ID: 930351382

View in Genome Browser
Species Human (GRCh38)
Location 2:50259958-50259980
Sequence CTGCATGTACAGATGAAATT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 285}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930351382 Original CRISPR CTGCATGTACAGATGAAATT GGG Intronic
901835081 1:11918938-11918960 CTGCATGGACAGAAGTAAGTGGG + Intergenic
901911113 1:12459010-12459032 CTGCATGCTTTGATGAAATTCGG - Intronic
906089965 1:43170759-43170781 CTGCATCTGCAGATCAGATTTGG + Exonic
906833356 1:49058231-49058253 CTACAATTCCAGATGAAATTTGG - Intronic
909338544 1:74505277-74505299 CTGCCTGTATAGATTTAATTAGG - Intronic
909887013 1:80954525-80954547 CTGAATCTACAGATCAATTTGGG - Intergenic
910179003 1:84461155-84461177 CTGTAAGTCCAGTTGAAATTGGG + Intergenic
910999668 1:93149657-93149679 CTACATGAAGAGATGAAATGAGG - Intergenic
912027443 1:105195384-105195406 CTGCATTTACCTATGTAATTTGG - Intergenic
914007199 1:143742763-143742785 CTGCATATATAGGTAAAATTAGG - Intergenic
914646016 1:149653257-149653279 CTGCATATATAGGTAAAATTAGG - Intergenic
915289121 1:154870946-154870968 CTCCTTTTACAGATGAAAATTGG + Intergenic
915695644 1:157739129-157739151 CTACAACTAGAGATGAAATTTGG + Intergenic
918274127 1:182935245-182935267 CTGGATCTACAGATCAAGTTGGG + Intronic
920241294 1:204552822-204552844 CTACAAGTAAAGATGAAATTCGG - Exonic
920988128 1:210909688-210909710 CTGCATGTGCAGCTGCCATTAGG - Intronic
920999015 1:211024000-211024022 CAGTATGTAATGATGAAATTGGG - Intronic
921255414 1:213334347-213334369 CTGCATGAATCGATGATATTAGG + Intergenic
923447203 1:234082904-234082926 CTGCAATTAAAGATGAGATTTGG + Intronic
924862013 1:247935316-247935338 CTGTATGTATAAATGAAATAAGG - Intergenic
1063277385 10:4585247-4585269 CTGCTTGTAGAGATGCCATTAGG + Intergenic
1065906905 10:30263038-30263060 CTGCAATTTCAGATGAGATTTGG - Intergenic
1066420196 10:35258355-35258377 CTGCATATACAGGGAAAATTAGG - Intronic
1066519659 10:36201809-36201831 CTGAATCTACAGATCAAGTTGGG + Intergenic
1067971710 10:50978681-50978703 GTGCATGTGCACAGGAAATTAGG + Intergenic
1068214528 10:53967047-53967069 CTGCAATTCAAGATGAAATTTGG - Intronic
1070652759 10:78249817-78249839 CTGCATATGCAGATTAAATTTGG + Intergenic
1071113864 10:82194251-82194273 CAGCATGCACAGATGATTTTTGG + Intronic
1071426002 10:85552270-85552292 ATTCATTTACAGATCAAATTGGG - Intergenic
1075433224 10:122408006-122408028 CTTCATGTACAGATCAGATGCGG - Intronic
1076125030 10:127967308-127967330 CTGCAAGTCAAGATGAGATTTGG - Intronic
1077786362 11:5388593-5388615 GTGAATATACAGAGGAAATTAGG + Intronic
1078955311 11:16187578-16187600 TTGCCTTTACAGATGAACTTGGG - Intronic
1080273537 11:30476814-30476836 CTGAATCTACAGATCAATTTAGG + Intronic
1080852069 11:36078624-36078646 CTGCATCTGCAGCTGCAATTTGG + Intronic
