ID: 930352315

View in Genome Browser
Species Human (GRCh38)
Location 2:50272593-50272615
Sequence AGTAAAAGTAGACTAAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 332}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930352315 Original CRISPR AGTAAAAGTAGACTAAAAGC AGG Intronic
900579133 1:3399825-3399847 AGAAAGAGTAAAATAAAAGCTGG + Intronic
906865943 1:49420141-49420163 AGTAAAAGAAGACCAAAAGTTGG - Intronic
908276070 1:62472499-62472521 AGTAAATGTATACAAAAAGAAGG + Intronic
908288150 1:62631926-62631948 AGTAGAAGAAGACTAAACGCTGG + Intronic
910514943 1:88049823-88049845 AGTAAACGTTGACTAAATGATGG + Intergenic
910554816 1:88519641-88519663 AATAAAAATAAAATAAAAGCAGG + Intergenic
910566484 1:88649237-88649259 ATTAAAAGTAAATTAAAAGGGGG - Intergenic
910685798 1:89914650-89914672 AGTAATAGTAAACAAAAACCAGG - Intronic
911269751 1:95786589-95786611 AGTAAAAGCAAACCAACAGCGGG - Intergenic
911374708 1:97037909-97037931 AGTGAAAGTAAAATAAAAGTTGG - Intergenic
911526671 1:98995900-98995922 AGTAAAAATAACCTAAAAGCTGG + Intronic
912193998 1:107376784-107376806 AGCAAAAGAAGACTGGAAGCTGG - Intronic
913280048 1:117177122-117177144 GGAAAAAGAAGATTAAAAGCGGG + Intronic
913444145 1:118931938-118931960 AACAAAAGGAGACTTAAAGCTGG + Intronic
914985397 1:152451929-152451951 AGAAAGAGTAGAGTAATAGCAGG - Intergenic
915534549 1:156527315-156527337 ACTAAAAATACACAAAAAGCCGG + Intronic
916344414 1:163771700-163771722 AGTAAAAGAAGAGTATAAACAGG + Intergenic
918022372 1:180707641-180707663 AGAAAAAGAAAACTAAAATCAGG - Intronic
918388394 1:184034343-184034365 AGTAAAAATCAACTAAAACCTGG - Intronic
919571617 1:199255967-199255989 AAAAAAAGTAAACAAAAAGCTGG - Intergenic
920424792 1:205866496-205866518 ATACAAATTAGACTAAAAGCAGG - Intergenic
921659209 1:217778804-217778826 ATTAAAAGTATATTAAAAGCAGG - Intronic
921796139 1:219346776-219346798 AGTAAAGGTTAACTAGAAGCTGG + Intergenic
922852320 1:228743655-228743677 AGCCAAAGAAGTCTAAAAGCAGG + Exonic
924555707 1:245116734-245116756 TGTCAAAGTAGCATAAAAGCTGG + Intronic
924867474 1:248000781-248000803 AGTTAAAGTACATTAAAAACAGG + Intronic
1063047829 10:2411425-2411447 ACTAAAAATAGAATATAAGCCGG - Intergenic
1065395124 10:25228042-25228064 AGTAGAAGTAGAGAAAAAACAGG - Intronic
1066400029 10:35067391-35067413 AGTAAAAGTAAACTAGAACAGGG + Intronic
1066574405 10:36809828-36809850 AGTGAAAAGTGACTAAAAGCAGG + Intergenic
1066754345 10:38695746-38695768 AGTAATAGAAGACTAAAAAAAGG + Intergenic
1066958218 10:42193215-42193237 AGGAAATGCAGACCAAAAGCAGG - Intergenic
1068173529 10:53426302-53426324 AGTAAATTTAAACTAAAAGTCGG + Intergenic
1068622098 10:59197613-59197635 TGTTAAAGAAGAGTAAAAGCAGG - Intronic
1069064123 10:63924727-63924749 AGGAAAAGTAGAATAAACTCAGG - Intergenic
1069482739 10:68798417-68798439 AGTAAAATTAGACTGTATGCAGG - Intergenic
1070266872 10:74911562-74911584 ACAGAAAGTAGACTAAAGGCTGG - Intronic
1070345870 10:75541301-75541323 ATTAAAAGCAAACTAAAAACAGG + Intronic
1071031719 10:81192777-81192799 AGTAACAGCAGATTTAAAGCAGG - Intergenic
1071672821 10:87625914-87625936 AGTAAAAGTTTACTTAAAACAGG - Intergenic
1071898224 10:90087785-90087807 AGTAACAGCAGATTTAAAGCAGG - Intergenic
