ID: 930350028

View in Genome Browser
Species Human (GRCh38)
Location 2:50239551-50239573
Sequence AAATTTCCTCAGATATAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 259}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930350028_930350029 18 Left 930350028 2:50239551-50239573 CCATGCTATATCTGAGGAAATTT 0: 1
1: 0
2: 0
3: 19
4: 259
Right 930350029 2:50239592-50239614 GCTATCTAAAGTTGCAAACTTGG 0: 1
1: 0
2: 0
3: 9
4: 90
930350028_930350030 26 Left 930350028 2:50239551-50239573 CCATGCTATATCTGAGGAAATTT 0: 1
1: 0
2: 0
3: 19
4: 259
Right 930350030 2:50239600-50239622 AAGTTGCAAACTTGGTTAATTGG 0: 1
1: 0
2: 1
3: 8
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930350028 Original CRISPR AAATTTCCTCAGATATAGCA TGG (reversed) Intronic
901725268 1:11236830-11236852 AACATTCCTCAGTTATAGGAAGG - Intronic
906216620 1:44044727-44044749 AAATTTCCTCATCTCTAACATGG + Intergenic
908082376 1:60594942-60594964 AACTCTCCTCAGATATCTCATGG - Intergenic
908769915 1:67586642-67586664 AAATTTCCTCTGCTATAACATGG + Intergenic
911150649 1:94594397-94594419 AAATTTTTTCACAGATAGCAAGG - Intergenic
911625811 1:100123217-100123239 AATCTTCCTCAGATATAACAAGG + Exonic
912133528 1:106631321-106631343 AAATTTCCTTATTTGTAGCATGG - Intergenic
912360973 1:109094630-109094652 AGTTTTCCCCACATATAGCAGGG - Exonic
912694056 1:111827655-111827677 CAGTTTCCTCATATATAACATGG - Intronic
915027028 1:152840874-152840896 GAATTTCATCACATATAGGATGG - Intergenic
915626418 1:157116703-157116725 AAAGTTCCTTAGATAAATCAAGG + Intergenic
916288710 1:163139863-163139885 CAATTTCCTCATATATAAAATGG + Intronic
917118056 1:171622289-171622311 AAATCTCCACAGATGTCGCAGGG - Intergenic
917825644 1:178817604-178817626 AAATTTCCACAGATATAAAATGG - Intronic
918787236 1:188777400-188777422 ATTTTTTCTCAGATATCGCATGG - Intergenic
921364234 1:214358627-214358649 ACATTTCCTCAGCAATAACATGG + Intronic
922267406 1:223996573-223996595 AAATTAGATCACATATAGCATGG - Intergenic
923558126 1:235017853-235017875 GAAGTTACTCAGAGATAGCAAGG - Intergenic
924105353 1:240643979-240644001 AAATTTACTTAGATATGGCCAGG - Intergenic
1065386271 10:25136490-25136512 ACATTTCCTCACTTATAGAAAGG - Intergenic
1066028402 10:31390143-31390165 AGTTTGCCTCAAATATAGCATGG - Intronic
1069109964 10:64435145-64435167 CAAGGTCCTCAGATTTAGCAAGG + Intergenic
1070388541 10:75948840-75948862 AAATTTCCCCATATCCAGCAAGG - Intronic
1070431712 10:76346729-76346751 CAATTTCCTCATATATAAAATGG - Intronic
1072267690 10:93746134-93746156 CAGTTTCCTCATATATAGCATGG - Intergenic
1072289016 10:93945346-93945368 AAATTTCATCAAATATAGCTGGG + Intronic
1072852497 10:98910926-98910948 AAATTTCCTCAGATAGAGGGTGG - Intronic
1073633978 10:105178290-105178312 AAATTTCCTCATCTATAAAATGG + Intronic
1074009798 10:109466144-109466166 AAAATTTCTAAGATATAGCTTGG - Intergenic
1074304290 10:112262533-112262555 CAATTTCCTCATCTGTAGCATGG - Intergenic
