAGAAAAAGAAGGCTGG + Intronic
963928714 3:150979190-150979212 GGAGAGAAGCAGAAGGAGTAGGG + Intergenic
963987807 3:151617335-151617357 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
964886461 3:161489199-161489221 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
964941052 3:162158225-162158247 GAGGAGCAGCCTAGGGAGGAGGG + Intergenic
965172184 3:165279927-165279949 GAGGTGAAGAAGAAGGAGGAGGG - Intergenic
965439382 3:168694006-168694028 GAGGAGAAGTAGCAGCAGGAGGG + Intergenic
965451576 3:168845384-168845406 GAGGAGGAGTAGGAGGAGGATGG - Intergenic
965611359 3:170547131-170547153 GAGGAAAAGGAGAAGAAGGAAGG - Intronic
965667872 3:171115357-171115379 GAGGAGAAGCACAAGCCACAGGG + Intronic
965888099 3:173474129-173474151 AAGGAAAAGGAAAAGGAGGAGGG - Intronic
965895020 3:173565069-173565091 GATGAGAGACACAAGGAGTACGG + Intronic
966257165 3:177930221-177930243 CAGCAGAAGCCCAAGGTGGAAGG + Intergenic
966319891 3:178690516-178690538 GAGGAGAATGAGAAGGAAGAAGG + Intronic
966370944 3:179250150-179250172 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
966521915 3:180882423-180882445 GAGGAGGAGGAGAAGGAGGAAGG - Intronic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
966879381 3:184341397-184341419 GAGGAGAGGGAAGAGGAGGAAGG - Intronic
966895104 3:184439078-184439100 AAGGAGAAGGAGAAGGAGAAAGG + Intronic
966902672 3:184498325-184498347 CAGGAAAAGAACACGGAGGAGGG - Intronic
966908496 3:184544545-184544567 GGGGAGAAGGAGGAGGAGGAGGG - Intronic
966908546 3:184544673-184544695 GAGGAGGAGAAGGAGGAGGAGGG - Intronic
966908573 3:184544755-184544777 GAGGAGGAGGAGAGGGAGGAGGG - Intronic
967214136 3:187195991-187196013 CAGGAGAAGCACTTGGAAGATGG + Intergenic
967341708 3:188405910-188405932 GAGGAGGAGGAAAAGGAGGAAGG - Intronic
967360492 3:188624749-188624771 AAGGAGAAGGAGAAGGAGAAGGG - Intronic
967365483 3:188681660-188681682 AAGGAGAAGGAAAAGGAGGGAGG + Intronic
967375604 3:188797115-188797137 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
967529603 3:190533491-190533513 CAGGGGAAGCACAGGGGGGAGGG - Intronic
967864933 3:194182291-194182313 AAGGAAGAGCAGAAGGAGGAGGG - Intergenic
967987742 3:195107636-195107658 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
968359896 3:198139565-198139587 GACGAGGAGGACAAGGGGGAGGG + Intergenic
968671278 4:1853109-1853131 GGGGAGGAGCAGAATGAGGAGGG - Intronic
968672158 4:1857431-1857453 GCGGAGAAGCAGGAGGAGGCAGG - Intergenic
968881380 4:3301834-3301856 GAGGAGAAGAACATGGACGTTGG + Intronic
968889166 4:3358890-3358912 GAGGAGAAGGAGGAGGAGAAGGG - Intronic
968943588 4:3652110-3652132 GTGCAGAAGCACAAGGGGCAAGG - Intergenic
969176353 4:5402022-5402044 GGGGATAAGCTCAAGGAGCAGGG - Intronic
969483886 4:7460976-7460998 AAGGAGCAGCACGAGGATGATGG - Intronic
969654201 4:8486894-8486916 GAGGAGCAGCCCAGGGAGGAGGG + Intronic
969723094 4:8904143-8904165 GAGGAGAAGCAGCAGGTCGAGGG - Intergenic
969954804 4:10877995-10878017 AAGGAGGAGGAAAAGGAGGAAGG - Intergenic
969979534 4:11140494-11140516 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
969995071 4:11303575-11303597 CGGGAGAAGAACAAGGAAGAAGG - Intergenic
970162624 4:13204658-13204680 GAGAAGGAGAGCAAGGAGGATGG - Intergenic
970195577 4:13547597-13547619 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
970274619 4:14385141-14385163 TGGGAGAAGAAAAAGGAGGAGGG - Intergenic
970338751 4:15082489-15082511 GAGGAGAAGGCAAAGGAGAAAGG + Intergenic
970401780 4:15724203-15724225 TAAGAGAAACACAAAGAGGAAGG - Intronic
970645295 4:18113826-18113848 GAGGAGAAGAAGAAGGGGAAGGG + Intergenic
971002693 4:22340360-22340382 GAGGAGAACGAGGAGGAGGAGGG + Intergenic
971094682 4:23387374-23387396 AAGGAGAAGCAGAAGTAAGATGG - Intergenic
971145998 4:23976959-23976981 GAGGAAAAGGAAAAGGAAGAAGG + Intergenic
971174024 4:24263589-24263611 GTGGAGATGGACAAGGTGGAAGG - Intergenic
971420251 4:26467893-26467915 GAGGGGAAGAAGAAGAAGGAGGG + Intergenic
971559014 4:28050855-28050877 GAGGAGCTGGACAAGGAGTAGGG + Intergenic
971633812 4:29031262-29031284 GAGGAGAAGGAGGACGAGGAGGG - Intergenic
971633841 4:29031426-29031448 GAGGAGGAGAAAGAGGAGGAGGG - Intergenic
971667802 4:29513874-29513896 GAGCAGAAGGATAAGAAGGAAGG - Intergenic
972279606 4:37589591-37589613 GAAGAGAGCCAAAAGGAGGAAGG - Intronic
972738069 4:41865045-41865067 GGGGAGAAGGGCAAGGAGGGAGG + Intergenic
972741124 4:41886998-41887020 GAGCAGTATCACAAGGAAGAGGG - Intergenic
972897476 4:43641317-43641339 GAAGAGAAGAAAAAAGAGGAGGG - Intergenic
972990497 4:44817683-44817705 GAGGAAGAGGAGAAGGAGGAAGG + Intergenic
973110285 4:46390007-46390029 GAGGAGGAGGAAGAGGAGGAGGG + Intronic
974112201 4:57538051-57538073 GAGGAGGATCAGGAGGAGGAGGG - Intergenic
974229244 4:59088853-59088875 GAGGAGGAGAAGGAGGAGGAAGG - Intergenic
974682897 4:65186661-65186683 GAGGAGAAGAAGGAAGAGGAAGG + Intergenic
975163204 4:71147494-71147516 GGGGAGAAGTGCAAGGAGAAAGG - Intergenic
975645501 4:76542043-76542065 GAGGAGGAGGAGGAGGAGGATGG + Intronic
975864011 4:78707387-78707409 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
975969403 4:80015712-80015734 GAAGAGAAGAAGCAGGAGGAGGG + Intronic
976143258 4:82015283-82015305 GAAGAAAAGGAGAAGGAGGAGGG + Intronic
976303439 4:83536427-83536449 GAGGAGGAGCCCAGGGAGGAAGG + Intronic
976478386 4:85510799-85510821 GAGGAGGAGGAGGAGGAGGAAGG - Intronic
976561967 4:86511893-86511915 AAGGAGAAGAATGAGGAGGAAGG + Intronic
976635111 4:87279564-87279586 GAGGAGAGGCAGAATGAGGCGGG + Intergenic
976777179 4:88719570-88719592 GAGGAGGAGAAGAAGGAGAAAGG - Intergenic
977292924 4:95182516-95182538 GAGGAGAGACAGATGGAGGATGG + Intronic
977416890 4:96744243-96744265 GAGGAGGAGAACAAAGAGGGAGG - Intergenic
977586596 4:98781346-98781368 GAGGAACAGCACAAATAGGATGG - Intergenic
977666440 4:99650918-99650940 GAGGAGGAGGTCAAGGAGGAAGG - Exonic
977666982 4:99653641-99653663 GGGGAGGAGGAAAAGGAGGAGGG - Exonic
977788524 4:101069699-101069721 GAGGAGAAGGAAGAGGAAGAGGG - Intronic
977790262 4:101091871-101091893 GAGGAGGAGGAGGAGGAGGAAGG + Intronic
978264727 4:106810197-106810219 GAGGAGGAGGAGGAGGAGGAAGG - Intergenic
978415833 4:108474915-108474937 GAGCAGAAGCAAGAGGAAGAGGG - Intergenic