1072457742 10:95591648-95591670 AATAAAAGTAGAGAAAGAGCAGG - Intergenic
1073040857 10:100604249-100604271 ATGAAAAGAAGACTCAAAGCTGG + Intergenic
1074403660 10:113162927-113162949 AGGAAAAGTTGAGTAAAAGGGGG - Intronic
1076998973 11:313091-313113 AGTAACAGCAGACTTAAAGCAGG + Intronic
1077558977 11:3245098-3245120 AGTAACAGCAGATTTAAAGCAGG + Intergenic
1079193485 11:18302803-18302825 AGTCAAAGGAGAAAAAAAGCGGG + Intronic
1080686526 11:34520197-34520219 AGTAAGAGCAGAATCAAAGCTGG - Intergenic
1080783410 11:35452268-35452290 AGTATTAGTAAACTAAAAGATGG + Intronic
1081155600 11:39685751-39685773 ACAAAAAGTAGAATAAAAGAGGG - Intergenic
1081174847 11:39914537-39914559 AATAAGAATAGACTAAAAGTGGG + Intergenic
1082737090 11:56867417-56867439 AGTAACAGCAGATTTAAAGCAGG - Intergenic
1083445767 11:62707165-62707187 AGAAAAGGTAGACCAAAAGGAGG - Exonic
1087025516 11:93645516-93645538 AGTGAAAGTAGAATGAAGGCTGG - Intergenic
1088008620 11:104972431-104972453 AGTAATGGTAGATTTAAAGCAGG + Intergenic
1089570439 11:119404629-119404651 AGTAAAAGGAGAGTAAAACTAGG - Intergenic
1089673956 11:120076848-120076870 AGTAAAAGTAGAGAGAATGCCGG + Intergenic
1090067651 11:123517339-123517361 AGAAAAAGTAGATTAGGAGCAGG + Intergenic
1093166417 12:15808823-15808845 TGGAATAGTAGACTCAAAGCTGG - Intronic
1093557948 12:20499912-20499934 AGTAAAATTAGAATAATAGTAGG - Intronic
1094823174 12:34243404-34243426 AATAAAAATAGAATACAAGCTGG + Intergenic
1095219090 12:39587299-39587321 TGCAAAAGTAGACTTACAGCAGG + Intronic
1095268817 12:40192546-40192568 AGTAACAGCAGATTTAAAGCAGG + Intergenic
1095571932 12:43693272-43693294 ACAAAAAGAAAACTAAAAGCAGG + Intergenic
1095650417 12:44601500-44601522 AGTAAAATTATACTTAAAACTGG + Intronic
1096934658 12:55258230-55258252 AGTATAGGTAGAGAAAAAGCTGG + Intergenic
1098122669 12:67257939-67257961 AGTAACAGTAGATTTAAAGCAGG - Intergenic
1098218607 12:68245255-68245277 AGTAACAGCAGATTTAAAGCAGG + Intergenic
1098831284 12:75366349-75366371 AGTAACAGCAGATTTAAAGCAGG + Intronic
1098891308 12:76012764-76012786 AGTAAAATGAGATTCAAAGCTGG + Intergenic
1099149457 12:79090929-79090951 AGGAAAAGAAGACTAAAGACAGG - Intronic
1100421554 12:94439226-94439248 AGATAAATTAGACAAAAAGCTGG + Intronic
1100511832 12:95282879-95282901 TGGAAAAGTAGGCTAAAAGCAGG + Intronic
1101396513 12:104353418-104353440 TGTAACAGAAGACTAACAGCAGG + Intergenic
1101426756 12:104594557-104594579 AGAAAAAGCAAAATAAAAGCGGG - Intronic
1101815968 12:108146517-108146539 AGAAAAAGAAAACTAAAACCTGG + Intronic
1103187694 12:118975190-118975212 AGTAAAAGTTCAGTAAATGCTGG - Intergenic
1103248227 12:119476750-119476772 AGTAAAAGGAGGCTATGAGCTGG - Intronic
1105021495 12:132819606-132819628 AGAAAAACCAGAATAAAAGCAGG + Intronic
1105299981 13:19124757-19124779 AGTAAAAGTATAGTAAAGACGGG + Intergenic
1106151790 13:27111123-27111145 AATAAAAGAAGACTAATGGCAGG - Intronic
1106276008 13:28207369-28207391 TGAAAAAGAAGACTAGAAGCAGG - Intronic
1106671063 13:31905789-31905811 AGTAAGTGTAGAGTAAAATCAGG - Intergenic
1107072609 13:36287187-36287209 AGTAACAGCAGATTTAAAGCAGG - Intronic
1107819310 13:44272016-44272038 AGGAAAAGTGGACTAAATTCAGG - Intergenic
1108955167 13:56144653-56144675 AGACAAAGTAGCCTAAAAGCTGG + Intergenic
