ID: 930349108

View in Genome Browser
Species Human (GRCh38)
Location 2:50226718-50226740
Sequence CAAGATACCAATCTATAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 268}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930349107_930349108 11 Left 930349107 2:50226684-50226706 CCACTGGTTCTCTATCAGAACTA 0: 1
1: 0
2: 0
3: 10
4: 114
Right 930349108 2:50226718-50226740 CAAGATACCAATCTATAAATAGG 0: 1
1: 0
2: 0
3: 28
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930349108 Original CRISPR CAAGATACCAATCTATAAAT AGG Intronic
902997426 1:20237642-20237664 TAAGATACTAAACTATAAACAGG + Intergenic
904276206 1:29386004-29386026 TAAGATACCAAATTATAAACAGG + Intergenic
906002236 1:42436640-42436662 CAACATTCCAATTTAAAAATGGG + Intronic
906206466 1:43990009-43990031 TAAGATACCTAATTATAAATAGG - Intronic
909216015 1:72890708-72890730 TAAGATACCTATTTATAATTAGG - Intergenic
910350904 1:86296563-86296585 TAAGATACCAGATTATAAATAGG + Intergenic
911389511 1:97221404-97221426 GAATATGCAAATCTATAAATGGG + Intronic
911425296 1:97703086-97703108 CAATACACTAATCTATCAATTGG + Intronic
912078253 1:105905656-105905678 CAAGATAGCCATTTATAAGTGGG - Intergenic
912760478 1:112361732-112361754 AAAGAAACAAATATATAAATTGG + Intergenic
912930883 1:113959921-113959943 CAAAATTCTCATCTATAAATTGG - Intronic
913660138 1:120999752-120999774 TAAGACACCAAATTATAAATAGG + Intergenic
914011501 1:143782908-143782930 TAAGACACCAAATTATAAATAGG + Intergenic
914166332 1:145178226-145178248 TAAGACACCAAATTATAAATAGG - Intergenic
914650129 1:149691568-149691590 TAAGACACCAACTTATAAATAGG + Intergenic
915964273 1:160292925-160292947 CCAGAAAGCAAGCTATAAATGGG + Intronic
918553526 1:185772058-185772080 CAAGTTACCAATGTATGAAATGG + Intronic
918747701 1:188226949-188226971 CAATACACTAATATATAAATAGG - Intergenic
919543069 1:198875555-198875577 AAAGATATCAATTAATAAATGGG - Intergenic
920010932 1:202867164-202867186 TAAGATATCAAACTATAAACAGG - Intergenic
921557922 1:216621574-216621596 CAAGATGACAATGTAGAAATGGG - Intronic
922544504 1:226445850-226445872 TAAGATACCAAATTATACATAGG + Intergenic
923071859 1:230572964-230572986 TAAGATACCAAATTATAAACAGG - Intergenic
923817540 1:237397705-237397727 AAAGATACCAAATTATAAACAGG - Intronic
923864883 1:237929045-237929067 CAATATAACACTTTATAAATTGG - Intergenic
924457092 1:244227542-244227564 CAACATCCATATCTATAAATTGG - Intergenic
1064055495 10:12093849-12093871 CAACCTACTTATCTATAAATCGG - Intronic
1065261417 10:23927180-23927202 CAGCATAGCAATTTATAAATAGG - Intronic
1065279746 10:24123094-24123116 CAAGATACCAAAATACACATGGG - Intronic
1067066769 10:43108392-43108414 TAAGATACCAAATTATAAACAGG - Intronic
1068368829 10:56087710-56087732 CAATATACCAGATTATAAATAGG + Intergenic
1068994611 10:63188849-63188871 TAAAATACCAATCTAAAAAGAGG + Intronic
1071662309 10:87517186-87517208 CTAAGTAGCAATCTATAAATGGG - Intronic
1072395517 10:95035872-95035894 TAAGATACCAACTTATAAATAGG + Intergenic
1072772609 10:98153712-98153734 TAAGATACCAAATTATAAACAGG + Intronic
1072833362 10:98683516-98683538 CAAGAAAACAAGCTATAAAAGGG + Intronic