1075288036 10:121204156-121204178 AAATCTTCTCAGATATAAGAGGG + Intergenic
1078139981 11:8685189-8685211 AAATCTCTTCAGATAATGCATGG - Intronic
1079132392 11:17754945-17754967 AACTTTCCTCAGCTTTATCAAGG - Intronic
1080002487 11:27365120-27365142 TAATTACCTCAAATATACCATGG - Intergenic
1080987618 11:37488633-37488655 TAATTTGATCAGATAAAGCAGGG - Intergenic
1081019393 11:37925552-37925574 AAATCTCCTCAGCTATACCGTGG - Intergenic
1081232085 11:40598059-40598081 AAGTTTCCTCTGAAGTAGCAGGG + Intronic
1081980594 11:47264004-47264026 AAAATACTTCAGATATAGGATGG - Intronic
1082846755 11:57732412-57732434 AAAGATCCTCTGAAATAGCAAGG - Intronic
1083426438 11:62589911-62589933 CAACTTCCTCAGATATAAAATGG + Intronic
1086726522 11:90191986-90192008 AAATTCCCTAAATTATAGCAAGG + Exonic
1088104570 11:106191802-106191824 AAATTTCCTTTGATTTAGCAGGG + Intergenic
1088185601 11:107165026-107165048 AAATTTCCTCAGTTTTATAAAGG - Intergenic
1089881132 11:121774944-121774966 AAATTCCCTCCGATAAAGCATGG + Intergenic
1092036456 12:5339510-5339532 TGATTTCCTCAGCTATAACATGG - Intergenic
1093350010 12:18087314-18087336 AAATTTCCTTAAATATAACCTGG - Intronic
1093866993 12:24239318-24239340 AAATTTCCTTAGAGATGACAAGG + Intergenic
1094064932 12:26352055-26352077 TGATTTCCTCAGATACAGGAAGG - Intronic
1095588708 12:43878686-43878708 AAATTTTCTAAGACATACCAAGG - Intronic
1097592373 12:61589015-61589037 AAAATTCCCCAGGTATAGCTAGG + Intergenic
1097718392 12:62993365-62993387 AACTGGCCTCAGATATGGCAGGG - Intergenic
1099392857 12:82102014-82102036 AAATTTCCAAAGAAATAACAAGG + Intergenic
1099832516 12:87862921-87862943 AAAATTCCTTATATATTGCAAGG + Intergenic
1099837392 12:87924038-87924060 AAGTATCTACAGATATAGCAAGG + Intergenic
1099866806 12:88292926-88292948 AACTTTCCTCAGACATAGATGGG - Intergenic
1100728171 12:97432195-97432217 CAATTTCCTCATCTATCGCATGG - Intergenic
1100862663 12:98822982-98823004 AAGTTGTCTCAGATAGAGCAGGG + Intronic
1102633664 12:114303621-114303643 CAATTTGCTCAGCTATAGAATGG + Intergenic
1107004213 13:35589303-35589325 GAATTTTCTCAGATATAAAAGGG + Intronic
1107424552 13:40280218-40280240 AAATTTCCTCATCTGTAGAATGG + Intergenic
1110209051 13:72951447-72951469 ATATTTCCTCAGAAAATGCAGGG + Intronic
1110797215 13:79653243-79653265 CAATTTCCTCATATATAAAATGG - Intergenic
1110862937 13:80363584-80363606 AAATATCCTCAGATATACAGTGG - Intergenic
1113053289 13:106238178-106238200 CAATTTCCTCATCTATAACATGG + Intergenic
1113283764 13:108822089-108822111 TCATTTGCTCAGTTATAGCATGG - Intronic
1114246934 14:20922980-20923002 AAAATTCCTCACAAATATCAAGG + Intergenic
1115471010 14:33768667-33768689 GGATTTCCTCAGATATAAAATGG - Intronic
1115945975 14:38661141-38661163 TAATTACTTCAGATAAAGCAGGG - Intergenic
1118795200 14:69137211-69137233 AAAGTTCCTCAAATAGAGCTGGG + Intronic
1119276272 14:73359498-73359520 AATTTTGCTTTGATATAGCAAGG + Intronic
1119534339 14:75390449-75390471 CAACTTTCTCAGCTATAGCACGG - Intergenic