1109244989 13:59943348-59943370 AGTAACAGTGGTCTAGAAGCAGG - Intronic
1109494736 13:63154165-63154187 AGTAAAAGTAAATTAAAATATGG + Intergenic
1109712375 13:66178339-66178361 AGTACAGCTAGAATAAAAGCAGG - Intergenic
1110050900 13:70897756-70897778 AGTACAAGTGGACAAAAAGAAGG - Intergenic
1110357240 13:74581239-74581261 AATAAAAGTAGAATAAAATGTGG + Intergenic
1110805705 13:79751811-79751833 AGCAAAAGCATACTAAAAACGGG - Intergenic
1111381659 13:87461937-87461959 AGGAAAAGGACACTAAAAGAAGG - Intergenic
1114303425 14:21398774-21398796 AATAAAAGTAGAGTATAAGAAGG - Intronic
1114575012 14:23705353-23705375 AGTAACAGCAGATTTAAAGCAGG + Intergenic
1114890255 14:26911938-26911960 ATTTAAAGTGGACTTAAAGCAGG - Intergenic
1115956314 14:38784044-38784066 ATTAAAAGTAAAACAAAAGCCGG + Intergenic
1116137410 14:40946301-40946323 AGAAAAAGTAAACTAACAGAAGG + Intergenic
1117088362 14:52224267-52224289 AGTAACAGCAGATTTAAAGCAGG - Intergenic
1117997929 14:61495608-61495630 AGTAAAAGAAGAATAAAGACAGG + Intronic
1120227345 14:81805691-81805713 AGTAAAAGTAAAGTTAGAGCTGG - Intergenic
1120434533 14:84464294-84464316 AATAAAAGTAAACCAAAAGAAGG + Intergenic
1120456249 14:84734091-84734113 AGTAAATGTAGAATAAATGATGG - Intergenic
1120633914 14:86927587-86927609 AGTAAAAGGAGACTACTAGAGGG - Intergenic
1120654769 14:87176794-87176816 AGTACAGCTAGAATAAAAGCAGG + Intergenic
1121160893 14:91738941-91738963 AGTAAAAGTAGACTTTAAAAAGG - Intronic
1122949670 14:105035123-105035145 AGTAACAGCAGACTTAAAGCAGG - Intergenic
1123735949 15:23182479-23182501 AGTAAAATTAGACTTAAAGTAGG - Intergenic
1123820582 15:24026877-24026899 AGTGAAAGCAGATTTAAAGCAGG + Intergenic
1123951242 15:25278148-25278170 AATAAAATTAGATTAAAATCTGG - Intergenic
1124012284 15:25848658-25848680 TGTAAAAGTGGAAGAAAAGCGGG - Intronic
1124196132 15:27631478-27631500 AGTAAAAGTGAATTAAAAGGTGG + Intergenic
1124286663 15:28405461-28405483 AGTAAAATTAGACTTAAAGTAGG - Intergenic
1124296040 15:28506175-28506197 AGTAAAATTAGACTTAAAGTAGG + Intergenic
1124870595 15:33538243-33538265 AGTAAAAGCTGACTAGAAGCTGG + Intronic
1124884109 15:33668356-33668378 ATTAAAAGCTGACCAAAAGCTGG + Intronic
1125915581 15:43484415-43484437 ATTAAGAATAGACTGAAAGCAGG - Intronic
1126879865 15:53083004-53083026 AGTAAAAGTAGGCTAGTTGCTGG - Intergenic
1131155374 15:90072110-90072132 AGGAAAATTAGGATAAAAGCTGG - Intronic
1132422422 15:101683067-101683089 AGTAAAAATAAAACAAAAGCTGG - Intronic
1133931691 16:10238061-10238083 GGTTAAAGTAGACGAATAGCAGG - Intergenic
1134320949 16:13162146-13162168 AGTAAAAGTAGCCAGAAAGGTGG + Intronic
1135648180 16:24181871-24181893 AGTAAAAGCATACAAAAATCTGG + Intronic
1136728338 16:32381101-32381123 AGTAATAGAAGACTAAAAAAAGG - Intergenic
1137325895 16:47436977-47436999 AGTAAAAGTAGGCTAATAAAGGG + Intronic
1138895025 16:61193735-61193757 AGTAGTAGTAGAACAAAAGCAGG + Intergenic
1139892181 16:70260396-70260418 AGTAAGAGTAGCTTAAAACCAGG - Intronic
1202998100 16_KI270728v1_random:136653-136675 AGTAATAGAAGACTAAAAAAAGG + Intergenic
1142481918 17:224284-224306 AGGAAAAGTAGACAAAGGGCAGG - Intronic
1145163842 17:20595647-20595669 AGAAAACGTAGACTCAAATCAGG - Intergenic
1145795787 17:27654676-27654698 GGTAAATGCAGCCTAAAAGCTGG - Intergenic