978858321 4:113418646-113418668 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
978922473 4:114201020-114201042 GAAGAGAAGAAAAAGTAGGAAGG - Intergenic
979364907 4:119809863-119809885 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
979373303 4:119914758-119914780 GAGGAGAAATACAAGCTGGATGG - Intergenic
979375455 4:119941502-119941524 GAGGAGGAGAAAGAGGAGGAGGG - Intergenic
981025035 4:140069399-140069421 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
981025047 4:140069453-140069475 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
981025062 4:140069514-140069536 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
981131502 4:141162651-141162673 GAGGACAAGCAGAAGCAGGGTGG + Intronic
981430235 4:144648759-144648781 GAGGAGAAGGGGAAGGGGGATGG + Intronic
981809662 4:148759493-148759515 GAGGAGGAGCAAGAGGAGGAGGG + Intergenic
982318711 4:154057918-154057940 GAGGAGCAGCCTGAGGAGGAGGG - Intergenic
982364369 4:154559185-154559207 GAGGAGAAGAAGAAGGGGAAGGG - Intergenic
982508743 4:156253196-156253218 GAAGAGAAGCACAAGGATAATGG + Intergenic
982567352 4:157002392-157002414 GAAGAGAAACACAAAGAAGAAGG - Intergenic
983379832 4:166978676-166978698 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
983655966 4:170084974-170084996 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
983698259 4:170559503-170559525 GAGGAGAAGCAGGAGCAGGCAGG - Intergenic
983930907 4:173452353-173452375 GAGCAAAAGCAAGAGGAGGATGG + Intergenic
984118238 4:175709225-175709247 GAGGAGGAGAAGAGGGAGGAAGG - Intronic
984125407 4:175803131-175803153 GAGGAGAAAGAGAAGGAAGAGGG - Intronic
984617537 4:181915644-181915666 GAGGAGAAGCAGAGAGGGGAGGG + Intergenic
985217227 4:187666861-187666883 GAGGAGACGCTAAAGGAAGATGG - Intergenic
985345049 4:188995512-188995534 GAGCAGAAGCAGAAGGACAAAGG + Intergenic
985652281 5:1112560-1112582 GAGGGGGCGCAGAAGGAGGAGGG - Intergenic
985679994 5:1250943-1250965 GAAGAGAAGAAGAAGGAAGAAGG - Intergenic
985756642 5:1723427-1723449 GAGGAAAAGAGAAAGGAGGAGGG - Intergenic
986221730 5:5774769-5774791 GAGGAGAAGGAGGAGGGGGAGGG - Intergenic
986221782 5:5774973-5774995 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
986294213 5:6423864-6423886 GAGGAAAAACACAGGAAGGAAGG + Intergenic
986566759 5:9123416-9123438 AAGAAGAAGGAAAAGGAGGAGGG + Intronic
986636068 5:9823615-9823637 GAGGAGAGGGAAAGGGAGGAAGG + Intergenic
986673851 5:10166974-10166996 GAGGAGACACACAGGGAAGAAGG + Intergenic
986970970 5:13336043-13336065 CAGGAGTAACACAAGGAGCAAGG + Intergenic
987016336 5:13823559-13823581 GAGGAAAAGAACAGGGAGAAAGG + Intronic
987032876 5:13991569-13991591 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
987062367 5:14254644-14254666 GAGAAGAAACAGGAGGAGGAGGG - Intronic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987353221 5:17039920-17039942 GAGGAGGAGAAGGAGGAGGATGG - Intergenic
987518598 5:18948220-18948242 GAGAAGAAGAAGAAGAAGGAGGG + Intergenic
987734064 5:21816170-21816192 GAGGAGAAGGAGGAAGAGGAGGG - Intronic
987766704 5:22240949-22240971 GAGGAGAAGGGCAAGGAAGGAGG + Intronic
988106075 5:26750156-26750178 AAGGAGAAGAAAAAAGAGGAGGG - Intergenic
988677269 5:33445336-33445358 GAAGAGAAGCAAAAGGAAGGAGG + Exonic
988836072 5:35033559-35033581 GAGAAGAAACAACAGGAGGATGG + Intronic
989100132 5:37815485-37815507 GAGGAGGAGGAGGAGGAGGAAGG - Intronic
989823272 5:45821630-45821652 GAGGAGAAGAGCAAGGAAAATGG + Intergenic
990182296 5:53174516-53174538 GAGGAGGAGGAGAAGGAAGAAGG + Intergenic
990494942 5:56338023-56338045 GAGAAGGAGCAGGAGGAGGAGGG - Intergenic
990549141 5:56855113-56855135 GAGGAGGAGAAAAAGGAGGAGGG - Intronic
990570999 5:57078773-57078795 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
990616839 5:57517246-57517268 GAAGAGAAACACATGGAGTAAGG + Intergenic
991008092 5:61851348-61851370 GAGGAGAAGAACAAAGTTGAAGG + Intergenic
991116140 5:62957709-62957731 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
991435958 5:66597001-66597023 GAGGAGCAGGACGAGGAGGTGGG + Exonic
991939847 5:71839914-71839936 GAGGAGAAGTTCAAGGAGGATGG + Intergenic
992063979 5:73086664-73086686 GAAGAGAAGCACAAGATGCAAGG - Intronic
992073896 5:73173663-73173685 CTGGAGAACCATAAGGAGGAGGG - Exonic
992090649 5:73312971-73312993 GAGGAGGAGGAGAAGGAAGAAGG - Intergenic
992371059 5:76144632-76144654 GAGGAGATACAAAAGGAGAAGGG + Intronic
992629661 5:78667956-78667978 AAGGGGAAGAAAAAGGAGGAGGG - Intronic
993021136 5:82592477-82592499 GAGGAGGAGGAGAAGGAGGAAGG - Intergenic
993033373 5:82729877-82729899 GAGGAGAAGGAGGAAGAGGAAGG - Intergenic
993477033 5:88378911-88378933 GAATACAAGCACAAAGAGGATGG + Intergenic
993509898 5:88758110-88758132 GAGGAGAAGTGCTTGGAGGAAGG - Intronic
993716128 5:91277355-91277377 GAGGAGGAGGAGAAGGGGGAGGG + Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994043596 5:95284600-95284622 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
994541294 5:101101637-101101659 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
994556835 5:101316568-101316590 GAGGAGCAGCCCGGGGAGGAGGG - Intergenic
994738581 5:103589999-103590021 GAGGAGGAGGAGGAGGAGGAAGG + Intergenic
994825405 5:104707667-104707689 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
994869685 5:105331629-105331651 GAGGAGAGGGAGGAGGAGGAGGG + Intergenic
995035147 5:107525709-107525731 GAGGAGAAGGAGAAAGAAGAGGG + Intronic
995044698 5:107632559-107632581 GAAGAGAAGAACAAGGAAGACGG - Intronic
995069668 5:107904925-107904947 GGGGTGAAGCAGGAGGAGGAGGG + Intronic
995214732 5:109582348-109582370 GAGGAGAAGGAAGAGGAGGGGGG + Intergenic
995548209 5:113253575-113253597 GCAGATGAGCACAAGGAGGAGGG + Intronic
995836518 5:116405335-116405357 GAGGAGAAGGACAAGGCAGAGGG - Intronic
996091856 5:119359147-119359169 TAGGAGGAGCCCAAGGTGGAAGG - Intronic
996118211 5:119642547-119642569 GAGGAGAGGCAGAAGGATGGAGG - Intergenic
996154384 5:120080002-120080024 CAGGAAAGGCACAATGAGGAGGG + Intergenic
996165745 5:120220734-120220756 GAGGAGGAGGAAAAGGAGGTGGG - Intergenic
996465963 5:123803050-123803072 GGGGAGAAGGCCAAGGAGAAGGG - Intergenic