1120335789 14:83152819-83152841 AACTTTCCTCAGATAAAAAATGG + Intergenic
1121792769 14:96711572-96711594 ACCTTTCCTCAAATATAGCTGGG + Intergenic
1124372001 15:29109335-29109357 AAATTTGCTCTGACACAGCAGGG - Intronic
1126507658 15:49425974-49425996 AAAGTTGCTCAGATTTATCATGG + Intronic
1127151977 15:56085164-56085186 AAATATGCTCAGATATAGCTTGG + Intergenic
1128986532 15:72226120-72226142 AAATCTCCTCTGAAATGGCATGG + Intronic
1129510168 15:76115784-76115806 GAATTTCCCCAAATATAGAAGGG - Intronic
1134234899 16:12457743-12457765 AAATTTCCTCACATACAAGATGG - Intronic
1138722918 16:59102718-59102740 AAATTTCCTCATCTATACAATGG - Intergenic
1140607560 16:76559050-76559072 AAATGTTCTCAAATAAAGCAAGG - Intronic
1140623361 16:76763252-76763274 AAAGAGCCTCAGATACAGCATGG + Intergenic
1203047610 16_KI270728v1_random:845260-845282 AAATATCTTCAGATAAAACATGG + Intergenic
1142654045 17:1378239-1378261 AAATGTCCTCAGTTATTTCATGG - Intronic
1142903920 17:3030270-3030292 AACTTTTCTCGGATACAGCAAGG - Intronic
1144301577 17:13926377-13926399 AGATTTCCTCAGTTGGAGCACGG - Intergenic
1144420731 17:15095659-15095681 ATATTTCAGCAGATATATCATGG - Intergenic
1144665716 17:17100956-17100978 AAATTTCCTCATCTGTAGAATGG + Intronic
1147696970 17:42362643-42362665 TAATTTCCTCATCTATAGAAAGG + Intronic
1149596322 17:57866790-57866812 AAATTTCCTCATCTATAAAATGG + Intronic
1150330031 17:64287041-64287063 AAATTTCCCCAGTTATTTCAAGG - Intergenic
1155985515 18:32226830-32226852 CAATTTCCTCAGCTATAAAATGG + Intronic
1157332851 18:46716191-46716213 AAATTTCCTCATCTATAAAATGG + Intronic
1159087362 18:63809225-63809247 CAATTTCCACAGGCATAGCAGGG + Intergenic
1159319158 18:66824164-66824186 AAATTTCTTCAGTTCTAGCTGGG + Intergenic
1159377326 18:67609853-67609875 AAATTTCACCAGAAATAGAATGG - Intergenic
1159982834 18:74806903-74806925 AAATTTTCTCAGGCATGGCATGG + Intronic
1162205242 19:9050858-9050880 CAGTTTGCCCAGATATAGCATGG + Intergenic
1163803866 19:19384810-19384832 CACTTTCCTCAGATAAAGGAGGG + Intergenic
1164743877 19:30596728-30596750 AAGTTTCCTTAAATATTGCACGG - Intronic
925037356 2:699316-699338 AAATGAACTCAGATATTGCATGG - Intergenic
928554269 2:32407104-32407126 GCATTTCCTGATATATAGCATGG + Intronic
929310731 2:40421379-40421401 AAATTTCCTGAGATAAAGATGGG - Intronic
929900624 2:46000081-46000103 AACTAGACTCAGATATAGCAGGG - Intronic
930079819 2:47436595-47436617 AACTTTCATCAGATATCCCAAGG + Intronic
930350028 2:50239551-50239573 AAATTTCCTCAGATATAGCATGG - Intronic
931050216 2:58405599-58405621 AATTTACCTCAGATATAAGAGGG + Intergenic
932673404 2:73757431-73757453 AAATCTCCTTTGGTATAGCAAGG - Intergenic
937885424 2:126896465-126896487 AAATTTCCTGAGTGATAGGACGG + Intergenic
939853890 2:147333799-147333821 AACTTTCCTCCAATCTAGCAGGG - Intergenic
940290245 2:152071345-152071367 ACACTTCCTCAAACATAGCAGGG + Intronic
940573821 2:155473967-155473989 AAATTCCCTCAGAATTAACATGG - Intergenic
941198164 2:162475855-162475877 AAATTTTCTCAGTTAGAGCTGGG - Intronic