1083539888 11:63505322-63505344 CTCCATGTACAGATGAACAAAGG + Intergenic
1083880049 11:65543883-65543905 CTGCATGAGCAGAAGAAAGTGGG - Intronic
1086503785 11:87480304-87480326 CTACAATTAAAGATGAAATTTGG - Intergenic
1087404574 11:97714587-97714609 CTGTATGTAAACATAAAATTGGG - Intergenic
1088229996 11:107663849-107663871 CTGCATGCATAAATGAAAATGGG - Intronic
1090821447 11:130345975-130345997 CTGCATGTACAGTTGTTATCTGG + Intergenic
1092890933 12:12968682-12968704 CCCCATGTACAGATGAACTGGGG - Intergenic
1092894043 12:12996187-12996209 CTTCATTTTCAGATGAAACTGGG + Intronic
1097404985 12:59178027-59178049 CTGCAATTCAAGATGAAATTTGG + Intergenic
1098808521 12:75053170-75053192 CTAAATCTACAGATAAAATTGGG - Intronic
1099509756 12:83519193-83519215 TTGCAAGCAGAGATGAAATTGGG - Intergenic
1099557146 12:84124029-84124051 GGGCATGTATAGAAGAAATTTGG + Intergenic
1099725026 12:86414817-86414839 CTACTTCTACTGATGAAATTAGG - Intronic
1100508399 12:95243570-95243592 ATACATTTACAGGTGAAATTAGG - Intronic
1102032274 12:109747552-109747574 TTACATTTACAGATGAATTTAGG + Intronic
1103887068 12:124210498-124210520 AGGCATTTACAGATGTAATTAGG - Intronic
1104198952 12:126568522-126568544 CTGCAATTCAAGATGAAATTTGG + Intergenic
1104321139 12:127752013-127752035 CTGCAGTTCAAGATGAAATTTGG + Intergenic
1105653579 13:22407992-22408014 CTGCATGTAATGATAAAACTGGG - Intergenic
1106136325 13:26976265-26976287 CTGCTGGTACAGATGGAATGAGG - Intergenic
1107127285 13:36859284-36859306 CTGCATGTCCAGGTGGTATTTGG - Intronic
1107843739 13:44488859-44488881 CTGAATCTACAGATGAATTTGGG - Intronic
1108300823 13:49073957-49073979 CTGCCTTGACAGATGAAAATAGG - Intronic
1108338226 13:49468620-49468642 CTGAAAGAACAAATGAAATTAGG - Intronic
1108342170 13:49508030-49508052 TTGCATTTATAGATGAATTTGGG + Intronic
1108850977 13:54728601-54728623 CTACAATTAAAGATGAAATTTGG - Intergenic
1109524532 13:63557883-63557905 TTACAAGTAGAGATGAAATTTGG - Intergenic
1109608862 13:64737207-64737229 TTGCATGTATAGATGCAATTGGG + Intergenic
1109940832 13:69361799-69361821 TTGCATGTACAGTAGAGATTGGG + Intergenic
1110170257 13:72491987-72492009 CTACAATTACAGATGAGATTTGG - Intergenic
1110612298 13:77502478-77502500 CTGCAGCTACAGATTAAATTTGG + Intergenic
1111751983 13:92344380-92344402 CTGCAAGTCAAGATGAGATTTGG + Intronic
1111787842 13:92813818-92813840 CTGAATGTACAGATTAATTTAGG - Intronic
1112582921 13:100691860-100691882 CTGCAGTTCAAGATGAAATTTGG - Intergenic
1112857398 13:103787917-103787939 CTGCAATTCAAGATGAAATTTGG + Intergenic
1112921036 13:104613055-104613077 CAGCAAGTACAGGTGAAACTGGG + Intergenic
1115706025 14:35998862-35998884 CTGCATCTGCAGATGAACTTCGG + Intergenic
1115998474 14:39217694-39217716 CTGCAGTTCAAGATGAAATTTGG + Intergenic
1116172409 14:41420337-41420359 CTGCAAATACAGATATAATTGGG - Intergenic