1076708100 10:132313213-132313235 TAAGATACCAAATTATAAACAGG + Intronic
1077558736 11:3242254-3242276 GACGATACCAATCTACAAAATGG + Intergenic
1077693723 11:4374430-4374452 CAACATAAAAATCAATAAATGGG + Intergenic
1079188594 11:18258861-18258883 TAAGATTCCAATAAATAAATGGG - Intergenic
1079719878 11:23796919-23796941 CAAGCTACCATTCTAGACATAGG + Intergenic
1079973898 11:27068838-27068860 AAACATACAAAACTATAAATTGG - Intronic
1080500162 11:32863027-32863049 TAAGATACCAAAGTATAAATAGG - Intergenic
1081523278 11:43903763-43903785 TAAGCTTCAAATCTATAAATAGG - Intronic
1082845753 11:57724033-57724055 AATGATACCAATCTACAAAATGG - Intronic
1083831139 11:65234379-65234401 CTGAATACAAATCTATAAATAGG - Intergenic
1084787465 11:71451486-71451508 TAAGATACCAAATTATAAACAGG + Intronic
1085979821 11:81710846-81710868 CAAGATACAAATCTAATAAGAGG + Intergenic
1087641389 11:100758781-100758803 CAATTTACCTATCTATAAAATGG - Intronic
1088199134 11:107311198-107311220 CAAGGTACCAATTTCTATATAGG + Intergenic
1090154095 11:124419250-124419272 CAAGAAACCCATCTATAACCAGG - Intergenic
1090293146 11:125563985-125564007 GATGATACCAATCTACAAAATGG - Intergenic
1090757933 11:129810996-129811018 CATGGTACCAATATAAAAATAGG + Intergenic
1094746977 12:33356091-33356113 CAAAAAACCAATTTAAAAATGGG - Intergenic
1095305395 12:40632872-40632894 CAAGAGATAAATCTTTAAATTGG - Intergenic
1095380049 12:41580195-41580217 CAACATACAAATCAAAAAATAGG - Intergenic
1095888166 12:47210299-47210321 CATGATACCAAAATATAAAGTGG + Intronic
1096552478 12:52382176-52382198 CTAGATCCCAGTCTTTAAATTGG + Intronic
1097685335 12:62685531-62685553 CAATTTCCCAATCTGTAAATTGG + Intronic
1099702723 12:86108305-86108327 TAAGATACCAAATTATAAACAGG + Intronic
1100000837 12:89833237-89833259 CAAGAAACCAGTCTATCAACAGG + Intergenic
1100077669 12:90805683-90805705 CAAGATACCATTTCATATATTGG + Intergenic
1100105663 12:91168990-91169012 GAAAATACAAATCTATGAATGGG - Intronic
1100412588 12:94336417-94336439 AATAATACCAAGCTATAAATAGG - Intronic
1100966550 12:100019509-100019531 CAAGGTCCCAATACATAAATTGG + Intergenic
1101662297 12:106776468-106776490 CCAGATACCCAGCAATAAATAGG + Intronic
1101748653 12:107564493-107564515 CAAGGTTCCAATCTGGAAATGGG - Intronic
1101934849 12:109048850-109048872 TAAGATACCAAATTATAAACAGG - Intronic
1101965231 12:109277880-109277902 CAATTTCCCCATCTATAAATGGG + Intergenic
1103246789 12:119464714-119464736 TAAGATACCAAATTATAAACAGG + Intronic
1103257494 12:119554636-119554658 TAAGATACCAAGTTATAAACAGG + Intergenic
1103609434 12:122113566-122113588 AAAGATAAAAATATATAAATAGG - Intronic
1105802480 13:23920034-23920056 GAAAATACCATTCTATACATTGG + Intergenic
1109801827 13:67389909-67389931 TAAAATACAAGTCTATAAATAGG + Intergenic
1109981954 13:69920556-69920578 CAATATAACAATGTATAAATGGG + Intronic
1110964732 13:81678668-81678690 CAACATAGCAATCTTTAAACAGG - Intergenic
1111726169 13:92012675-92012697 CTGGATTCCAATCTATGAATTGG + Intronic
1113231910 13:108220874-108220896 AAAGTTTCCAATTTATAAATGGG - Intronic
1115492514 14:33971858-33971880 CAATATACAGATCTATCAATGGG - Intronic