1149178610 17:53905654-53905676 ATTAAAAGGAAACTAAAGGCTGG - Intergenic
1149291124 17:55218574-55218596 TGCAAAAATAGACTAAAAGCTGG - Intergenic
1150967066 17:69983275-69983297 ATTAAATGAAGACTAAGAGCAGG + Intergenic
1151017806 17:70577353-70577375 ATACAAATTAGACTAAAAGCAGG + Intergenic
1151061969 17:71105361-71105383 AGTAAATGGTAACTAAAAGCTGG + Intergenic
1155001305 18:21689687-21689709 AGTAAATTCTGACTAAAAGCTGG + Intronic
1155155025 18:23150674-23150696 ACTATAAGTAGACTAAACTCTGG + Intronic
1155469319 18:26173850-26173872 ATAAAAAGTAGACAAAAGGCCGG - Intronic
1155593992 18:27461329-27461351 AGTAAAATTAGACTGACAGCTGG + Intergenic
1157737311 18:50061538-50061560 AGTAGAAGTAGGCTAGAAGTAGG - Intronic
1157757694 18:50233116-50233138 AGTAACAGCAGATTTAAAGCAGG - Intronic
1157769848 18:50336447-50336469 AGTAACAGCAGATTTAAAGCAGG + Intergenic
1158085622 18:53648207-53648229 AATAAAAATAGAAAAAAAGCCGG - Intergenic
1158134298 18:54189520-54189542 CTTAAAAGTATACAAAAAGCTGG - Intronic
1158201331 18:54944613-54944635 ACCAAAAGTATACTAAAACCTGG + Intronic
1158682534 18:59581615-59581637 AGGAAAAGAAGAATAAAAGGGGG + Intronic
1158852092 18:61504703-61504725 AGAAAAACTAAACTAAAAGGAGG + Intronic
1159306618 18:66651747-66651769 AGTTTAAATAGACAAAAAGCTGG - Intergenic
1159740834 18:72167973-72167995 ATTAAATCTAGACTAAAAGTTGG + Intergenic
1159751704 18:72310783-72310805 ATTAAAAGTAGACTAAAGATGGG + Intergenic
1160101607 18:75924576-75924598 AGGAAAATTTGACTGAAAGCCGG + Intergenic
1160693579 19:471602-471624 TTTAAAAGTAGCCGAAAAGCTGG - Intronic
1161774292 19:6250239-6250261 AGTAAAAACAGACAAAAAACAGG + Intronic
1163606737 19:18280067-18280089 AGTAAAAGTAAAGGAAAGGCAGG + Exonic
1165184382 19:34004219-34004241 AGTAAAAGTAAACTAAAATGTGG - Intergenic
1165348363 19:35262867-35262889 AATAAAAATAAACTAAAAGTTGG - Intronic
928340799 2:30441589-30441611 AATAAAAATACACAAAAAGCAGG + Intergenic
928756096 2:34527355-34527377 AATAAAGGTAAACTTAAAGCAGG - Intergenic
929647709 2:43645562-43645584 TGTAAAAGTAGAATAAATACAGG + Intronic
930352315 2:50272593-50272615 AGTAAAAGTAGACTAAAAGCAGG + Intronic
930808664 2:55518539-55518561 AATAAAAATAGACTAAAGGATGG + Intergenic
931227367 2:60343024-60343046 GGAAAAAGAAGAATAAAAGCTGG + Intergenic
931402389 2:61943076-61943098 AGTAACAGCAGACTTAAAGCAGG + Intronic
932324736 2:70850693-70850715 AGTAATCCTAGACTTAAAGCTGG + Intergenic
933122192 2:78552672-78552694 AGTTCAAGAAGACTTAAAGCAGG + Intergenic
933659246 2:84913948-84913970 AGTAAATGTAGAGTAAAGCCAGG - Intergenic
934306332 2:91825623-91825645 AGGAAATGCAGACCAAAAGCAGG - Intergenic
934326924 2:92027119-92027141 AGGAAATGCAGACCAAAAGCAGG + Intergenic
934465301 2:94257674-94257696 AGGAAATGCAGACCAAAAGCAGG + Intergenic
935456756 2:103278550-103278572 GGTAAAAGTAAAATAAATGCAGG + Intergenic
936554939 2:113487864-113487886 AGTACAAGCAGACTAAAAAAAGG - Intronic
937204971 2:120230292-120230314 ATTAAAAGTCAACTAAAAACAGG + Intergenic
940050131 2:149453581-149453603 TGTAAAAGTAAAGAAAAAGCTGG + Intronic
940062024 2:149582373-149582395 AGTAAAAGTAGAATAAATGTTGG - Intronic
941304811 2:163850686-163850708 ATAAAAACTAGACTAAAGGCCGG + Intergenic
942948773 2:181699569-181699591 AGTAGGAGTAAACTAAAAGTCGG + Intergenic