1117879396 14:60296284-60296306 CTGAAAGAACTGATGAAATTGGG + Intronic
1118182009 14:63503168-63503190 CTGTATGTACAGAGGGATTTTGG + Intronic
1118491980 14:66269949-66269971 CTGCAGGTAAAGATGAGATGAGG + Intergenic
1118579611 14:67281265-67281287 AAGCATGTACATATGAAATGTGG - Intronic
1119309606 14:73634718-73634740 GTGCATAAGCAGATGAAATTTGG - Intergenic
1119801159 14:77446517-77446539 TTGAATGTACAGATCAATTTTGG - Intronic
1121796326 14:96738801-96738823 TTACCTCTACAGATGAAATTGGG + Intergenic
1122381728 14:101312055-101312077 CTGAATCTATAGATCAAATTGGG - Intergenic
1123219418 14:106842420-106842442 CTGCAGGCACAGATTACATTTGG - Intergenic
1125056922 15:35370951-35370973 GTGCATGGACAAATGAAATGTGG + Exonic
1125442850 15:39722048-39722070 CTGCAAATACAGTTGAACTTGGG - Intronic
1126695417 15:51321517-51321539 CTAGATGTGCAGACGAAATTAGG - Intronic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1127219680 15:56865795-56865817 ATGAATGTACAGCTCAAATTGGG - Intronic
1127655678 15:61053391-61053413 CTGCCTGTCCAGATGTAATTAGG + Intronic
1128056036 15:64700839-64700861 CTGCATGCAAAGAAGAAATGAGG + Intronic
1130581819 15:85144247-85144269 CTGCATGTACATTTGCAATTTGG - Intergenic
1130815871 15:87432103-87432125 CTGCATTTACAGATGAAGTAAGG + Intergenic
1131737473 15:95349081-95349103 CTTCATGTTCCGATGACATTTGG - Intergenic
1132109210 15:99089967-99089989 GTGCATGTGAAAATGAAATTAGG - Intergenic
1133504726 16:6400029-6400051 CTGCAATTCAAGATGAAATTTGG + Intronic
1134438162 16:14280879-14280901 TTGAATCTACAGATGAATTTGGG - Intergenic
1134468155 16:14497395-14497417 CTGCATCTACAGATTCAAGTTGG + Intronic
1138225030 16:55286247-55286269 CTGAATGTACAAAAGACATTTGG + Intergenic
1138225637 16:55292088-55292110 CTGCAATTCCAGATGAGATTTGG + Intergenic
1140222032 16:73050592-73050614 CTGCACTTACATATGAAATCAGG + Intronic
1140579644 16:76214603-76214625 ATGTAAGTACAGATGAAAATGGG - Intergenic
1140786850 16:78350677-78350699 CTGAATGCATAGATGAAATGTGG - Intronic
1140855248 16:78972160-78972182 CTTCATTTCCAGATGAAACTGGG + Intronic
1141019711 16:80483804-80483826 CTGCAATTCAAGATGAAATTTGG + Intergenic
1145932778 17:28697957-28697979 TTGCAGGCACAGATGAAATAAGG - Exonic
1147584168 17:41643552-41643574 CTCCATGTCCATATGAATTTGGG - Intergenic
1148488805 17:48009850-48009872 CTGCATCTATAGAGGAAACTTGG - Intergenic
1149159078 17:53668456-53668478 CTGCAATTCAAGATGAAATTTGG - Intergenic
1150951751 17:69810385-69810407 CTGAATGTCAAAATGAAATTGGG - Intergenic
1154103040 18:11494187-11494209 CTGCTTCTACAGATGAACTATGG + Intergenic
1155185821 18:23385751-23385773 CTGCATGTTTAGAGGAACTTGGG + Intronic
1155901916 18:31401902-31401924 CAGGATGTACAGATGATAGTTGG - Intronic
1156130361 18:33965514-33965536 CTGCAATTCAAGATGAAATTTGG - Intronic
1157057167 18:44244071-44244093 CTGCATGTACAGAATAAGATTGG - Intergenic