996910963 5:128656268-128656290 GAGGGGGAGCAGAAGCAGGATGG - Intronic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997084271 5:130778519-130778541 GAGGAGAAGGAAGAAGAGGAGGG + Intergenic
997827937 5:137124311-137124333 GGGGAGAAGCACAGAGAAGAGGG - Intronic
998395023 5:141812678-141812700 GAGGAGGAGGAGCAGGAGGAGGG + Intergenic
998465674 5:142341889-142341911 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
998484086 5:142486597-142486619 GAGGAGGAGGGAAAGGAGGAAGG - Intergenic
998533653 5:142908872-142908894 GAGGAGACTCACAAGCAGGCAGG - Intronic
998821819 5:146064135-146064157 GAGGAGAAGGAGAAAGAGGAGGG + Intronic
999089308 5:148921372-148921394 GAGAAGGAGGAAAAGGAGGATGG + Intergenic
999137219 5:149329952-149329974 GAGGAGGAGGAGAAGGAGGAGGG - Intronic
999147612 5:149406522-149406544 GAGGAGGAGGAGGAGGAGGAAGG - Intergenic
999178364 5:149648379-149648401 GAGGAGGAGAGCAAGGAGGGAGG - Intergenic
999189175 5:149733394-149733416 GAGGAGAAGGCCATGCAGGACGG - Intronic
999296533 5:150462947-150462969 GAGGAGAACCAGAGGGAGAAGGG + Intergenic
999440278 5:151595472-151595494 AAGGAGGAGCAGAAGGTGGAAGG + Intergenic
999980048 5:156949418-156949440 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1000010112 5:157223132-157223154 GAGCAGAGGCAGAAGGAAGAGGG + Intronic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000294496 5:159901386-159901408 GAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1000519502 5:162279425-162279447 GAGGAGCAGCCCGGGGAGGAGGG + Intergenic
1000747655 5:165055053-165055075 GAGGAGGAGTAGAAGGAGGAAGG - Intergenic
1000799785 5:165711767-165711789 GGTGAGTAGCACATGGAGGATGG - Intergenic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001315577 5:170638981-170639003 GAGCAGACACACAAAGAGGAGGG + Intronic
1001543710 5:172557110-172557132 GAGCAGAAGCAGGAGGAGGGAGG - Intergenic
1001901521 5:175434532-175434554 GATGAGGACGACAAGGAGGAAGG + Intergenic
1002352440 5:178592412-178592434 GAGCAGAGGCAGAAGGAAGAAGG + Intergenic
1002937701 6:1687653-1687675 GAGGAGAGACACAAAGAGGCAGG + Intronic
1002969125 6:1996093-1996115 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1003190914 6:3873740-3873762 GAGGAAAAGGACAGAGAGGAAGG + Intergenic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003515159 6:6811688-6811710 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1003856940 6:10286045-10286067 GAGGAGGAGGAGAAGGAGGGAGG + Intergenic
1003872779 6:10415113-10415135 GTGGAGGAGGAGAAGGAGGAGGG + Exonic
1004266431 6:14152007-14152029 GAGGAGAAGGGGGAGGAGGAGGG - Intergenic
1004278498 6:14258882-14258904 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1004368474 6:15031865-15031887 GAGAAGAAGAAGAAAGAGGAGGG + Intergenic
1004462714 6:15853428-15853450 AAGGAGAAGCAGAAGGGGAAGGG - Intergenic
1004473279 6:15947868-15947890 CAGGAGAGGCACAGGAAGGAGGG + Intergenic
1004577029 6:16906831-16906853 GAGGAAAAGAAAAAGAAGGAAGG + Intergenic
1004636105 6:17469257-17469279 GAAGAGAAGCACCCGGAGGGTGG + Intronic
1004698799 6:18059177-18059199 GAGGATGAGCAAGAGGAGGAAGG - Intergenic
1004869529 6:19890730-19890752 GAGGAAAAGAAGAAGGAGAAAGG - Intergenic
1005011498 6:21340165-21340187 AAGAAGAAGCACATGGAAGAGGG - Intergenic
1005081924 6:21965306-21965328 GAGGAGGGGAAGAAGGAGGAGGG - Intergenic
1005081929 6:21965321-21965343 GAGGAGGGGAAGAAGGAGGAGGG - Intergenic
1005081934 6:21965336-21965358 GAGGAGGGGAAGAAGGAGGAGGG - Intergenic
1005081939 6:21965351-21965373 GAGGAGGGGAAGAAGGAGGAGGG - Intergenic
1005081944 6:21965366-21965388 GAGGAGGGGAAGAAGGAGGAGGG - Intergenic
1005081949 6:21965381-21965403 GAGGAGGGGAAGAAGGAGGAGGG - Intergenic
1005081954 6:21965396-21965418 GAGGAGGAGAAGAAGGAGGAGGG - Intergenic
1005089200 6:22038549-22038571 GAAGAAAAAGACAAGGAGGAGGG - Intergenic
1005385242 6:25279272-25279294 GAGAAGGAGGAGAAGGAGGAGGG + Intronic
1005495450 6:26383862-26383884 GAGGAGCAGGAGGAGGAGGAGGG - Exonic
1005829230 6:29657253-29657275 GAGGAGGAGGAGGAGGAGGAAGG - Exonic
1005864274 6:29926605-29926627 GGGGAGCAGCGCAAGGAGGAGGG + Intergenic
1005929074 6:30467411-30467433 GAGGAGAAGGCCAAGGAAGAGGG + Intergenic
1005939803 6:30552568-30552590 GAGGAGGAGGAAGAGGAGGATGG - Exonic
1005959053 6:30683602-30683624 GAGGGGAAACCCAGGGAGGAAGG + Intronic
1005976619 6:30804978-30805000 GAAGAGATGCACAGGGAGAAGGG + Intergenic
1006268855 6:32948909-32948931 GAGGAGAAGGAGGAGGAGGATGG - Intronic
1006288230 6:33114161-33114183 GAGGAAAGGCACAAGGAGCCAGG + Intergenic
1006313944 6:33279432-33279454 GGGCAGAGGCACAAGCAGGAGGG + Intronic
1006599056 6:35213838-35213860 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1006633830 6:35448289-35448311 GAGTAGAAGGACGAAGAGGAGGG + Intergenic
1006813598 6:36836717-36836739 GGAGAGGAGCACAGGGAGGAGGG - Intronic
1007071868 6:39043828-39043850 GAAGAGAAGCAGGAGGTGGAGGG + Intergenic
1007126500 6:39430150-39430172 GAGAAGAAGCATAAAGAAGAGGG - Intronic
1007134481 6:39507958-39507980 GAGGAGGAGGAGGAGGAGGAAGG - Intronic
1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG + Intergenic
1007418047 6:41703440-41703462 GAGGAGCAGCCCCAGGAGCAGGG - Intronic
1007537375 6:42605117-42605139 GAGATGGAGCACAAGGAAGAAGG - Intronic
1007827105 6:44608762-44608784 GAGGAGGAGGAGAAGGAGGATGG - Intergenic
1008054565 6:46933015-46933037 GAGGAGAAGCACAAAGTTGGAGG + Intronic
1008174105 6:48245565-48245587 GAGAAGAATCACAAGCATGAAGG - Intergenic
1008225014 6:48904446-48904468 GAGGAGAAGAAGAAGTAGAAGGG - Intergenic
1008369232 6:50714441-50714463 CAGTAGATGCACAAGGGGGATGG + Intronic
1008648975 6:53544653-53544675 GAGGAGGAGGAGGAGGAGGAGGG - Exonic
1011300165 6:85865317-85865339 CAGGAGAAGAGCAAGGAAGAAGG - Intergenic
1011888420 6:92126674-92126696 GAGGAGGAGCAGGAGGAAGAGGG + Intergenic
1012091410 6:94902558-94902580 GAGGAGAAGAAAGAGTAGGAAGG + Intergenic
1012325973 6:97917969-97917991 GAGGAGGAGAAGGAGGAGGAAGG - Intergenic
1012596006 6:101041074-101041096 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1012754331 6:103205784-103205806 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1012931849 6:105325746-105325768 GAGGATAAGAACAAGGAAGGTGG + Intronic