1117769393 14:59117815-59117837 TAAGATACCAAATTCTAAATAGG + Intergenic
1117860764 14:60090844-60090866 GAAGATACCAAACTATGAAAGGG + Intergenic
1118545341 14:66880603-66880625 CAACATAGCTATTTATAAATTGG - Intronic
1118690660 14:68336528-68336550 CAAAATAGCAATCTATGTATTGG - Intronic
1123766371 15:23482573-23482595 GATGATACCAATGTATAAAATGG - Intergenic
1124484399 15:30102347-30102369 CAAGTTACCAATCCAGAAACTGG + Intergenic
1124510302 15:30318698-30318720 TAAGATACCAAATTATAAACAGG - Intergenic
1124519184 15:30394877-30394899 CAAGTTACCAATCCAGAAATTGG - Intergenic
1124539472 15:30571344-30571366 CAAGTTACCAATCCAGAAACTGG + Intergenic
1124732587 15:32211855-32211877 TAAGATACCAAATTATAAACAGG + Intergenic
1124759178 15:32436228-32436250 CAAGTTACCAATCCAGAAATTGG - Intergenic
1124974490 15:34520337-34520359 CAAGTTACCAATCCAGAAATTGG - Intergenic
1125311582 15:38385028-38385050 GAAGAAACCAATCTAGAAAAGGG - Intergenic
1126326813 15:47487696-47487718 CAAGCTAAATATCTATAAATAGG - Intronic
1126332969 15:47553825-47553847 AAACATACAAATCTTTAAATGGG - Intronic
1126988853 15:54346809-54346831 CAAAAGATCAATCTATAAACTGG + Intronic
1127379402 15:58418204-58418226 CAAGATTCCAAAAGATAAATGGG + Intronic
1128429975 15:67583109-67583131 CAATATTCTCATCTATAAATTGG - Intronic
1128633879 15:69290643-69290665 CAACTTTCCAATCTATAAAATGG + Intergenic
1128936112 15:71747972-71747994 TAAGATACCAAATTATAAACAGG - Intronic
1128958355 15:71973339-71973361 AATGATACCAATCTACAAAATGG - Intronic
1132185899 15:99801424-99801446 CAAGTTACCAATCCAGAAATTGG + Intergenic
1132429779 15:101751274-101751296 CAAGTTACCAATCCAGAAATTGG - Intergenic
1133714334 16:8432493-8432515 CAAGACACCAAATTATAAATAGG - Intergenic
1133840704 16:9406815-9406837 CAGGATTCCACTCTATAAAAAGG + Intergenic
1138301717 16:55935988-55936010 CAATATTCCAATCTGTAGATGGG + Intronic
1140409478 16:74733356-74733378 CAATATCCTCATCTATAAATTGG - Intronic
1140722915 16:77787618-77787640 CAACACACTCATCTATAAATTGG - Intergenic
1143382453 17:6504805-6504827 CAATCTTCCAATCTATAAAATGG + Intronic
1144407244 17:14964044-14964066 AAAGATACCAAATTATAAATAGG - Intergenic
1146765763 17:35520027-35520049 TAAGATACCAAGTTGTAAATAGG + Intronic
1148205499 17:45777221-45777243 CAATATACCTATCTGTAAAATGG + Intergenic
1149829279 17:59857037-59857059 CAAGATAACAAGCAATAATTAGG + Intergenic
1149978641 17:61291457-61291479 CAACATACCAATCTAGCAGTTGG - Intronic
1151034067 17:70778132-70778154 CAAGTTGGCAAACTATAAATGGG + Intergenic
1151128792 17:71874212-71874234 AAAAATAGCAACCTATAAATAGG + Intergenic
1203191120 17_KI270729v1_random:190683-190705 CAAGATAGAAATATATAAAGAGG - Intergenic
1152980264 18:269447-269469 TAAGATACCAAAGTATAAACAGG + Intergenic
1153136538 18:1923785-1923807 AATGATACCAATCTACAAAATGG + Intergenic
1153156774 18:2159040-2159062 AACGATACCAATCTACAAAATGG - Intergenic
1154388648 18:13917866-13917888 TCAGATCCCCATCTATAAATGGG - Intergenic
1156010543 18:32492580-32492602 GAAGATACCCATTTTTAAATGGG - Intergenic
1156030025 18:32701941-32701963 AAAGATACAAATGTAAAAATGGG - Intronic