1157333690 18:46721676-46721698 CTGCTGGTACAGATGGAATGAGG - Intronic
1157501722 18:48195280-48195302 CTGCAATTCAAGATGAAATTTGG - Intronic
1159872625 18:73775662-73775684 TTGAATGTACAAATGAATTTGGG - Intergenic
1160110244 18:76021584-76021606 CTGCATCTACATATCACATTAGG - Intergenic
1160472616 18:79151017-79151039 CTGAATCTACAGATCAATTTAGG - Intronic
1164412355 19:28016528-28016550 ATGCTTGCACAGATGAGATTTGG - Intergenic
1164915714 19:32050953-32050975 CTGCAGCTACAGGTCAAATTTGG - Intergenic
1167350771 19:48973036-48973058 CTACATTTTGAGATGAAATTTGG - Intronic
925256243 2:2491045-2491067 CTGCAATTCAAGATGAAATTTGG + Intergenic
925823430 2:7822981-7823003 CTGCATTGACAGGTGAAAATAGG - Intergenic
927736606 2:25528964-25528986 CTGAATCTAAAGATCAAATTGGG - Intronic
929213320 2:39383460-39383482 CTACAATTAAAGATGAAATTTGG + Intronic
929396695 2:41531801-41531823 CTGCATGTACAGCTGAGATCTGG - Intergenic
929767820 2:44864038-44864060 CTGAATCTATAGATCAAATTGGG - Intergenic
930351382 2:50259958-50259980 CTGCATGTACAGATGAAATTGGG + Intronic
931182865 2:59920665-59920687 CTGCATTTGAAGGTGAAATTTGG + Intergenic
931339452 2:61385281-61385303 CTGAATCTATAGATGAATTTCGG - Intronic
931580619 2:63768455-63768477 TTGAATTTATAGATGAAATTGGG + Intronic
931593516 2:63913564-63913586 TTGCATGTACAAAACAAATTCGG + Intronic
932728464 2:74199448-74199470 CTGCAAGTACCGCTGAAATATGG - Intronic
933139240 2:78773618-78773640 CTGCATTTCAAGATGAGATTTGG - Intergenic
933793354 2:85901390-85901412 ATGTATGTAAAGATGAAATTTGG - Intergenic
935287383 2:101577619-101577641 CTGCATGTTCTAATCAAATTTGG + Intergenic
935452008 2:103220686-103220708 CTGCATGTTAAGATGAAGGTTGG - Intergenic
937743563 2:125384837-125384859 CTGAATCTATAGATCAAATTGGG - Intergenic
940274528 2:151925340-151925362 TCACATGTACAAATGAAATTGGG - Intronic
940732600 2:157410654-157410676 CTGAATCTACAGATTAAGTTGGG + Intergenic
941227383 2:162866259-162866281 CTACAAGTAAAGATGAGATTTGG + Intergenic
943437558 2:187885529-187885551 CTGCAATTCAAGATGAAATTTGG + Intergenic
945341420 2:208660471-208660493 ATGCATGTATAGATCAATTTGGG + Intronic
945953198 2:216059956-216059978 CTGAATCTACAGATCAATTTGGG + Intronic
947017327 2:225635730-225635752 CTGCATTTATAGATGGAATTTGG + Intronic
947135198 2:226970445-226970467 CTTCATGTACAGATAAAACTTGG - Intronic
947317545 2:228877892-228877914 CAGCATGTAAAGATGGTATTTGG - Intronic
947510564 2:230749554-230749576 CTGCATGTATAGATAAAGATGGG + Intronic
1169952535 20:11061486-11061508 CTGCATTTACAGAAAAATTTAGG + Intergenic
1170076742 20:12427948-12427970 CTACAATTACAGATGAGATTTGG - Intergenic
1170324814 20:15145177-15145199 CTGTATTCACAGATGACATTTGG + Intronic
1170444594 20:16412749-16412771 CTACAATTCCAGATGAAATTTGG + Intronic
1170788565 20:19489116-19489138 CTGAATGTATAGATTGAATTAGG - Intronic