1013267152 6:108511130-108511152 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1013325235 6:109039081-109039103 GAGGAAAAGGAGAAGGAGGGAGG + Intronic
1013325239 6:109039100-109039122 GAGGAGAAGGAGAAGGAAGGAGG + Intronic
1013342839 6:109232105-109232127 GAGGAGTGGCAGAAGGAAGAGGG - Intergenic
1013351928 6:109313605-109313627 GAGGAGAAGAAACAGGAGGTAGG + Intergenic
1013414008 6:109908617-109908639 GAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1013492359 6:110660742-110660764 GAGGAGAAGCAGCTGGAGGTTGG - Intronic
1013668823 6:112376151-112376173 GAGGAGAAGGAAAATGAGGGAGG + Intergenic
1013836772 6:114343089-114343111 GAGGAGGAGCACGGGGAGGAGGG - Intergenic
1014113302 6:117645454-117645476 GAGGACAAGCCAAAGGAGGGTGG + Intergenic
1014129428 6:117813665-117813687 GAGGAGAGGGACATGGAAGAGGG + Intergenic
1014567947 6:122973866-122973888 GAGGAGACGAAGAATGAGGATGG + Intergenic
1014617553 6:123622128-123622150 GAGGAGGAGGAAAAAGAGGAAGG - Intronic
1014869951 6:126581901-126581923 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1015027495 6:128554069-128554091 GAAGAGAGGGAGAAGGAGGATGG - Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015308483 6:131736972-131736994 GAGGAGAAACACAGGGGAGAAGG - Intronic
1015341098 6:132101826-132101848 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1015445577 6:133300211-133300233 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
1015452642 6:133388929-133388951 GAGCAGAAGCAGAAGGACGTGGG - Intronic
1015547866 6:134379991-134380013 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1015763753 6:136693349-136693371 CTGGAAAAGCACAAGGTGGAAGG - Intronic
1015857104 6:137636511-137636533 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1016245912 6:141980599-141980621 GAAGAGAAGGAAAGGGAGGATGG + Intergenic
1016330103 6:142945960-142945982 GAGGAGGAGGAGAAGGAGGACGG + Intergenic
1016391315 6:143578646-143578668 GAGGAGGAGGAGGAGGAGGAAGG + Intronic
1016749178 6:147613732-147613754 GAGGAAGAGCAGAAGGGGGAAGG + Intronic
1016994041 6:149948299-149948321 GAGGAGAGGCTCAAGAAGAAGGG + Intronic
1017041836 6:150314319-150314341 GAGGAAGAGGAAAAGGAGGAGGG + Intergenic
1017192211 6:151666696-151666718 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1017339591 6:153305279-153305301 AAGGAGAAGGAGAAGGAGAAGGG - Intergenic
1017587444 6:155942789-155942811 GAAGAGGAGCAGGAGGAGGAAGG + Intergenic
1017665256 6:156713746-156713768 GAGGAGGAGGCAAAGGAGGAGGG + Intergenic
1017777006 6:157688392-157688414 GAGGAGGAAGACAAGGGGGATGG + Intergenic
1017995971 6:159531960-159531982 GAGCAGCAGCAGAAGGAGAAGGG - Intergenic
1018449192 6:163890891-163890913 GAGGAGTTGAAGAAGGAGGAGGG - Intergenic
1018494314 6:164333273-164333295 GAGGATAAGCACAAGCAACAAGG + Intergenic
1018864232 6:167734965-167734987 GAGGAGGGTCAAAAGGAGGATGG + Intergenic
1018928786 6:168225898-168225920 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1018928795 6:168225922-168225944 GGGGAGAAGGAGAAGGAGGAGGG - Intergenic
1018973932 6:168549593-168549615 GAGGAGGAGGAAGAGGAGGAGGG + Intronic
1019013341 6:168860923-168860945 GAGGAGAGGGAGAAAGAGGAAGG + Intergenic
1019198060 6:170293712-170293734 GAGGAGAAGGAAGAAGAGGAAGG - Intergenic
1019234395 6:170597537-170597559 GAAGGGAAGCAAAGGGAGGAAGG + Intergenic
1019260092 7:77084-77106 GACGAGGAGGACAAGGGGGAGGG - Intergenic
1019419103 7:942473-942495 GAGGAGGAGGAAGAGGAGGAAGG + Intronic
1019419144 7:942634-942656 GAGGAGGAGGAAGAGGAGGAAGG + Intronic
1019419179 7:942761-942783 GAGGAGGAGGAAGAGGAGGAAGG + Intronic
1019419209 7:942870-942892 GAGGAGGAGGAAGAGGAGGAAGG + Intronic
1019419257 7:943061-943083 GAGGAGGAGGAAGAGGAGGAAGG + Intronic
1019419329 7:943344-943366 GAGGAGGAGGAAGAGGAGGAAGG + Intronic
1019473227 7:1232240-1232262 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1019494936 7:1333395-1333417 GAGGAGAAGGGGGAGGAGGAGGG - Intergenic
1019531752 7:1506697-1506719 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1019535282 7:1526141-1526163 GAGGAGAAGAAGAAGAAGAAGGG + Intergenic
1019535306 7:1526228-1526250 GAGGAGAAGAAGAAGAAGAAGGG + Intergenic
1019549245 7:1594006-1594028 GAGGGAAAGAAGAAGGAGGAGGG - Intergenic
1019797636 7:3063525-3063547 GAGGAGAAGCAGAAGAAAGAAGG - Intergenic
1019830276 7:3321683-3321705 GAGGAGGAGGAGAAGGAAGAAGG - Intronic
1019943980 7:4312209-4312231 GAGCAGAAGCAGAGGGAGGGAGG - Intergenic
1019945372 7:4324541-4324563 GAAGAAAAGGAGAAGGAGGATGG - Intergenic
1020011402 7:4807704-4807726 GGGGAGAAGGAGAGGGAGGAGGG - Intronic
1020011514 7:4808087-4808109 GAAGAGAGGAAGAAGGAGGAGGG - Intronic
1020026813 7:4905350-4905372 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1020577336 7:9949778-9949800 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1020577394 7:9949989-9950011 GAGGAGGAGGAAGAGGAGGAGGG + Intergenic
1020828136 7:13058019-13058041 GAGGAGAAGCAGAAAGAAGGAGG - Intergenic
1020887719 7:13840066-13840088 GAGGAGAAAAGAAAGGAGGAAGG + Intergenic
1021116115 7:16748099-16748121 GAGGAGGAGAAGGAGGAGGAAGG + Intergenic
1021467343 7:20960017-20960039 AAGGAAAAGCATAAGAAGGAAGG - Intergenic
1021616151 7:22505100-22505122 GAGAAGAGGAAGAAGGAGGAAGG + Intronic
1021675492 7:23076532-23076554 TAGGGGAAGGACAATGAGGAAGG + Intergenic
1021827931 7:24573311-24573333 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1021850292 7:24801401-24801423 GAGGAGAAGAATCAGGAGGCTGG - Intronic
1022323151 7:29305803-29305825 GAGGAGAAAGACGAGGAGGAAGG - Intronic
1022477431 7:30720725-30720747 GAGAAGAAGGACAAGCAGAAGGG - Intronic
1022503458 7:30896669-30896691 GAGGGGAGGCAAAAGGAGGCAGG - Intergenic
1022523422 7:31022396-31022418 GATGAGCAGCACATGGAGCAGGG + Intergenic
1022591798 7:31670866-31670888 GAGGAGAAGCAGCTGGAGGTCGG + Intergenic
1022925942 7:35056316-35056338 GAGAAGAGGAAGAAGGAGGAAGG + Intergenic
1023045174 7:36204423-36204445 GAGGAGGAGGAGAAGGAGGAGGG + Intronic
1023271706 7:38470114-38470136 GGGGATCAGGACAAGGAGGAAGG - Intronic
1023338295 7:39192934-39192956 GAGAGGAAGGACAAGGAGAAAGG + Intronic