942260583 2:174157701-174157723 AATTTTTCTAAGATATAGAAGGG + Intronic
944052905 2:195491523-195491545 ATATTTCCTGACAAATAGCAAGG - Intergenic
944646286 2:201783968-201783990 AAATTGTCTCAGATTTAGAAAGG + Intergenic
945695606 2:213099573-213099595 ATAATTCCTCATATACAGCATGG + Intronic
946482951 2:220074199-220074221 AGATTTCCTCAGAAATTGGAGGG + Intergenic
947648333 2:231762015-231762037 AGACTTCCTCAAATATACCATGG + Intronic
1169036152 20:2453975-2453997 CAGTTTCCTCAGCTATAGAATGG - Intergenic
1170316409 20:15045804-15045826 AAGTTCCCTCAGTTATAACAAGG - Intronic
1175450356 20:59060588-59060610 CAATTTCCTAAGTTATAGCAGGG - Intergenic
1175596623 20:60239720-60239742 AAATGTCCTCAGAGAAATCAGGG + Intergenic
1177091501 21:16774886-16774908 ATATTTCCTTAGAAATATCAAGG - Intergenic
1177399597 21:20585605-20585627 AAATTTCCTCAGTTTGAGAAAGG + Intergenic
1179631792 21:42683468-42683490 AAATTTCCTCTGCTATAAAATGG - Intronic
1181394794 22:22613433-22613455 GAATTTCCTCAGGAAAAGCAGGG + Intergenic
1183117301 22:35701875-35701897 AGATTACATCAGATATAACAAGG - Intergenic
1184075478 22:42174594-42174616 AAAAATCCTCATATATAGCTGGG + Intronic
949782638 3:7707378-7707400 ACTTTTCCTCAGATACAGGAAGG - Intronic
950734660 3:14996519-14996541 AAATTTCCTCAAATTCAACATGG - Intronic
951185249 3:19705020-19705042 AAAGTCCCTCAGTAATAGCAAGG + Intergenic
951185923 3:19712950-19712972 AATTTCTCTCAAATATAGCATGG - Intergenic
952308181 3:32163653-32163675 CAATTTACTCATATATAGAATGG + Intronic
953236924 3:41115110-41115132 TAATTTCCTTATCTATAGCATGG - Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
954986138 3:54794076-54794098 AAATTTGCTCTTATATATCAAGG - Intronic
958035242 3:88162554-88162576 ATATTTCCTCATATGTAGTAGGG + Intronic
960327495 3:116315273-116315295 AAATTTCCTCAGATGCAATAGGG + Intronic
960423946 3:117483183-117483205 AAATTCCCTCTGATAAAACAAGG - Intergenic
963318293 3:143784689-143784711 AAATATCTTCAGAGATATCAAGG - Intronic
964191264 3:154003810-154003832 AAAGGTCCTCAGATAGAGCCTGG - Intergenic
964594220 3:158404723-158404745 AAATTTACTGAAGTATAGCAAGG + Intronic
964776146 3:160280148-160280170 AAATTCTCTAAGAAATAGCAAGG - Intronic
965288765 3:166849546-166849568 TAGATTCCTCAGATAAAGCAGGG + Intergenic
965685746 3:171300410-171300432 AAATTTTCTCAGAAAGAGAAAGG + Intronic
966551465 3:181209079-181209101 AAGTTTCCTCATATATAAGAAGG + Intergenic
967599451 3:191367726-191367748 TTTTTTCCTCAGTTATAGCAGGG + Intronic
970979625 4:22081326-22081348 TAGTTTCCTTATATATAGCAGGG - Intergenic
972154693 4:36145310-36145332 AAATGTCGTCATATATACCATGG + Intronic
974159089 4:58113836-58113858 CAATTGCGTCAGATATAGCATGG + Intergenic
975364081 4:73507937-73507959 AGATTTCCTCAGTTTTATCAGGG + Intergenic
977831665 4:101601335-101601357 TAATTTCCTCATCTATAACACGG - Intronic
978136741 4:105271450-105271472 AATTTGCCTCTGATAGAGCATGG + Intronic
979596008 4:122534667-122534689 TAATTTCCTCAGACAGTGCAGGG + Intergenic