1156813508 18:41280821-41280843 TAAGATACCAAATTATAAACAGG - Intergenic
1158099612 18:53815686-53815708 CGAGATACCATTGTATAAGTGGG - Intergenic
1162993319 19:14317606-14317628 CCTGACACCAATCTATAAACAGG + Intergenic
1164921133 19:32089429-32089451 GAAGATACCACTTTAGAAATAGG + Intergenic
924976778 2:184626-184648 TAAGATACCAAATTGTAAATGGG + Intergenic
928251343 2:29683873-29683895 CAAGAGACCATTCTGTAAACAGG - Intronic
928453592 2:31400047-31400069 TAAGAAACAAATCTATAGATGGG + Intronic
928489046 2:31762166-31762188 CAAGATTTCAACATATAAATTGG + Intergenic
928858294 2:35826831-35826853 CAATTTACTCATCTATAAATTGG - Intergenic
928954382 2:36847970-36847992 ACAGAGACCAATCTAGAAATTGG - Exonic
930349108 2:50226718-50226740 CAAGATACCAATCTATAAATAGG + Intronic
930355169 2:50309123-50309145 CAAATAACAAATCTATAAATGGG - Intronic
930577886 2:53174104-53174126 CAAGATATCATTGCATAAATTGG - Intergenic
931782306 2:65589335-65589357 CAGTATTCCTATCTATAAATTGG + Intergenic
932788000 2:74624597-74624619 TAAAATACCAATTTATATATAGG - Intronic
934981292 2:98844924-98844946 CAAGCTACAAATCTACAAAAGGG + Intronic
937478218 2:122234085-122234107 CAGGTTCCCAATCTGTAAATGGG + Intergenic
937724591 2:125146917-125146939 CATGATACCTATCTTTACATAGG + Intergenic
938151260 2:128885889-128885911 CAAAAGAAAAATCTATAAATTGG - Intergenic
938769476 2:134488786-134488808 AAAGATAACAATAGATAAATGGG + Intronic
939596320 2:144127796-144127818 CAAGATACACATCTAGAAAGTGG + Intronic
940162826 2:150731793-150731815 TAAAATTCTAATCTATAAATGGG - Intergenic
940498570 2:154465440-154465462 CAAGAAACCAATATACAACTGGG - Intergenic
940758998 2:157716825-157716847 CAACATATAAATATATAAATGGG - Intergenic
941079653 2:161045790-161045812 TAAGATGCCCATCTATAAAAGGG + Intergenic
944050154 2:195458788-195458810 CAAGAAACAGATCTATAAATAGG + Intergenic
945367151 2:208968861-208968883 CAAGAAACCAGTCTATGATTAGG - Intergenic
945968891 2:216217332-216217354 CAAGATACCAAATTACAAACAGG - Intergenic
946783874 2:223221839-223221861 AAAGATACCAAATTATAAACAGG - Intergenic
1170258460 20:14374760-14374782 GAGGATACCTATTTATAAATAGG - Intronic
1173388224 20:42608274-42608296 CATGATGCCACTCTATAAAGAGG + Intronic
1175574072 20:60047307-60047329 CAAGATACTCACCTATAAAATGG - Intergenic
1177708277 21:24737476-24737498 GAAGATAGCCATCTATAAACCGG + Intergenic
1177825090 21:26074032-26074054 AAAGATACCATCCAATAAATAGG + Intronic
1178386730 21:32157561-32157583 AATGATACCAATCTACAAAGTGG + Intergenic
1181643480 22:24217322-24217344 CAAGATACCAAATTATAAAGAGG + Intergenic
1183844597 22:40530988-40531010 CAATATATTAATCTATATATTGG - Intronic
949162986 3:903767-903789 CAAGAAAAAAATATATAAATTGG + Intergenic
952704546 3:36364254-36364276 GATGATACCAATCTACAAAGTGG - Intergenic
955972452 3:64448897-64448919 CAAGATAGGAACCTATATATAGG - Intergenic
956318549 3:67968268-67968290 CAAGTTTCTCATCTATAAATTGG + Intergenic
957839675 3:85652161-85652183 CAAGATACTAATCCTTTAATTGG - Intronic
957843080 3:85696276-85696298 CAAAATAACAATAAATAAATGGG - Intronic
959420931 3:106127458-106127480 CATGTTACCTATCTAGAAATGGG + Intergenic