943114923 2:183656638-183656660 AGTAAAAGTATAATTAAAGAGGG - Intergenic
943787434 2:191893800-191893822 AGGAAAAGAAGAATAAAAGCTGG - Intergenic
943870311 2:192987884-192987906 AGTAAAAATTCACTCAAAGCTGG - Intergenic
943969729 2:194388316-194388338 ATTCAAAATATACTAAAAGCAGG - Intergenic
944021533 2:195111128-195111150 AGCAAAGCTAGAATAAAAGCAGG + Intergenic
944748238 2:202679821-202679843 AGTAAAAAATGACTAGAAGCAGG + Intronic
944875032 2:203954619-203954641 AGAAAAAGTAAACAAAAATCTGG + Intronic
946119677 2:217498910-217498932 AGTAAAAAAAGAATGAAAGCAGG - Intronic
946898800 2:224352920-224352942 AGTAAAATTAAAATAAAAGAGGG + Intergenic
947273760 2:228368655-228368677 AGTAACAGTAGATTCTAAGCAGG - Intergenic
948240376 2:236427684-236427706 AGAAAAAGTAAACTAAGAGTTGG - Intronic
948688946 2:239690173-239690195 AGAAAAATTATCCTAAAAGCCGG + Intergenic
1169567795 20:6874493-6874515 AGTAAAAGTAAAATAAGAGCAGG - Intergenic
1169588255 20:7111555-7111577 AGTAAAAGTATATTTAAAGTAGG + Intergenic
1169647715 20:7832480-7832502 ATTAAAAGTAGAAAAAAAACGGG - Intergenic
1169926906 20:10793389-10793411 AGCAAAATTAGAATAAAAGAAGG - Intergenic
1170588985 20:17756886-17756908 AGTCAAAGAAGAGTAAAAGAAGG - Intergenic
1172860474 20:38046185-38046207 AGGGAAAGGAGACTAAAAACAGG + Intronic
1174481876 20:50837110-50837132 TGTAAAATGAGACTAATAGCAGG - Intronic
1174996046 20:55569494-55569516 ATTAAAAATAAAATAAAAGCAGG + Intergenic
1177314470 21:19439017-19439039 TGTAAAAGTAGACACAAAGTGGG + Intergenic
1177846399 21:26292891-26292913 AGTATAATTAAAATAAAAGCGGG + Intergenic
1177938671 21:27381958-27381980 AGTAAATGAAGACAAAAAGAAGG + Intergenic
1179224249 21:39439461-39439483 ATTAAAATGAGACTAAAAGCAGG + Intronic
1179396847 21:41047998-41048020 AGGAAAAGGAGAGAAAAAGCTGG + Intergenic
1180279235 22:10678330-10678352 AGGAAATGCAGACCAAAAGCAGG + Intergenic
1180586450 22:16896865-16896887 AGGAAATGCAGACCAAAAGCAGG + Intergenic
1182292394 22:29291096-29291118 AGTCACAGTATAATAAAAGCAGG - Intronic
1182873413 22:33668809-33668831 GCTAAATGTATACTAAAAGCAGG - Intronic
951727960 3:25781303-25781325 AGTAAAAGTATACTGCAAACAGG + Intronic
954261345 3:49441145-49441167 AGTGAAAATAGACTCAAATCAGG - Intergenic
956072700 3:65471478-65471500 AGTAAAGGTAATCTGAAAGCTGG + Intronic
956966164 3:74463367-74463389 AGTGAAAGAAGATTAAAAGCTGG + Intronic
957435471 3:80169262-80169284 AGAAAAAGTAAACTAAAAGATGG + Intergenic
959374267 3:105568689-105568711 GGTCTAAGTAGACCAAAAGCTGG - Intronic
959578427 3:107960207-107960229 AAGAAAAGCAGACTAAAAGCAGG - Intergenic
960461365 3:117939844-117939866 AGTAAAAGTGCACTAAAATCTGG - Intergenic
960723808 3:120650219-120650241 AGTAACAGCAGATTTAAAGCAGG - Intronic
960914833 3:122684635-122684657 AGTAAAAGGAGTATAAAAGAAGG - Intronic
961322627 3:126086322-126086344 AGTAAAAGCAGATTTAAAGCAGG - Intronic
962788118 3:138786104-138786126 AATAAAAGTAAAATAAAATCAGG + Intronic
962862803 3:139420068-139420090 AGAAAAAGTGGACTAGAAGATGG + Intergenic
963911980 3:150822733-150822755 AGTAACAGCAGATTCAAAGCAGG + Intergenic
963927810 3:150969624-150969646 AATAAAAATATACTATAAGCAGG - Intronic
964621020 3:158720205-158720227 AGAAAAGGAAGAATAAAAGCTGG + Intronic