979616543 4:122748889-122748911 CAATTTCCTCATCTATAACATGG - Intergenic
981639482 4:146923174-146923196 AAATTTTTTCAGATAATGCAAGG - Intronic
982142755 4:152343322-152343344 AAATTTTCTCAGATCTAAAAAGG - Intronic
982308089 4:153954682-153954704 AAAGTCCCTCACATATTGCAAGG + Intergenic
982338739 4:154270939-154270961 AGATTTGTTCAGATAGAGCAGGG + Intronic
984298792 4:177888886-177888908 AAATTTCCTAGAATAGAGCAAGG - Intronic
985424973 4:189821092-189821114 CAATTTCTTCAGAAATATCATGG - Intergenic
987014567 5:13805054-13805076 AAATTTCCTGAGTGATAGAAAGG + Intronic
987551997 5:19395079-19395101 TAATTTACTCAGTTATAGAATGG + Intergenic
988017754 5:25581164-25581186 AAATTTCCTCATATGTAAAATGG - Intergenic
988882411 5:35517454-35517476 AAGATTCCTGAGATAAAGCAAGG - Intergenic
988932699 5:36052527-36052549 CAATTTACTCAGATGAAGCATGG - Intronic
989777831 5:45230629-45230651 AAATTTCCTCATCTACAGAATGG - Intergenic
989857208 5:46312917-46312939 AAATTTCTTCAGATACAAAATGG + Intergenic
990052625 5:51525570-51525592 AAATTGGCTCAGATATTACATGG + Intergenic
991060689 5:62371915-62371937 ATATTTTCTCAGTTATACCAAGG + Intronic
991200956 5:63991860-63991882 AAATTTCATAAGTTATACCACGG - Intergenic
991203498 5:64021802-64021824 AAAATTCCTCAGAGATAGATAGG + Intergenic
991551704 5:67843801-67843823 GAATTTCCTGAGAGATAGGAGGG - Intergenic
993523122 5:88929577-88929599 AACTTGGCTCAGATATAGCGTGG - Intergenic
993793916 5:92242805-92242827 AACTTTCCTCAAAAATAGAAGGG + Intergenic
993925701 5:93863202-93863224 AAAACTCCTCAGAAATAGGATGG + Intronic
995404874 5:111783600-111783622 AAACTTCCTCAGATGGAGAAGGG - Intronic
995567928 5:113451260-113451282 AAAGGCCCTCAGATAAAGCAAGG + Intronic
995781559 5:115781418-115781440 AAATTTTTCCAGATATTGCAGGG - Intergenic
996301327 5:121989660-121989682 ACCTTTCCTCAGAAAGAGCAAGG + Intronic
996762998 5:127004680-127004702 AACTTTGCTCAGACATAGGAAGG + Intronic
996887127 5:128370598-128370620 AAATTTGCACAAATATAACATGG + Intronic
997684177 5:135777203-135777225 AAATTACCTCCAATATCGCAGGG + Intergenic
998226340 5:140329535-140329557 AATTTTCCTCATCTATAACACGG + Intergenic
1000073479 5:157763136-157763158 TAGTTTCCTCACATATATCAAGG - Intergenic
1000176792 5:158763915-158763937 AAAGGTCCTCAGAGATAGCCTGG - Intronic
1000740792 5:164968079-164968101 AAATTTCATCAATTGTAGCAAGG - Intergenic
1001141399 5:169146916-169146938 AAGTTTCCTCATCTGTAGCATGG + Intronic
1001201680 5:169723372-169723394 CAATTTCCTCATATGTAACACGG + Intronic
1003801620 6:9676142-9676164 AAATTTCCACAGATATATAAAGG - Intronic
1005131447 6:22513160-22513182 ATATTTCCTCTGAGATATCATGG + Intergenic
1005347437 6:24904413-24904435 ACATTCCCTCTGACATAGCAGGG + Intronic
1007729997 6:43939836-43939858 AAATTTCCTCAGAGGGGGCAGGG - Intergenic
1008377079 6:50804283-50804305 ATTTTTTCTCAGATATTGCAGGG + Intergenic
1008380183 6:50832414-50832436 TAATTTCCACAAATAAAGCAGGG - Intronic