959804155 3:110530897-110530919 AAAGATACCAATTTATAAACAGG + Intergenic
961907275 3:130276073-130276095 TAAGATACCAAATTATAAACAGG - Intergenic
962177334 3:133168001-133168023 TAAGATACCAAATTATAAACAGG - Intronic
963644402 3:147895709-147895731 TAAGAAACCAAATTATAAATAGG - Intergenic
963849311 3:150194094-150194116 CTAGATGCCAATCTGGAAATTGG + Intergenic
963910519 3:150813703-150813725 TAAGATACCAAATTATAAACAGG - Intergenic
965739235 3:171856149-171856171 GATGATACCAATCTATGAAATGG - Intronic
966318846 3:178678331-178678353 TAAGATTCCAAATTATAAATGGG - Intronic
966439844 3:179932064-179932086 CAACATACCTGTCTATAAATAGG + Intronic
968590642 4:1457787-1457809 TAAGATATCAAACTATAAACAGG - Intergenic
968640896 4:1713960-1713982 TAAGATACCAAATTATGAATAGG + Intergenic
969667718 4:8571476-8571498 GATGATACCAATCTGTAAAATGG + Intronic
970372276 4:15419990-15420012 CAAGAAATCTATCTATTAATAGG + Intronic
970479952 4:16462763-16462785 CATGATACCAATATAGAAACTGG + Intergenic
970646319 4:18124831-18124853 CAAGATACCCAAATATCAATGGG - Intergenic
970768293 4:19578211-19578233 CAACAAACCAATATAAAAATGGG - Intergenic
972922436 4:43960431-43960453 TAAGACACCAAATTATAAATAGG - Intergenic
973940251 4:55901571-55901593 TAAGACCCCAATTTATAAATGGG + Intronic
974027310 4:56745025-56745047 TAAGATACCAAAGTATAAACAGG + Intergenic
974382125 4:61154574-61154596 GAAGATACCTATTTATAAAGTGG + Intergenic
975115342 4:70674224-70674246 CTAGATACTACTCTTTAAATAGG - Intronic
975898670 4:79123693-79123715 TAAGAAACCAATTTTTAAATTGG + Intergenic
976136445 4:81942420-81942442 AAAGAAATCAATTTATAAATGGG + Intronic
976685941 4:87815036-87815058 CATGGTACCAATATAAAAATAGG - Intergenic
976813405 4:89120785-89120807 CAAAATACCAAATTATAAACAGG + Intergenic
977365467 4:96062865-96062887 CAAAACAAGAATCTATAAATTGG - Intergenic
978493680 4:109335537-109335559 CAAGATCTCACTCTATAAAGAGG + Intergenic
979631598 4:122908252-122908274 TAAGATACCAAATTATAAACAGG + Intronic
980597880 4:134978821-134978843 CAAGATATAAATGGATAAATCGG + Intergenic
982553896 4:156836944-156836966 AAAGAAGCCAATCTTTAAATAGG - Intronic
982655091 4:158137894-158137916 CAATATAGAAATCTAAAAATGGG + Intronic
983159655 4:164396359-164396381 CAATAGACTAATCTATATATTGG - Intergenic
984273144 4:177573067-177573089 CAAAATACAAATATTTAAATTGG + Intergenic
986253030 5:6078521-6078543 CAAGATACCAAATTATAAACAGG + Intergenic
987145734 5:14989567-14989589 CAAGTTACCTGCCTATAAATTGG - Intergenic
988071749 5:26299027-26299049 CAAGATACAAATGTATATAAAGG + Intergenic
989319999 5:40122872-40122894 GATGATACCAATCTACAAAATGG + Intergenic
989435600 5:41409791-41409813 CAACATCCTCATCTATAAATAGG + Intronic
990185959 5:53209307-53209329 AATGATACCAATCTACAAACTGG + Intergenic
990931791 5:61100029-61100051 CAACATACAAAGCTAGAAATGGG - Intronic
992664302 5:78991199-78991221 CAACAAACCAATTTTTAAATGGG + Intergenic
993335481 5:86653086-86653108 CAAGGAACAAATCTGTAAATGGG - Intergenic
995475934 5:112548233-112548255 TAAGATACCAACATATAAAAAGG + Intergenic
996038007 5:118780353-118780375 GATGATACCAATCTACAAAATGG - Intergenic