965127150 3:164646241-164646263 AGAAAAAATAGAATAAAAGCAGG + Intergenic
965457086 3:168915144-168915166 AGAAAAAGTAAAATATAAGCAGG - Intergenic
965569641 3:170158948-170158970 AATAAAAGTAAAATAAAATCTGG + Intronic
972501768 4:39684512-39684534 CGCAAAAGAAAACTAAAAGCTGG - Intergenic
974776447 4:66489279-66489301 AGCAAAAGTAAATTAAAAGTGGG + Intergenic
976042552 4:80905326-80905348 AGTAAGCGTAGTCTAACAGCTGG - Intronic
976241749 4:82965387-82965409 AGTAACATTAGATTCAAAGCTGG + Intronic
976955254 4:90889209-90889231 AGTAAAAGTAAAATAATAGCAGG - Intronic
977950109 4:102961274-102961296 AGTAATAGAAGACTAAAAAAAGG + Intronic
978037342 4:104011378-104011400 AGTCCAAGTGGACTGAAAGCAGG + Intergenic
978808457 4:112824796-112824818 AATAAAAATATGCTAAAAGCAGG - Intronic
979442846 4:120772432-120772454 TGCAAAAGTAGAGTCAAAGCTGG + Intronic
979743823 4:124183972-124183994 AGAAAATATAGTCTAAAAGCAGG - Intergenic
981152176 4:141391868-141391890 AGAAAAGGTGGACTAAAAGATGG + Intergenic
982515383 4:156340735-156340757 AGGCAAAGTAAACTAGAAGCAGG + Intergenic
982623547 4:157734615-157734637 AGTGGATGAAGACTAAAAGCTGG + Intergenic
982929178 4:161380580-161380602 AGCAGAAGTAGTTTAAAAGCAGG + Intergenic
984148940 4:176101549-176101571 GGTAAAAGTAGACAACATGCAGG + Intronic
984864848 4:184272600-184272622 AGTAAAAGAAACATAAAAGCAGG - Intergenic
986207321 5:5637229-5637251 AATAAAACTAGATTAAAACCAGG - Intergenic
987124156 5:14795550-14795572 TGCAAAAGCAGATTAAAAGCTGG + Intronic
987268563 5:16280990-16281012 AGTAAAATTGGACTAAGAGGTGG - Intergenic
988533976 5:32049799-32049821 AGTAAAAGCAGAGAAAAAACTGG + Intronic
989802287 5:45558017-45558039 AGCAAAAACAGACCAAAAGCTGG + Intronic
990729623 5:58794321-58794343 AAGAAAAGTAGAAAAAAAGCTGG + Intronic
990875249 5:60476929-60476951 TGTAAAAGTAGACAAAATGGAGG - Intronic
991591136 5:68252462-68252484 AGAAAAAGTAGAATAAAATGTGG + Intronic
991678522 5:69113797-69113819 AGTAATAGAAGAATAAAAACTGG - Intronic
992539968 5:77755160-77755182 AGTAGCAGCAGACTTAAAGCAGG + Intronic
993435913 5:87893945-87893967 AGTAAAAGTTGACAAGAAGATGG - Intergenic
994141620 5:96347775-96347797 AGCAAAAGTGAACTAAAACCAGG + Intergenic
995412730 5:111877065-111877087 AGTAATATCAGAGTAAAAGCAGG - Intronic
996812816 5:127538442-127538464 TGTAATAGAAAACTAAAAGCTGG - Intronic
997287272 5:132689445-132689467 AGAAAAATAAGACTATAAGCAGG + Intergenic
999277002 5:150338185-150338207 TGTAAAAGCAGACTAATAACTGG - Intronic
999526324 5:152410200-152410222 ACTAAAAGTTAATTAAAAGCTGG - Intronic
999616861 5:153434011-153434033 AGTAAAAATAGACCAATAGGAGG - Intergenic
1001167985 5:169389049-169389071 AGTAAAAGTAGGATAAAAGATGG + Intergenic
1001378653 5:171287326-171287348 ACTAAAAATAGAAAAAAAGCTGG + Intronic
1001519176 5:172378508-172378530 AGTTAAAGTAGAAGAAAATCTGG + Intronic
1001827659 5:174758864-174758886 AGTTACAGTTAACTAAAAGCTGG - Intergenic
1002030935 5:176429845-176429867 AATAACAGTAGACTTAAAGCAGG + Intergenic
1003335869 6:5171731-5171753 AGCAAAAGTATACAAAATGCAGG + Intronic
1006696637 6:35936335-35936357 TGTTAAAGTAGAGTAAAAGATGG - Intergenic
1007146518 6:39639544-39639566 AGCAAAAATATACTGAAAGCAGG - Intronic
1008832807 6:55788756-55788778 AGGAAAATTAGATTAAAATCTGG - Intronic