1172992483 20:39046862-39046884 GTTCATGCACAGATGGAATTCGG + Intergenic
1175043091 20:56074698-56074720 CTGCATGTGCAGATGTTATCTGG + Intergenic
1175601982 20:60281678-60281700 CTGGATGTTCAGAGGAAATGAGG + Intergenic
1177023240 21:15889157-15889179 CTGGATTTATAGATGAATTTGGG - Intergenic
1179198734 21:39193178-39193200 CTGCACCTAAAGAGGAAATTGGG - Intronic
1180003798 21:45009812-45009834 CTGAATGTGCAGATCAATTTGGG + Intergenic
1184278664 22:43425196-43425218 CCGCATGTGCAGATGTAAGTGGG + Exonic
949271585 3:2223831-2223853 CTGCACTTACATATGTAATTAGG - Intronic
949607501 3:5670386-5670408 CTGCATGTAAAGATGGTTTTTGG - Intergenic
950321764 3:12061944-12061966 CTGCATCTACAGATCAAGTTGGG - Intronic
951233808 3:20211191-20211213 CTGCATATAGAAATGATATTGGG - Intergenic
952169056 3:30785255-30785277 TTGAATGTAAACATGAAATTGGG + Intronic
952196202 3:31077807-31077829 CTGAATGTAGAGATGTTATTTGG + Intergenic
953753840 3:45630286-45630308 GTGAATGTACAGGTGAGATTGGG + Intronic
953870543 3:46622851-46622873 CTGCATTTTCATATGAATTTTGG + Intronic
956040768 3:65142909-65142931 AGGCAAGTAAAGATGAAATTAGG - Intergenic
956824595 3:72986058-72986080 CTCCATGTTCAGATGAAAAATGG + Intronic
957206776 3:77208841-77208863 AGGCATGTCCAGATGACATTGGG + Intronic
957953958 3:87160257-87160279 CAGCATGTTGAGATGAAATTGGG - Intergenic
957969994 3:87371081-87371103 ATGAATGTAAAGATGAGATTTGG - Intergenic
959275376 3:104270713-104270735 CTAAATGTACACATGAACTTAGG + Intergenic
959676330 3:109039965-109039987 CTACATGTAGAGAGGAAATTAGG + Intronic
959710574 3:109381921-109381943 CTGAATGTACAAATGAAAAATGG + Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
965723479 3:171687429-171687451 CTGCTTGTAGAGACTAAATTTGG + Exonic
967201072 3:187073079-187073101 CTGCTAGTCCAGATGAAATGGGG - Intronic
970180136 4:13383604-13383626 CTACATTTCCAGATGAGATTTGG - Intronic
971307489 4:25496315-25496337 CTTGATTTACAGATGAAATGAGG - Intergenic
971373891 4:26040709-26040731 CTGCAATTAAAGATGAGATTTGG + Intergenic
971401936 4:26284233-26284255 GAGCATGTTCAGATGAAATAGGG - Intronic
972165428 4:36277856-36277878 CTGAAAGTAAAGATGAACTTAGG - Intergenic
972830089 4:42804522-42804544 TTGAATCTACAGATCAAATTGGG + Intergenic
972883845 4:43460367-43460389 CTTGATGAACAGATGAAATAAGG - Intergenic
973267344 4:48224124-48224146 CTGAATGTACAGGTGGAGTTGGG + Intronic
973643306 4:52924867-52924889 CTGCATTCACAGATGAGATGTGG - Intronic
974475012 4:62367291-62367313 TTGAATCTACAGATCAAATTGGG - Intergenic
974552349 4:63394984-63395006 ATGAATGTACAGATAAAATGTGG + Intergenic
974977010 4:68904507-68904529 CTGCAGGCACAGATTACATTTGG - Intergenic
974988646 4:69059401-69059423 CTGCAGGTACAGATTACATTTGG + Intronic
975048289 4:69829611-69829633 CTGCAGGCACAGATTACATTTGG - Intronic