1023412171 7:39899040-39899062 GAGGAGAAGTAGGAGGAGGGTGG - Intergenic
1023412172 7:39899043-39899065 GAGGAGGAGAAGTAGGAGGAGGG - Intergenic
1023737594 7:43248670-43248692 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1023758780 7:43444679-43444701 GAGAAGGAGCAGGAGGAGGAGGG + Exonic
1023878862 7:44307396-44307418 GGGGGTAAGCAGAAGGAGGAGGG + Intronic
1024160055 7:46664668-46664690 GATGAGAGGCACAGGGATGATGG - Intergenic
1024183429 7:46921839-46921861 GAAGAAAAGGAAAAGGAGGAAGG + Intergenic
1024233103 7:47377767-47377789 GGGGAGAAGGAGAAGGAGGGAGG - Intronic
1024242785 7:47448236-47448258 GAGGGGGAGCACAGGGAGGAGGG + Intronic
1024464886 7:49701433-49701455 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1024515940 7:50256138-50256160 GGGCAGAAGGACAAGGTGGAAGG - Intergenic
1024599024 7:50963317-50963339 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1025207917 7:57004097-57004119 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1026191884 7:68136359-68136381 AAGAAGAAGAAAAAGGAGGAGGG + Intergenic
1026191892 7:68136436-68136458 GAGGAGAAGGAGAAGAAGGAAGG + Intergenic
1026191905 7:68136490-68136512 GAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1026191906 7:68136493-68136515 GAGGAGAAGGAGGAGGAGGGAGG + Intergenic
1026205727 7:68255617-68255639 GAGGAGAAGGGGAAGGAGAAGGG - Intergenic
1026205742 7:68255669-68255691 GAGGAGAAAGAAAAGGAGAAAGG - Intergenic
1026217663 7:68364018-68364040 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
1026245377 7:68615082-68615104 GAGGAGAAGAAGGAGGAGAAGGG + Intergenic
1026360787 7:69599464-69599486 GAGGAGAAAGAAAAGGGGGAAGG - Exonic
1026404879 7:70054936-70054958 GAGGAGAAGGAAAAGCAGAAAGG - Intronic
1026545174 7:71316141-71316163 GAGCAGGAGCAAAGGGAGGAAGG + Intronic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1026678351 7:72446940-72446962 GAGGAAAAGCAGAAGGGGGAAGG + Intronic
1026804067 7:73418579-73418601 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1026844623 7:73691437-73691459 AAGGATCAGCACTAGGAGGAGGG - Intronic
1027192619 7:76005902-76005924 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1027254138 7:76419769-76419791 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1027572770 7:79891493-79891515 GAGGAGGAGGACGAAGAGGAGGG + Intergenic
1027738840 7:81973565-81973587 GAGGAGAAGGAAAAGGAGGGAGG + Intronic
1027941736 7:84691065-84691087 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1028210568 7:88069196-88069218 AAGGAGAAACATAGGGAGGAAGG - Intronic
1028246840 7:88489607-88489629 AAGAAGAAGAACAAGGAGGATGG - Intergenic
1028376320 7:90149235-90149257 GAGAAGAGGAAGAAGGAGGAAGG - Intergenic
1029024607 7:97402988-97403010 GAGGATAAGCATTAGGTGGATGG + Intergenic
1029094874 7:98077190-98077212 GAGGAGGAGCAGGAGGAGAAGGG + Intergenic
1029139532 7:98400537-98400559 GGGAAGAAGCACAGGGAGGAGGG + Intronic
1029482222 7:100820044-100820066 GGGAAGAAGCCCAGGGAGGATGG + Intronic
1029520157 7:101055110-101055132 GAGGAGGAGGAGGAGGAGGAAGG + Intronic
1029524551 7:101087077-101087099 GAGGAGGAGGAGAAGGAGGAGGG + Exonic
1029530194 7:101120366-101120388 GAAGAGAAGGAGAAGGAGAAGGG + Intergenic
1029630680 7:101748192-101748214 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1029678722 7:102092450-102092472 GAGGAGAGGCACAGGGAGTGAGG - Intronic
1029797371 7:102909776-102909798 GAGGAGAAGGACGAGTAGGGAGG - Intronic
1029823948 7:103171006-103171028 GAGAAGAGGAAGAAGGAGGAAGG + Intergenic
1029927000 7:104328752-104328774 GAGGAGGAGGAGGAGGAGGAGGG + Exonic
1030034445 7:105396689-105396711 GAGGAGAAGGAGGAGGAGGAAGG + Intronic
1030583075 7:111384174-111384196 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
1030884651 7:114922584-114922606 GAGGAGGAGGAGGAGGAGGAAGG + Exonic
1031083759 7:117282447-117282469 GAGGAGGAGAGGAAGGAGGAGGG + Intronic
1031379941 7:121073324-121073346 GAGGAGATGGAAAAAGAGGAGGG + Intronic
1031537132 7:122948359-122948381 GAGGAGAAGGAGAAGGACAAGGG + Intergenic
1031537417 7:122952438-122952460 GAAGAGGAGGAGAAGGAGGAAGG + Intergenic
1031595108 7:123640723-123640745 GAGGAGAAGGGGAAGGGGGAAGG + Intergenic
1031796204 7:126176992-126177014 GAGGAGGAGGAGAAGGAGAAGGG - Intergenic
1031812796 7:126392859-126392881 GTGGAGAAGAACAAGGAGTTTGG - Intergenic
1031863845 7:127015094-127015116 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031863849 7:127015122-127015144 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1032055286 7:128679629-128679651 GTGTAGAAGCACAGGAAGGAAGG + Intronic
1032080435 7:128856003-128856025 GAGGAGATGCACAAGGACTCTGG - Intronic
1032175403 7:129620211-129620233 GAGTAGGAGCACCAGAAGGAAGG + Intronic
1032344692 7:131107243-131107265 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1032432760 7:131875358-131875380 GAGGTTAAGCATAAGGAGGAAGG - Intergenic
1032439768 7:131933426-131933448 GAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1032466837 7:132151412-132151434 GAGGAGGAGGAGGAGGAGGAAGG + Intronic
1032523129 7:132561358-132561380 GAGGAGGAGGACAAGAAGGAGGG - Intronic
1032523151 7:132561436-132561458 AAGGAGGAGGACAAGAAGGAGGG - Intronic
1032523275 7:132561942-132561964 GAGGAGGAGGAGAAAGAGGAGGG - Intronic
1032523301 7:132562053-132562075 GAAGAGGAGGAGAAGGAGGAGGG - Intronic
1032523515 7:132562972-132562994 GAGGAGGAGAAGGAGGAGGAGGG - Intronic
1032523545 7:132563110-132563132 GAGGAGGAGAAGGAGGAGGAGGG - Intronic
1032644642 7:133809329-133809351 GAGGATTGGCACAATGAGGATGG + Intronic
1032669375 7:134069323-134069345 GAGGAGAAGGAGGAGAAGGAGGG - Intergenic
1032769818 7:135039961-135039983 GAGGAAGAGAACGAGGAGGAGGG + Intronic
1032884653 7:136124517-136124539 GAGGATCATCACAAGGAGGAGGG + Intergenic
1033185507 7:139224420-139224442 GAAGAGAAGGACAGGGAGGGAGG + Intergenic
1033454330 7:141488947-141488969 GAGGAGAAAGAGAAGGAGGAGGG + Intergenic
1033596696 7:142864293-142864315 GAGGAGGAGGAGGAGGAGGAGGG - Exonic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1034070057 7:148175842-148175864 GAGGAGGATGATAAGGAGGATGG - Intronic
1034152150 7:148925475-148925497 GAGGAGAGGCAACATGAGGACGG + Intergenic