1008970628 6:57363658-57363680 CTTAAAAGGAGACTAAGAGCAGG - Intronic
1009736537 6:67683764-67683786 AGTAACAGCAGATTTAAAGCAGG + Intergenic
1010355654 6:74929609-74929631 TGAAACAGTAGACTAAAAGATGG + Intergenic
1011309322 6:85964558-85964580 AAAAAAAGGAGACTAAAAACAGG - Intergenic
1012009276 6:93760394-93760416 AGGAAAAGTGGATTTAAAGCAGG - Intergenic
1012301651 6:97596203-97596225 GGTAAAAGTACAAAAAAAGCAGG + Intergenic
1013349615 6:109293479-109293501 AGGAAAAGAAGACCAGAAGCTGG + Intergenic
1013707866 6:112860493-112860515 GGAAAAAGTAGACAAAATGCAGG + Intergenic
1014296462 6:119624603-119624625 AGAAAAAGCAGACTAAAAAATGG - Intergenic
1014610203 6:123533883-123533905 AGGAAAATTAGACTAAAAAATGG + Intronic
1014799191 6:125759106-125759128 CGTCAAAGTAGCCTAAAAGTGGG - Exonic
1014962598 6:127705608-127705630 AGGAAAAGTAAACTAATACCTGG - Intergenic
1015185101 6:130407031-130407053 AGGAAAACTACACTAAAATCAGG - Intronic
1017244399 6:152207006-152207028 AGTAAAAGTAGAATGGAAGAAGG + Intronic
1019087620 6:169495396-169495418 ACTAAAAGTAAACTAAATCCAGG + Intronic
1020197278 7:6051048-6051070 AGTAAGAGAAGAATAAGAGCAGG + Intronic
1022677908 7:32516991-32517013 AGTAACAGCAGACTTAAAGCAGG - Intronic
1023668135 7:42546922-42546944 AGTAACAGTGGATTTAAAGCAGG + Intergenic
1023776574 7:43613540-43613562 GTTAAAAGTAGACTAGAAGAAGG + Intronic
1024091419 7:45944725-45944747 CGGAAAAGTAGCCTAAAAGGAGG - Intergenic
1024122982 7:46263942-46263964 ACTAAAAGTAAACCAAAAGCAGG + Intergenic
1024614814 7:51102519-51102541 AGTAAAAGGTGATTAAATGCTGG + Intronic
1029915321 7:104203051-104203073 AGTATAAGTAGAAGAAAACCTGG + Intronic
1029924542 7:104301915-104301937 AGAAACAGTAGACTCAAAGAAGG + Intergenic
1030122035 7:106119555-106119577 AGTAACAGCAGATTTAAAGCAGG + Intergenic
1030151892 7:106415011-106415033 AGAAAAAACAAACTAAAAGCTGG - Intergenic
1030994791 7:116347007-116347029 ATTAAAAATAATCTAAAAGCTGG - Intronic
1031100673 7:117476339-117476361 AGTAAAAGTAAACTAGAATCTGG + Intronic
1031797026 7:126187553-126187575 AATAGAAGAAGACTAAAAGATGG + Intergenic
1033052272 7:138016138-138016160 AGTAACAGCAGATTTAAAGCAGG - Intronic
1033490962 7:141843100-141843122 ATTAACAGTAGATTCAAAGCAGG - Intergenic
1033812332 7:145030617-145030639 AGGAATAGAAGACTAAAAGAGGG - Intergenic
1035777669 8:2201656-2201678 AGTAAGACTAGAATAAAATCAGG - Intergenic
1038892661 8:31744200-31744222 AGGACAAGTAGACAAACAGCTGG - Intronic
1043803503 8:84642478-84642500 AGTAACAGCAGATTTAAAGCAGG + Intronic
1045256248 8:100525421-100525443 TGAGAAAGTAGACTAGAAGCTGG - Intronic
1046030585 8:108778718-108778740 ATCAAAATTAGATTAAAAGCAGG + Intronic
1046048592 8:108993031-108993053 AGGAGGAGGAGACTAAAAGCAGG + Intergenic
1046914835 8:119668721-119668743 AGTAAAAGAAGTCTAGAGGCTGG - Intronic
1047570754 8:126096053-126096075 AGTAACAGCAGATTCAAAGCAGG - Intergenic
1048288353 8:133160476-133160498 AGGAAAGGAAGACAAAAAGCAGG + Intergenic
1049898068 9:129320-129342 AGTACAAGCAGACTAAAAAAAGG + Intronic
1050135890 9:2463880-2463902 AGGCAAAGTAGACTAAATTCTGG + Intergenic
1050176015 9:2869996-2870018 AGTTGAAGTTGACTAAAAGCTGG - Intergenic
1050262819 9:3859008-3859030 AGAAATAGTAAACTAAAATCAGG + Intronic
1050935582 9:11391240-11391262 AGGAAAAGGAGAATAAAAGTAGG + Intergenic