996411571 5:123164518-123164540 CAAGAAACTAATATAAAAATTGG + Intronic
996424949 5:123304480-123304502 TAAGATACCAAGTTATAAATAGG - Intergenic
996487139 5:124049702-124049724 CAAGATTCCATTCTAGAAATGGG + Intergenic
997765390 5:136498427-136498449 AAAAATACCAATTTTTAAATAGG - Intergenic
998999930 5:147909390-147909412 CAAAATACCATTTTATAAATGGG + Intergenic
999189325 5:149734906-149734928 CAAGATACCAATTGCAAAATGGG - Intronic
1002030466 5:176424947-176424969 CAAGATTAGAATCTAAAAATAGG + Intergenic
1004496916 6:16173192-16173214 CAAGATGTCATTCTATAAAAAGG + Intergenic
1004595949 6:17100063-17100085 TAACATACCAAATTATAAATAGG - Intergenic
1004812973 6:19279819-19279841 CAACATCTCAATCTATAAAATGG + Intergenic
1006011257 6:31044781-31044803 CAATTTACCTATCTATAAAATGG + Intergenic
1007714096 6:43844396-43844418 CAATAGACCACTCCATAAATGGG - Intergenic
1008026507 6:46642522-46642544 CAAGAAAAGAAGCTATAAATAGG - Intronic
1008883053 6:56400796-56400818 TTAGATTCCAATCTAAAAATAGG - Intergenic
1008977851 6:57448822-57448844 TAAGATACCAAATTATAAATAGG - Intronic
1009165998 6:60341769-60341791 TAAGATACCAAATTATAAATAGG - Intergenic
1010296074 6:74197691-74197713 CAAGATAGTAAACTATAAATTGG - Intergenic
1010315913 6:74450201-74450223 CATGGTACCAATATAAAAATAGG - Intergenic
1010462104 6:76125281-76125303 TAAGATACCAACTTATAAACAGG + Intergenic
1010519481 6:76815461-76815483 CAAGCTTCCATTCTATAAACAGG + Intergenic
1011735544 6:90306894-90306916 CAACAACCCAATCAATAAATGGG - Intergenic
1012105161 6:95148184-95148206 TAAGATACCAAATTATAAGTAGG - Intergenic
1012759674 6:103282822-103282844 TAAGATACCAAATTATAAACAGG + Intergenic
1013198284 6:107865376-107865398 CAAAATACCCATCAATGAATTGG + Intergenic
1014172222 6:118291382-118291404 CAAGTGACCAATTTAAAAATGGG - Intronic
1014647516 6:123992621-123992643 CAAGATATAAACCTATAAAAAGG + Intronic
1016010321 6:139132815-139132837 CAAAATATCTATCTATCAATAGG + Intergenic
1016065585 6:139679503-139679525 CAAGCTAACATTCTATAAACTGG - Intergenic
1018568432 6:165182597-165182619 CAAGATACTAATTTCTATATTGG - Intergenic
1019269434 7:138803-138825 TAAGATACCAAATTATAAACAGG - Intergenic
1021571802 7:22073503-22073525 CAATATACCCATCTCTAAAAGGG - Intergenic
1022678163 7:32520271-32520293 AATGATACCAATCTATAAAATGG - Intronic
1023241964 7:38158268-38158290 TAAGATACCAAATTATAAATAGG - Intergenic
1023789334 7:43739683-43739705 CAAGAGACCAATTTAAAAAGGGG - Intergenic
1026315770 7:69225921-69225943 TAAGATACCAAATTATAAACAGG - Intergenic
1026611356 7:71862813-71862835 CAAGATAACAATCTACTAGTGGG + Intronic
1029192626 7:98782576-98782598 TAAGATACCAAATTATAAACAGG - Intergenic
1029192724 7:98783230-98783252 TAAGATACCAAATTATAAACAGG - Intergenic
1030523091 7:110622180-110622202 CAAGCTACCAATCTCTATCTTGG + Intergenic
1031318310 7:120286660-120286682 CAAAATTCCAATTTCTAAATAGG - Intronic
1032833081 7:135648609-135648631 AAAGAAACTAATCTATAAAATGG - Exonic
1035612904 8:980152-980174 CAGGAGACAAATCTATAACTTGG + Intergenic
1038172215 8:25145817-25145839 CAATTTACTCATCTATAAATGGG + Intergenic