976180290 4:82392408-82392430 CTGCATGAACAGATGAGTTAAGG - Intergenic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
978263882 4:106798610-106798632 CTGTATGTATAGATTATATTTGG + Intergenic
978271060 4:106891749-106891771 GTGAATGTATAGATCAAATTAGG - Intergenic
978918482 4:114152797-114152819 CTGCTTCTACAGATGAAGTAAGG - Intergenic
979967009 4:127087408-127087430 CTGCAAGTGAAGATGAGATTTGG - Intergenic
980281638 4:130730800-130730822 ATCTATGTACAGATGAAAATCGG + Intergenic
980617486 4:135249891-135249913 CTGCAAGCACAGAGAAAATTAGG - Intergenic
980646481 4:135649226-135649248 CTCCATGAACAGTAGAAATTAGG - Intergenic
980708938 4:136539050-136539072 CTGAAGGTGCAGATGACATTTGG - Intergenic
982150152 4:152445267-152445289 TTACATCTTCAGATGAAATTTGG + Intronic
983282307 4:165696122-165696144 TTGGATGTGCAGAGGAAATTTGG - Intergenic
984571750 4:181403633-181403655 CTACAATTCCAGATGAAATTTGG + Intergenic
987819634 5:22946331-22946353 CTGAATCTACAGAGGAACTTGGG + Intergenic
987847918 5:23311512-23311534 CTGCAATTCAAGATGAAATTTGG + Intergenic
988010706 5:25479115-25479137 CTCCATGAACAGGTGAAGTTGGG + Intergenic
988320477 5:29688473-29688495 CTGCATTTAAAAATAAAATTTGG - Intergenic
989740233 5:44762375-44762397 CTGCATGTGCAGGTGGAATGTGG - Intergenic
991163707 5:63536089-63536111 CTGGATGTTCATAGGAAATTTGG + Intergenic
991537084 5:67681458-67681480 TTGCATTTACAGATTAAATGGGG - Intergenic
992660821 5:78959027-78959049 CTACAATTAAAGATGAAATTTGG - Intronic
993033629 5:82732798-82732820 CTACATTTAAAGATGAGATTTGG + Intergenic
993085116 5:83354452-83354474 ATGTATGTACATATAAAATTTGG - Intergenic
994409825 5:99392797-99392819 CTACAATTAAAGATGAAATTTGG + Intergenic
994483994 5:100372479-100372501 CTACAATTAAAGATGAAATTTGG - Intergenic
994894154 5:105680394-105680416 TTCCATGTACTGATGAAGTTAGG - Intergenic
995511843 5:112918436-112918458 CAGGATGCAAAGATGAAATTGGG - Intronic
996611978 5:125393167-125393189 TTGCATGTGGAGATGAATTTAGG - Intergenic
1000485250 5:161833642-161833664 TGACATCTACAGATGAAATTGGG + Intergenic
1000797406 5:165682281-165682303 CTGCATATACAGCAGAAATAAGG - Intergenic
1002713840 5:181212763-181212785 CTGTAAGAGCAGATGAAATTCGG - Intergenic
1004435349 6:15587321-15587343 TTGCATGTATAGATCAATTTGGG - Intronic
1004678492 6:17868465-17868487 CTGCATGTATATATGAAGTTCGG + Intronic
1004735574 6:18402902-18402924 CTGCATATACAGGAAAAATTGGG + Intronic
1006390487 6:33755311-33755333 CTGCAGGTGCAGATAAAATTAGG + Intergenic
1006952993 6:37840644-37840666 TTGCATCTCCAGATGAATTTGGG + Intronic
1007660008 6:43478126-43478148 CTGAATCTTCAGCTGAAATTGGG - Exonic
1008297701 6:49797925-49797947 CTGCATCTACTGATCTAATTTGG - Intergenic
1010040173 6:71372449-71372471 CTGAATCTACAGATCAACTTGGG + Intergenic
1010882742 6:81200134-81200156 CTGCAATTCAAGATGAAATTTGG - Intergenic