1035162492 7:156961286-156961308 GAGGACCAGCAAGAGGAGGAAGG + Intronic
1035280841 7:157776907-157776929 GAGGAGAAGAGCGAGGAGGAGGG - Intronic
1035419667 7:158717150-158717172 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1035419693 7:158717283-158717305 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1035419753 7:158717611-158717633 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1035419768 7:158717685-158717707 GAGGAGGAGAAGAAGGAAGAAGG - Intergenic
1035760446 8:2064777-2064799 GAGGAGAAGGAGGAGGGGGATGG - Intronic
1036448727 8:8846288-8846310 GAGGAGGATAAGAAGGAGGAGGG + Intronic
1036448735 8:8846315-8846337 GAGGAGAAGGAGGAGTAGGAGGG + Intronic
1036453704 8:8891356-8891378 CAGGAGAAGCACGACGCGGAGGG - Exonic
1037026155 8:14040619-14040641 GAGGAGAAGCAGAGGGAGCAGGG + Intergenic
1037300254 8:17444021-17444043 GAGGAGAAGGAGGAGGAAGAAGG - Intergenic
1037591214 8:20313535-20313557 CAGGAGAACCTCAAAGAGGAAGG - Intergenic
1037598401 8:20373614-20373636 GAGGAGGAGGAGAAGAAGGAAGG + Intergenic
1037598466 8:20373866-20373888 GAAGAGAAGGAGGAGGAGGAGGG + Intergenic
1037655440 8:20879695-20879717 GAGGAGGAGGAGAAGGAGAAAGG + Intergenic
1037691283 8:21183452-21183474 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1037714019 8:21381743-21381765 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1038120387 8:24607967-24607989 GAGGAGGAGGAAAAGGAGAAGGG + Intergenic
1038448626 8:27623481-27623503 GAGGAGAAGTCCAAGGTTGAGGG + Intergenic
1038483660 8:27918869-27918891 GGGAAGAAGGAGAAGGAGGAGGG + Intronic
1038882228 8:31627661-31627683 GAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1039087999 8:33799044-33799066 AAGGAGAAGGTCATGGAGGAGGG + Intergenic
1039140933 8:34387266-34387288 GTGGAGAAGAACAAAGATGAAGG + Intergenic
1039340112 8:36638741-36638763 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1039351613 8:36769878-36769900 GAGGAGCAGCCAAATGAGGAGGG - Intergenic
1039435984 8:37559560-37559582 GAGGAGGAGGAAAAGAAGGAGGG + Intergenic
1039436012 8:37559668-37559690 GAGGAGGAGGAAAAGGAGGAGGG + Intergenic
1039436022 8:37559701-37559723 GAGGAGAAGGAAAAGGAGGAGGG + Intergenic
1039884400 8:41646960-41646982 GAGGAGGAGAAGGAGGAGGAGGG - Intronic
1039986530 8:42452453-42452475 GAAGAGATGGAGAAGGAGGAAGG + Intronic
1040071952 8:43195705-43195727 GAGGAGGAGGAAGAGGAGGAGGG + Intronic
1040079772 8:43274918-43274940 GAGGAGGAGCAGGAGGAGGAGGG - Intergenic
1040564274 8:48552149-48552171 AAGGAGGAGCGAAAGGAGGAGGG - Intergenic
1040682569 8:49831081-49831103 AAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1041011445 8:53547598-53547620 GAGGGGAAGCAGAAGGGGAAAGG + Intergenic
1041067041 8:54092087-54092109 GAGGAAAAGGAGAAGGAAGAGGG + Intronic
1041154969 8:54976733-54976755 GAGGACAAGCAGAAGCAGGGAGG + Intergenic
1041267616 8:56080364-56080386 GAGGAGAAGGAGAAGGCGGAAGG + Intergenic
1041284844 8:56249570-56249592 GAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1041347883 8:56920442-56920464 GAGAAGACGGAGAAGGAGGAAGG + Intergenic
1041401366 8:57448750-57448772 GAGGGGGAGGAGAAGGAGGAGGG - Intergenic
1042076670 8:65003246-65003268 GAGGAGAAGGAGGAAGAGGAAGG + Intergenic
1042098246 8:65243218-65243240 GAGGAAAAGTAAAAGGAGAAGGG - Intergenic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1042329230 8:67560545-67560567 GAGCAGAGGCACAAGGGTGAGGG + Intronic
1042568216 8:70134114-70134136 GTGGAGAAGAAGCAGGAGGAAGG - Intronic
1042591816 8:70403847-70403869 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1042691799 8:71508118-71508140 GTGCAGAAGCACAAGGACAAAGG - Intronic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1042962861 8:74321479-74321501 GAGGAGGAGGAGGAGGAGGAAGG - Intronic
1043014580 8:74922075-74922097 GAGGAGGAGGAAGAGGAGGAAGG - Intergenic
1043385585 8:79744628-79744650 AAGGAGAAGTAAAAGGAGAAGGG + Intergenic
1043656957 8:82679672-82679694 GAAGAGGAGAAGAAGGAGGAGGG + Intergenic
1043855012 8:85255092-85255114 GAGAAGAAGAAGGAGGAGGAAGG - Intronic
1044395891 8:91711392-91711414 GAGGAAGAGGAAAAGGAGGAAGG + Intergenic
1045130025 8:99140657-99140679 GGGGAGAAGGACGGGGAGGAGGG - Intronic
1045411973 8:101929234-101929256 GAGGAGGAGGAGGAGGAGGAAGG + Intronic
1045839269 8:106560855-106560877 GAGGATGAGCAAAAGCAGGATGG + Intronic
1045856326 8:106769568-106769590 GAGGAGAGGCCCGAGCAGGATGG - Exonic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046629362 8:116608076-116608098 GAGGGGAAGAACAAGGAGTTTGG - Intergenic
1046698590 8:117373669-117373691 GAGGAGAAGAGAAAGGGGGAGGG + Intergenic
1046718102 8:117589206-117589228 GAAGGGAAGGACAAGGAAGAAGG + Intergenic
1046838794 8:118833379-118833401 GAGGAGAAGAAGGAAGAGGAGGG + Intergenic
1047221538 8:122922608-122922630 GAGGAGAAGGAACAGGAGGAAGG - Intronic
1047250088 8:123175411-123175433 GAGGAGGAGGAGAAGGAGAAAGG - Intergenic
1047702565 8:127464240-127464262 TAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1047916650 8:129591150-129591172 GAGGAGAAGCACAGGAGGGAGGG + Intergenic
1048001419 8:130382468-130382490 GAGAAGCAGAACAGGGAGGAAGG + Intronic
1048019264 8:130523364-130523386 GAGGAGATGCTCAAGAAGGAAGG - Intergenic
1048417559 8:134243633-134243655 GAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1048417573 8:134243687-134243709 GAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1048417576 8:134243693-134243715 GAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1048518916 8:135136116-135136138 GAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1048630183 8:136233948-136233970 GAGAATAAGCAGAAGCAGGATGG - Intergenic
1048643163 8:136387345-136387367 AAGGAGAAGCAGAGGGAGTATGG - Intergenic
1048865553 8:138758775-138758797 GAGGAGAAGGTCAAGGACCATGG - Intronic
1048941146 8:139401954-139401976 GAGAAGAAGGATAAGGGGGATGG - Intergenic
1048996374 8:139796097-139796119 GAGGAGGAGGAAGAGGAGGAGGG + Intronic
1049027606 8:140005926-140005948 GAGGAGGAGGAGGAGGAGGAAGG + Intronic
1049058446 8:140257386-140257408 GAGGAGAAGTAGAAGGAAGGTGG - Intronic
1049062579 8:140287363-140287385 GAGACGAAGCAGAGGGAGGAGGG + Intronic