1039309079 8:36296507-36296529 ATAGTTACCAATCTATAAATGGG - Intergenic
1039624908 8:39039133-39039155 CAAAAGACCAAGCTATAGATAGG + Intronic
1040475731 8:47775721-47775743 CAAGAAACAAATATATACATTGG - Intronic
1041029449 8:53721563-53721585 CGAGTTACGTATCTATAAATTGG - Intronic
1042107161 8:65340401-65340423 TAAGATACCAAATTATAAACAGG - Intergenic
1042933079 8:74032215-74032237 GATGATACCAATCTACAAAATGG - Intergenic
1043820766 8:84860265-84860287 AAACAAGCCAATCTATAAATTGG - Intronic
1044282216 8:90369249-90369271 CAAGATACCTATCTGAAATTTGG - Intergenic
1044452788 8:92357795-92357817 CAAGATACCTAAATAAAAATTGG - Intergenic
1047011671 8:120679242-120679264 CTATATACCATTCTAAAAATTGG + Intronic
1047439991 8:124869332-124869354 CAAGATAACAAAATAAAAATAGG - Intergenic
1048952402 8:139507279-139507301 GAAGATAAGAATCTAGAAATGGG + Intergenic
1050352804 9:4756305-4756327 TAAGATACCAAATTATAAACAGG - Intergenic
1051643225 9:19243014-19243036 CAAGATACCCCCCTTTAAATTGG - Intronic
1052895656 9:33745827-33745849 CATGATACCAATATAAAAGTAGG + Intergenic
1053228295 9:36381494-36381516 TAAGATACCAAATTATAAACAGG + Intronic
1053563267 9:39218878-39218900 GAAGATATCAATTTATGAATGGG - Intronic
1053829056 9:42056798-42056820 GAAGATATCAATTTATAAATGGG - Intronic
1054133880 9:61400189-61400211 GAAGATATCAATTTATGAATGGG + Intergenic
1054601506 9:67130649-67130671 GAAGATATCAATTTATAAATGGG + Intergenic
1054801146 9:69349585-69349607 CAAGTAACCAATTTTTAAATGGG - Intronic
1054802260 9:69362215-69362237 CAAGATTTCATTCTTTAAATAGG - Intronic
1055051717 9:71988177-71988199 TAAGATACCAAATTATAAACAGG - Intergenic
1056209872 9:84355636-84355658 CAAGTTCCCAATCTAGAAATAGG - Intergenic
1057000098 9:91500794-91500816 TAAGATACCAAATTATAAACAGG - Intergenic
1057173566 9:92977931-92977953 TAAGATACCAAATTATAAACAGG + Intronic
1059892434 9:118817835-118817857 GACGATGCCAATCTATAAAAGGG + Intergenic
1060331138 9:122671733-122671755 TAAGATACCAAATTATAAATGGG + Intergenic
1187737115 X:22316461-22316483 CAAGATAGGTGTCTATAAATGGG - Intergenic
1188366109 X:29316841-29316863 TAAGATACCAAATTATAAACAGG - Intronic
1188591123 X:31836528-31836550 TAAGATCACAATATATAAATAGG + Intronic
1190410257 X:50130089-50130111 TAAGATACCAAATTATAAACAGG - Intergenic
1190570314 X:51775042-51775064 GATGATACCAATCTACAAAATGG - Intergenic
1190774731 X:53543660-53543682 CAACAAACCAATCAACAAATAGG + Intronic
1192749372 X:73972588-73972610 CAAGAACCCAATTTAAAAATGGG - Intergenic
1194742670 X:97593788-97593810 TAAGATCCCAATAGATAAATGGG + Intronic
1195484181 X:105383938-105383960 AAATAATCCAATCTATAAATGGG - Intronic
1195566107 X:106340667-106340689 AATGATACCAATCTACAAAATGG + Intergenic
1197560949 X:128021015-128021037 CAGGATACCAAATTATAAACAGG - Intergenic
1197618862 X:128723973-128723995 GAAGATGCTAATCTATAAAGAGG - Intergenic
1197957661 X:131969987-131970009 CAAGATAACAATTAAAAAATTGG + Intergenic
1199336498 X:146623752-146623774 CCAGAAACCAATCTAAACATAGG - Intergenic
1199490482 X:148393462-148393484 CAAGAAACCAATATATCAAAGGG + Intergenic
1200900598 Y:8427826-8427848 CAAGATACCATTTATTAAATAGG - Intergenic