1011035339 6:82967950-82967972 AAATTTACTCAGTTATAAAAAGG - Intronic
1012364790 6:98425318-98425340 AAATTTCTTCACATATAGAATGG - Intergenic
1013069338 6:106714421-106714443 ATATCTCATCAGATAAAGCAGGG - Intergenic
1017502096 6:155034992-155035014 AAATTTCCTTAGATTTATTATGG - Intronic
1017502609 6:155039402-155039424 AAATTTCTTGAGATCTTGCATGG + Intronic
1018411542 6:163553915-163553937 AACTTTCCACACATAAAGCAAGG - Intronic
1023753118 7:43390617-43390639 TCATTTCCTCAGATCTAGCCTGG - Intronic
1024049920 7:45612322-45612344 AAATTTCCTCATCTATAAAATGG - Intronic
1024296085 7:47843432-47843454 AAAGTTCCTCAGACCCAGCATGG - Intronic
1024423107 7:49193128-49193150 AAAATTCCTCAGAACCAGCAAGG + Intergenic
1024857405 7:53797520-53797542 AAAATTCCTCAAATACAGCTGGG - Intergenic
1025863502 7:65357009-65357031 AAATTTCCTCATGTACAGTAAGG - Intergenic
1026168823 7:67935018-67935040 AAACTCCCTCAAATAAAGCAAGG - Intergenic
1027662079 7:80999099-80999121 ACATTTTCTCAGTTATATCAAGG + Intergenic
1028443135 7:90887081-90887103 AAAATCCCTCATATATAGCTAGG - Intronic
1029921454 7:104269077-104269099 CAAATTCCTCAAATATAGCAAGG - Intergenic
1030082196 7:105787887-105787909 AAGTTTCCTTATCTATAGCAGGG - Intronic
1031205100 7:118746515-118746537 AAATTTTCTCAGATTTTGCTAGG + Intergenic
1032375526 7:131412400-131412422 AAAGTTCCACAGATTTAGAATGG - Intronic
1033673467 7:143514820-143514842 CAATTTCCTCATCTATAACATGG - Intergenic
1033719155 7:144038587-144038609 AAATTCCATCAGATATATCTTGG - Intergenic
1033769955 7:144538924-144538946 AAATTTCATCAGTTCTAACATGG + Intronic
1033921784 7:146402660-146402682 AAAGTTCCTTAGATATAACTAGG + Intronic
1034608070 7:152336498-152336520 ATATTTCCTCAGATATCACTGGG - Intronic
1039131973 8:34275474-34275496 ATATTTTCTTAGATAAAGCATGG + Intergenic
1040980049 8:53237820-53237842 AAATTTCTTCAGCTATATGAGGG - Intronic
1041199417 8:55436651-55436673 AAATGTCATCAGAAATAGCTCGG + Intronic
1042287485 8:67130177-67130199 ACAATCCCTCAGATATACCACGG + Intronic
1043162252 8:76860552-76860574 TAATTTCCTCAGATTTAGGGGGG + Intronic
1046068658 8:109224144-109224166 AAGTTTCCTCAGGTATATAATGG - Intergenic
1046165800 8:110433165-110433187 AAATTTTCTCAAATATACCCCGG + Intergenic
1046926146 8:119791160-119791182 GCATTTCCTCAGATGTAGAATGG - Intronic
1047151949 8:122273941-122273963 CAGTTTCCTCAGAGCTAGCAGGG - Intergenic
1047781446 8:128114803-128114825 CAATTTCCTCAGTTGTAACATGG - Intergenic
1048275281 8:133061375-133061397 AAATTAACTGAGATAAAGCATGG + Intronic
1048663112 8:136629894-136629916 ATATTTTCTGTGATATAGCAAGG + Intergenic
1048706607 8:137160752-137160774 AAATTTCCTCAGACTTAGATCGG - Intergenic
1048982470 8:139710177-139710199 AGATTTCCTCTAATAAAGCAAGG - Intergenic
1049322455 8:142003922-142003944 AAATGTTCTCAAACATAGCACGG - Intergenic
1050112125 9:2228035-2228057 AAATTTCCTCATATGTAAAACGG - Intergenic
1051115147 9:13685942-13685964 AAATATGCTCAGTGATAGCATGG + Intergenic
1051976265 9:22953372-22953394 TTATTTCCTCATGTATAGCATGG + Intergenic