1049386068 8:142343775-142343797 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1049568994 8:143359658-143359680 GGGGTGAAGCACACGGAGGGGGG + Intronic
1049647037 8:143740168-143740190 GAGGTGGAGCACCAGGAGGTGGG - Intergenic
1049674039 8:143881873-143881895 GAGGAGAAGGGGGAGGAGGAGGG + Intergenic
1049730820 8:144177430-144177452 GAGGAGAAACAATAGTAGGAAGG - Intronic
1049774616 8:144398616-144398638 GAGGACAATCCCAAGGGGGAGGG - Exonic
1049997850 9:1048229-1048251 GAGGAGAAACAGGAGGAGAAAGG - Intergenic
1050302206 9:4271034-4271056 GAGGAGAAGGAGGAAGAGGAAGG - Intronic
1050386827 9:5099800-5099822 GGGTAGAAGCCCAAGGAGGTTGG - Intronic
1050393134 9:5167620-5167642 GAGAAGAGGCTCTAGGAGGAGGG + Intronic
1050406151 9:5310366-5310388 GGGGAGAGGTACAGGGAGGAAGG - Intergenic
1050475942 9:6041107-6041129 GAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1050635260 9:7605636-7605658 GAGGTAAAGCACAAGGGAGATGG + Intergenic
1051038291 9:12775911-12775933 GAGGAGGACGACAAGGAGGGAGG - Exonic
1051189256 9:14493797-14493819 AAGGAGAAGAACAAGGAGGGAGG - Intergenic
1051518073 9:17952917-17952939 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1051613087 9:18980565-18980587 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1051814241 9:21087068-21087090 GAGGGTAAGCAGAAGGAGGGTGG + Intergenic
1051880721 9:21837001-21837023 GATGAGTAACACAGGGAGGAGGG - Intronic
1052169701 9:25377797-25377819 GAGGAGAAGCAGTTGGATGATGG - Intergenic
1052250275 9:26390095-26390117 GAGCTGAAGCACTTGGAGGAAGG - Intergenic
1052540453 9:29804801-29804823 GAGGAGAAGCAGATGGATGTGGG - Intergenic
1052709966 9:32042154-32042176 GAGGAGCAGCAGCTGGAGGATGG - Intergenic
1052738435 9:32369648-32369670 GAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053022802 9:34707704-34707726 GAGGAGAAGAAGAAGAAGAAAGG - Intergenic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053441621 9:38120958-38120980 GAGGGGGAGGAGAAGGAGGAGGG + Intergenic
1053481501 9:38419863-38419885 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1053601181 9:39611105-39611127 AAGGAGAAGACCAAGGAGCAGGG - Intergenic
1053858830 9:42364903-42364925 AAGGAGAAGACCAAGGAGCAGGG - Intergenic
1054566470 9:66765833-66765855 AAGGAGAAGACCAAGGAGCAGGG + Intergenic
1054850654 9:69843464-69843486 GAGGAGGAGGAGAAGTAGGAGGG - Intronic
1054850668 9:69843505-69843527 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1054991475 9:71331964-71331986 GAGGAGGAGGAGAAGGAGGAGGG + Intronic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055074575 9:72200363-72200385 GAGGAGGAGGAAGAGGAGGAGGG - Intronic
1055112810 9:72576348-72576370 GAGGAGAGAGACAAGAAGGAAGG - Intronic
1055151930 9:73011048-73011070 GAGGAGAAAGACAAGAAGGAAGG - Intronic
1055280496 9:74668744-74668766 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
1055581479 9:77711145-77711167 GAGGGGAAGGGGAAGGAGGAGGG - Intergenic
1055617051 9:78083749-78083771 GAGGACAAGCCAAAGGAGGGCGG + Intergenic
1055708252 9:79031885-79031907 GAGGGGAAGAAGAAGGAGGGAGG + Intergenic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1056165547 9:83937409-83937431 GAAGGGAAGAAGAAGGAGGAGGG + Intergenic
1056542899 9:87589359-87589381 GAGGACAAGCACAATAAAGAAGG - Intronic
1056954573 9:91072053-91072075 GAAGAGAAGCAGAGGGAGGGAGG + Intergenic
1057181560 9:93033410-93033432 GAGAAGGAGCAGGAGGAGGAGGG - Intronic
1057388210 9:94622669-94622691 AAAGAGAAGCAGCAGGAGGAGGG - Intronic
1057396046 9:94681449-94681471 GATGAGAAGGAGGAGGAGGATGG - Intergenic
1057414121 9:94846225-94846247 CTGGAGAAGCACAACGTGGAAGG + Intronic
1057497418 9:95571969-95571991 GAGGAGGAGGAGAGGGAGGAGGG + Intergenic
1057739767 9:97701172-97701194 GAGCCGAAGGAGAAGGAGGAGGG - Intergenic
1058297443 9:103326890-103326912 CAGGAGAAGCAGAGGGAGCAGGG - Intergenic
1058472939 9:105299719-105299741 TAGGACAGGCAGAAGGAGGAAGG - Intronic
1058715963 9:107722206-107722228 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1058794656 9:108486323-108486345 GAGGTGAAGAATAAGGAAGAAGG + Intergenic
1059172322 9:112137271-112137293 GAGGAGGAGGAGGAGGAGGAAGG + Intronic
1059335361 9:113565414-113565436 GAGGAGGAGGAAGAGGAGGAGGG + Intronic
1059663096 9:116420812-116420834 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
1059823204 9:117997116-117997138 GAGGAAAAGAGGAAGGAGGAAGG - Intergenic
1059823226 9:117997251-117997273 GAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1059846036 9:118277861-118277883 GAGGAAAAGTATAAGGATGATGG + Intergenic
1059931088 9:119261872-119261894 GAGGAAGAGAAGAAGGAGGAGGG - Intronic
1060283538 9:122229027-122229049 GGGGAGGAGGACAAGGAGGAGGG - Intronic
1060700743 9:125747356-125747378 GAGGAGAAGAAAGAGGGGGAGGG - Intronic
1060880293 9:127113307-127113329 AAAGAGAAGCCCAAGGAGCATGG - Intronic
1061156189 9:128863197-128863219 AAGTAGACACACAAGGAGGAGGG + Intronic
1061559569 9:131394014-131394036 GAGGAGGAGGACGAGGAGGCGGG + Intergenic
1061865664 9:133490768-133490790 GAGGAGGAGGAGAGGGAGGAGGG + Intergenic
1062029988 9:134357931-134357953 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1062061667 9:134500059-134500081 GAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1062074714 9:134579690-134579712 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062165389 9:135105007-135105029 GAGGAGAAGCAGCAGAAGAAAGG - Intronic
1062206306 9:135339441-135339463 GAGAAGAAGCTCCAGGAGGCCGG + Intergenic
1062332819 9:136051918-136051940 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1062349661 9:136132734-136132756 CAGGAGCCGCACAGGGAGGATGG - Intergenic
1062437087 9:136551137-136551159 GAGGAGAGACATCAGGAGGATGG + Intergenic
1062480954 9:136751086-136751108 GAGGGGAAGAAGAAGGAGGGAGG + Intergenic
1062513981 9:136922886-136922908 GAGGACTAGGACAGGGAGGATGG + Intronic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1062727287 9:138082752-138082774 AAGGACAAGCACTAGGTGGAAGG - Intronic
1062744599 9:138203385-138203407 GACGAGGAGGACAAGGGGGAGGG + Intergenic
1185499105 X:584181-584203 GAGGAGGAGGGGAAGGAGGAGGG + Intergenic