1011707078 6:90012242-90012264 CTGAATCTACTGATGAATTTAGG + Intronic
1012466479 6:99521717-99521739 CTGCATCCACAGATAAAAGTTGG - Intronic
1012580136 6:100857935-100857957 CTGAATCTACAGATCAATTTGGG + Intronic
1014600881 6:123410963-123410985 CTGCTTGTAAATATCAAATTTGG - Intronic
1016453589 6:144209304-144209326 CTGCATGTACAGTTGCCAGTGGG - Intergenic
1019947062 7:4338249-4338271 TTGGATGGACAGATGCAATTTGG - Intergenic
1023903716 7:44505711-44505733 CTGCAAGTCAAGATGAGATTTGG - Intergenic
1024221328 7:47289817-47289839 TTGAATCTATAGATGAAATTAGG - Intronic
1024482405 7:49877609-49877631 CAGCATTTACAGACCAAATTTGG - Intronic
1025170145 7:56749096-56749118 CTGCAATTGAAGATGAAATTTGG - Intergenic
1025701740 7:63826622-63826644 CTGCAATTGAAGATGAAATTTGG + Intergenic
1025769034 7:64486408-64486430 ATTAATGTAAAGATGAAATTTGG + Intergenic
1026171141 7:67954963-67954985 CTGCAATTCAAGATGAAATTTGG + Intergenic
1026276865 7:68887241-68887263 CTGCAAGTAAAGATGAGATTTGG - Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1027501061 7:78951594-78951616 CTGCAAGTCAAGATGAGATTTGG + Intronic
1027609913 7:80347915-80347937 CTGCAATTACAGTAGAAATTAGG - Intergenic
1029977223 7:104846213-104846235 CTGGATTTACAGAATAAATTGGG + Intronic
1031160678 7:118164096-118164118 CTGAATCTACAGATTAATTTAGG + Intergenic
1033060494 7:138101847-138101869 TTGAATCTACAGATGAATTTGGG - Intronic
1035148640 7:156846612-156846634 CTGAATGTATAGATGAAGTTGGG - Intronic
1037979829 8:23244704-23244726 CTGGATCTACAGATCAATTTGGG + Intronic
1038465519 8:27759303-27759325 CTACATTTAAAGATGAATTTAGG + Intronic
1039533294 8:38284118-38284140 CTGCAGTTACAGATGAATTTTGG - Intronic
1039666074 8:39529789-39529811 CTGAATCTACAGATCAATTTGGG - Intergenic
1039949304 8:42155470-42155492 CTGCTTGCAAAGATGAGATTGGG + Intronic
1040605909 8:48930936-48930958 CTGGTTGTACAGATGCAGTTTGG + Intergenic
1041454417 8:58042366-58042388 CATCATGCAGAGATGAAATTAGG + Intronic
1043425955 8:80149130-80149152 CTGCAATTCAAGATGAAATTCGG - Intronic
1043683966 8:83065516-83065538 CTGGCTGTCCAGATGATATTGGG - Intergenic
1044147643 8:88737482-88737504 CTGCATGTACATACAACATTTGG + Intergenic
1044783568 8:95770385-95770407 CTGGATCTGCAGATCAAATTGGG + Intergenic
1045440605 8:102205217-102205239 CAGTATCTACAAATGAAATTTGG + Exonic
1046152752 8:110249749-110249771 CTGCATTCCCAGATGAATTTAGG + Intergenic
1046598911 8:116295093-116295115 ATGCCTATCCAGATGAAATTAGG - Intergenic
1046997924 8:120544984-120545006 TTGCATAAACAGAGGAAATTTGG + Intronic
1048099434 8:131332990-131333012 CTGCATATAGAGGAGAAATTAGG + Intergenic
1048117410 8:131540197-131540219 TTGCATTTCAAGATGAAATTTGG + Intergenic
1048667775 8:136682952-136682974 CTTAATGTGAAGATGAAATTTGG + Intergenic
1049486828 8:142869510-142869532 CTGCTTATACAGATCAAATAAGG + Intronic