1052506850 9:29366383-29366405 AAAATTCTACAGATATTGCAAGG + Intergenic
1052679440 9:31670426-31670448 AAGTATCCTCAGGTATAACAAGG + Intergenic
1055830174 9:80368938-80368960 AATTTCCCACAGATATAGAAAGG + Intergenic
1056735347 9:89204950-89204972 AAATCCCCTCACATATTGCAGGG + Intergenic
1057774886 9:97999618-97999640 CAGTTTCCTCACTTATAGCAGGG + Intronic
1058351728 9:104033036-104033058 AAATTTATTCAGAGATAACATGG + Intergenic
1058372331 9:104284337-104284359 CAATTTCCTCATCTATAGAATGG + Intergenic
1060249872 9:121977586-121977608 AAATTTCCTCATCTATAAAATGG + Intronic
1060289971 9:122292870-122292892 ACAGTGCCTCATATATAGCAAGG + Intronic
1185830571 X:3298657-3298679 ACATTTACTGAGACATAGCATGG - Intergenic
1186590714 X:10927427-10927449 AAATTTCTGCAGCAATAGCATGG - Intergenic
1186890375 X:13953793-13953815 AAACTTCCACAAAGATAGCATGG - Intergenic
1187039909 X:15582821-15582843 CAGTTTCCTCACCTATAGCATGG + Intronic
1187157488 X:16734450-16734472 AAATTCCCCCAGATTTATCATGG + Intronic
1187621245 X:21058144-21058166 AAAATGCCTCAGATATAAAAAGG - Intergenic
1188421930 X:30000672-30000694 AAATTTCCTTAGGTAAAGGAGGG + Intergenic
1188816463 X:34720966-34720988 AAATTTCTTAAGATAAACCAAGG + Intergenic
1189060272 X:37746269-37746291 GAATTGCCTCACATATAGCATGG - Intronic
1189751017 X:44223048-44223070 GAATTTCCCCAAATATAGAAAGG - Intronic
1191581151 X:62762657-62762679 AAATATCCTCAGATAAAAAAGGG - Intergenic
1192492992 X:71592634-71592656 AAATTTCCTTAGACAGAGCATGG - Intronic
1192493244 X:71594844-71594866 AAATTTCCTTAGACAGAGCATGG - Intronic
1192899480 X:75480731-75480753 AATTTTCCTCAGAGACAGCCTGG - Intronic
1193428538 X:81371261-81371283 CAATTTCTTCATATATAACATGG - Intergenic
1194156048 X:90390246-90390268 AAATTTCCTGAGATGTAACTTGG + Intergenic
1194271925 X:91826050-91826072 AAGTTTTCTCACATGTAGCAAGG + Intronic
1194566955 X:95501053-95501075 AAATTTTCTAAAATATATCATGG - Intergenic
1196397391 X:115279630-115279652 CAATTTCCTCATATATAAAATGG + Intergenic
1197514913 X:127415038-127415060 AAATTTATTTAGATATAGTATGG - Intergenic
1198050638 X:132949961-132949983 AAATGTCCTTTGATAGAGCATGG - Intronic
1198301168 X:135335247-135335269 AAACCTTCTCAGATATAACAAGG - Intronic
1198305853 X:135382422-135382444 AAGTTTCCTCAGAGATTACATGG - Intergenic
1199208138 X:145173671-145173693 AAAAGTCCTCAGATGGAGCAAGG + Intergenic
1199234847 X:145479571-145479593 AAATATACTCAGATATTTCAAGG + Intergenic
1200291262 X:154876645-154876667 AAATTTTCTCCTATATAGAAAGG - Intronic
1200502398 Y:3967219-3967241 AAATTTCCTGAGATGTAACTTGG + Intergenic
1200589174 Y:5047487-5047509 AAATTTTCTCACATGTAGCAAGG + Intronic
1201379538 Y:13358893-13358915 AAATTCCCTCTGATATGGGAAGG - Intronic
1201476924 Y:14392118-14392140 AAATCTCCTCAGATATGTCAAGG - Intergenic
1201937073 Y:19420729-19420751 CAAATTCCTCAGGTATAGCTAGG + Intergenic
1201943753 Y:19487781-19487803 AAATCACCTGAGAAATAGCATGG + Intergenic