1185499223 X:584636-584658 GAGGAGAAGGGAGAGGAGGAGGG + Intergenic
1185499346 X:585140-585162 GAGGAGAAGAAGGTGGAGGAGGG + Intergenic
1185504960 X:625187-625209 GAGGAGAAGGAGGAGGAGGAGGG - Intronic
1185504972 X:625227-625249 GAGTAGAAGGAGGAGGAGGAGGG - Intronic
1185540500 X:899418-899440 GAGGAGGAGAAGGAGGAGGAAGG - Intergenic
1185591607 X:1281052-1281074 GAGGAGAAGGAGGAGGAGAAGGG - Intronic
1185591619 X:1281096-1281118 GAGGAGAAGGAGGAGGAGAAGGG - Intronic
1185662009 X:1735515-1735537 GAGGAGGAGAAAGAGGAGGAGGG - Intergenic
1185688323 X:1948429-1948451 GAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1185688601 X:2133951-2133973 GAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1185714475 X:2330177-2330199 GAGGAGGAGAAGCAGGAGGAGGG + Intronic
1185948692 X:4406311-4406333 GAGGAGAAGGAGGAAGAGGAGGG + Intergenic
1185954860 X:4478252-4478274 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1186047291 X:5550339-5550361 GAGGAGAAGGAAAAGAAGAAAGG - Intergenic
1186064102 X:5742947-5742969 GAGGAGAAGGAGGAGAAGGAGGG + Intergenic
1186072054 X:5832858-5832880 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1186178422 X:6949371-6949393 GAGGAAAAGGATAAGGAGGAGGG - Intergenic
1186249800 X:7653328-7653350 GAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1186313163 X:8342079-8342101 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
1186313164 X:8342082-8342104 GAGGAGGAGAAGCAGGAGGAGGG - Intergenic
1186590120 X:10921408-10921430 GAGGAGAAATAAAAGGAGGGAGG - Intergenic
1186638163 X:11427843-11427865 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1186813449 X:13212490-13212512 GAGTAGAAGGACAGGAAGGAAGG + Intergenic
1187447672 X:19373147-19373169 GAGAGGAAGGAAAAGGAGGAAGG + Intronic
1187665968 X:21609563-21609585 GAGGAGGAGGAGGAGGAGGAAGG + Exonic
1188269297 X:28118878-28118900 GGGAAGAAGGAAAAGGAGGAGGG - Intergenic
1188626657 X:32293414-32293436 GAAGAGAACCAGAAGGAGGGAGG + Intronic
1188891616 X:35618284-35618306 GAGAAGAAGGGCAGGGAGGATGG + Intergenic
1188924671 X:36024326-36024348 GAAGAGAGGCAAAAGCAGGAAGG - Intergenic
1189083082 X:37994760-37994782 GAGGAGAAGAAGGAGGAGGAAGG + Intronic
1189156489 X:38762463-38762485 GAGGAGGAGAAAGAGGAGGAAGG + Intergenic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189737780 X:44089096-44089118 GAGAGGAAGAACAAGGAGGAGGG + Intergenic
1190058119 X:47193935-47193957 GGGGAGGAGGAGAAGGAGGAGGG + Exonic
1190259763 X:48790526-48790548 GAGAAGGAGGACAAGGAAGAGGG + Intronic
1190915115 X:54805833-54805855 GAAGAGAAGGGCAAGGAGGAGGG - Intergenic
1191606165 X:63065475-63065497 GAGGGGAAGCAGAAGCAGGGTGG + Intergenic
1191650220 X:63529232-63529254 GAGGAGAGGCATGAGTAGGAAGG + Intergenic
1191676287 X:63795359-63795381 GAGGAGAAGGGAAAGAAGGAAGG + Intergenic
1191909764 X:66136887-66136909 AAGGAGAAGGACTAGGAGGCTGG - Intergenic
1192026009 X:67452513-67452535 GAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1192141497 X:68650446-68650468 GAGGAGGAGGAAGAGGAGGAGGG + Intronic
1192190060 X:68985571-68985593 GAGGAGAAGGACAGGGGGGAAGG + Intergenic
1192204149 X:69085183-69085205 GAGGAGGAGAAGAAAGAGGAGGG - Intergenic
1192573038 X:72221980-72222002 GAGGAGCAGAACCAGGGGGATGG - Intronic
1192639083 X:72846133-72846155 GAGGAGGAGGAGGAGGAGGAGGG + Intronic
1192639091 X:72846163-72846185 GAGGAGGAGAAGAAGGAGGAGGG + Intronic
1192642620 X:72874642-72874664 GAGGAGGAGAAGAAGGAGGAGGG - Intronic
1192642628 X:72874672-72874694 GAGGAGGAGGAGGAGGAGGAGGG - Intronic
1192706043 X:73529291-73529313 GAGGAGCAGCTTAGGGAGGAGGG - Intergenic
1192958257 X:76096140-76096162 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1193228498 X:79013712-79013734 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1193601701 X:83514390-83514412 GAGGAGAAGAAAGAGGAGAATGG + Intergenic
1193941403 X:87683554-87683576 GAGGAGAAGCCTGGGGAGGAAGG - Intergenic
1194267367 X:91771462-91771484 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic
1194638915 X:96378514-96378536 AAGGAGAAACAAAAGGAGGGTGG + Intergenic
1195457564 X:105085988-105086010 GAGGAGAAGGAGGAAGAGGAGGG + Intronic
1195875378 X:109535226-109535248 GAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1196065446 X:111459144-111459166 GAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1196101722 X:111853858-111853880 CAGGAGAAGCATAAAGAGGAAGG + Exonic
1196109528 X:111930999-111931021 GAGGAGGAGGACAGGGAGGAAGG + Intronic
1196181102 X:112690491-112690513 GAGGAAGAGAAGAAGGAGGAGGG + Intergenic
1196600849 X:117600374-117600396 GAAGAGAAGGACAAGGACCAGGG - Intergenic
1196738719 X:119005200-119005222 GAGGAGCAGCACAGGAAGAAGGG - Intronic
1196761084 X:119201530-119201552 TAGCAGAAGAACAAAGAGGAAGG - Intergenic
1196828407 X:119758500-119758522 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1196964184 X:121037817-121037839 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1197605834 X:128584126-128584148 GAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1197753342 X:129980231-129980253 GAGGGGAAGGAGGAGGAGGAAGG - Intergenic
1198935190 X:141896806-141896828 GAGGACAAGGAAGAGGAGGAGGG - Intronic
1199398185 X:147365478-147365500 GAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1199701887 X:150385632-150385654 GAGGAGAAGGAGGAAGAGGAAGG + Intronic
1199751549 X:150824131-150824153 GAGGAGGAGGAGAAGAAGGAAGG + Intronic
1199907955 X:152254211-152254233 GAGGAGATGAACAAGAGGGAGGG - Intronic
1200158295 X:153990023-153990045 GTAGAGAAACACAAGGAGGCTGG - Intergenic
1200337944 X:155369833-155369855 GAGGAGAAGCAGGAGAAGGAGGG + Intergenic
1200348526 X:155471393-155471415 GAGGAGAAGCAGGAGAAGGAGGG - Intergenic
1200584572 Y:4992399-4992421 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic
1200842192 Y:7793854-7793876 GAGAGGAAGCTCAAGGAGAATGG + Intergenic
1201247911 Y:12024662-12024684 GAGGAGGAGTAAAAAGAGGAGGG - Intergenic
1201300269 Y:12498827-12498849 GAGGAGGAGGAGAAGGGGGAGGG - Intergenic
1201461675 Y:14232565-14232587 AAGAAGAAGCAGAAGAAGGAAGG - Intergenic
1201508683 Y:14733766-14733788 GAGGAGAAGCACATGTGAGAGGG + Intronic