1050002146 9:1088700-1088722 TTGAATGTACAGATTAATTTGGG + Intergenic
1050784257 9:9379603-9379625 TTGAATCTACAGATGAAGTTGGG + Intronic
1051469270 9:17417884-17417906 CTACTTGTAAAGATAAAATTAGG + Intronic
1051693668 9:19744639-19744661 CTGGATTTACATATGAAATCTGG + Intronic
1051797910 9:20895382-20895404 TTGAATGTATAGATGAAGTTAGG + Intronic
1051807660 9:21013570-21013592 CTGAATCTACAGATCAATTTGGG + Intronic
1051957211 9:22710851-22710873 CTGCATGTACAGAAAAAAATAGG - Intergenic
1052080304 9:24197944-24197966 CTACAATTAAAGATGAAATTTGG - Intergenic
1056145468 9:83724412-83724434 CTACATGTACTGATGACATTTGG - Intergenic
1056282850 9:85058890-85058912 CTGCATGTAAGCATGAAATAGGG - Intergenic
1057425683 9:94947542-94947564 CTGAATGTAAAAATGAAATATGG - Intronic
1057823738 9:98355648-98355670 CTGAATGTATAGATCAAGTTGGG - Intronic
1059511271 9:114850393-114850415 CTACATGTACAGATGTATTATGG - Intergenic
1061655808 9:132089150-132089172 CTACAAGTAAAGATGAGATTTGG - Intergenic
1062552159 9:137093862-137093884 ATGGATTTACAGATGAATTTAGG - Intronic
1186190877 X:7066515-7066537 CTGCATGTACAGTTCACACTAGG + Intronic
1187562535 X:20416216-20416238 GTGCATGGACAAATGGAATTGGG - Intergenic
1188407741 X:29832669-29832691 CAGCATTTACAGAGGAAATAAGG - Intronic
1189108194 X:38258088-38258110 CTTCATCTAAAGATAAAATTTGG - Intronic
1190149530 X:47932573-47932595 TTGCATCTATAGATAAAATTAGG + Intronic
1194397694 X:93405244-93405266 CTGCAATTCAAGATGAAATTTGG + Intergenic
1194479977 X:94409781-94409803 ATACATGTACAGTTGCAATTTGG + Intergenic
1194532363 X:95067371-95067393 TTGAATCTACAGATAAAATTTGG - Intergenic
1195174607 X:102303515-102303537 CTGCATGTCCAAAATAAATTTGG - Intergenic
1195177443 X:102324462-102324484 CTGCATTTCCACATGAATTTTGG - Intronic
1195181421 X:102362631-102362653 CTGCATTTCCACATGAATTTTGG + Intronic
1195184258 X:102383578-102383600 CTGCATGTCCAAAATAAATTTGG + Intronic
1195209887 X:102644370-102644392 CTGAATTTATAGATTAAATTTGG + Intergenic
1195279189 X:103313526-103313548 CTGAATTTACAGATGAATTTGGG - Intergenic
1195291696 X:103436056-103436078 CTGATTGTGCAGATGAAATCTGG - Intergenic
1195880805 X:109590931-109590953 CTGCATATTCAGCAGAAATTGGG + Intergenic
1196206683 X:112947714-112947736 TGGCATGTACAGAGGAAATGAGG + Intergenic
1196315044 X:114212124-114212146 CTACAAGTCAAGATGAAATTTGG + Intergenic
1196495198 X:116316864-116316886 CTGAAGGTGGAGATGAAATTAGG + Intergenic
1197675012 X:129320000-129320022 CTTCATGCACAGATGACATTTGG - Intergenic
1198420667 X:136468458-136468480 CTGCATCAACATATGAATTTCGG - Intergenic
1199702614 X:150394510-150394532 CTGAATCTATAGATCAAATTGGG + Intronic
1201769611 Y:17606960-17606982 CTGCATGCACAGATGTGTTTGGG + Intergenic
1201831943 Y:18299025-18299047 CTGCATGCACAGATGTGTTTGGG - Intergenic