1052164471 9:25307662-25307684 ATTATAAATAGATTAAAAGCAGG - Intergenic
1052884313 9:33628904-33628926 AGAAAAAAAAAACTAAAAGCAGG + Intergenic
1053695365 9:40634458-40634480 AGGAAATGCAGACCAAAAGCAGG + Intergenic
1053765857 9:41397367-41397389 AGAAAAAGTTGACTAAAAAATGG - Intergenic
1053942360 9:43265499-43265521 AGGAAATGCAGACCAAAAGCAGG + Intergenic
1054306609 9:63433684-63433706 AGGAAATGCAGACCAAAAGCAGG + Intergenic
1054405351 9:64757673-64757695 AGGAAATGCAGACCAAAAGCAGG + Intergenic
1054438975 9:65243162-65243184 AGGAAATGCAGACCAAAAGCAGG + Intergenic
1054491431 9:65778780-65778802 AGGAAATGCAGACCAAAAGCAGG - Intergenic
1055633454 9:78248517-78248539 ATTAAAAACAGACGAAAAGCTGG - Intronic
1055887018 9:81075469-81075491 AGTAAAGGTAGGCTAAAAGGGGG - Intergenic
1056014609 9:82370638-82370660 ATTAAAAGTAGAATGAAATCTGG + Intergenic
1057253959 9:93527925-93527947 GGTAGAAGTAGAAGAAAAGCAGG - Intronic
1057566507 9:96169824-96169846 AATAAAGGGAGACTTAAAGCTGG - Intergenic
1057909975 9:99012456-99012478 TGTAACAGCAGACTTAAAGCAGG + Intronic
1058515961 9:105776198-105776220 AAAAAAAGGAGACAAAAAGCTGG + Exonic
1058972048 9:110092833-110092855 TGAGAAAGTAGAATAAAAGCCGG - Intronic
1059795689 9:117694080-117694102 AGTAAAAATAGACTAAAGGAAGG - Intergenic
1059795833 9:117695653-117695675 AATTAAAGTAAACTAAAAGATGG - Intergenic
1059806511 9:117806856-117806878 TGTTAAACTAGACTAAAGGCAGG - Intergenic
1060198139 9:121636317-121636339 GCTAAAAGGAGAATAAAAGCAGG - Intronic
1060386816 9:123238020-123238042 TGTAAAATGAGAATAAAAGCAGG + Intronic
1202777809 9_KI270717v1_random:8074-8096 AGGAAATGCAGACCAAAAGCAGG + Intergenic
1186855017 X:13618113-13618135 AATGAAAGAAGACAAAAAGCCGG + Intronic
1188326046 X:28802278-28802300 AGCAAAAATAGACTAAAACATGG - Intronic
1188904661 X:35778023-35778045 AGTAACAGCAGACTTAAAGCAGG + Intergenic
1188983967 X:36753167-36753189 AGGAAAAGTAGAAAAAAAGTAGG - Intergenic
1189080883 X:37971597-37971619 AGTAACAGCAGATTTAAAGCAGG + Intronic
1189506852 X:41619672-41619694 AGTAAAAATAAACCAAAAGGAGG + Intronic
1190102535 X:47532859-47532881 AGAAAAAATAAAATAAAAGCCGG + Intergenic
1190193912 X:48300664-48300686 ATAAAAAGTAGATTAAGAGCGGG - Intergenic
1190541687 X:51484059-51484081 AGTAACAGCAGATTTAAAGCAGG + Intergenic
1190561822 X:51694099-51694121 AATATAAGTCTACTAAAAGCAGG - Intergenic
1190660424 X:52649323-52649345 ATAAAAAGTAGATTAAGAGCGGG - Intronic
1190788564 X:53677909-53677931 AGTAAATGGTGACTAAAAGTAGG - Intronic
1191879044 X:65826296-65826318 AAAATAAGTAGACAAAAAGCTGG + Intergenic
1192614394 X:72603701-72603723 ATTAAAAGTAGACTACATGCAGG + Intronic
1193538930 X:82747130-82747152 AGTAACAGAAGATTTAAAGCAGG + Intergenic
1193709511 X:84862330-84862352 AGTAACAGCAGATTTAAAGCAGG + Intergenic
1193974200 X:88097650-88097672 AGTAACAGCAGATTTAAAGCAGG + Intergenic
1194104459 X:89751966-89751988 AGTAACAGCAGATTTAAAGCAGG + Intergenic
1194205272 X:91003691-91003713 AGTAAGAGCAGATTTAAAGCAGG - Intergenic
1195541724 X:106069726-106069748 AATAGGAGTAGACTAAAACCAGG - Intergenic
1195546811 X:106122465-106122487 AGTAATAGCAGATTCAAAGCAGG + Intergenic
1196407928 X:115384971-115384993 AGTAAAAGAATACAAAAAGATGG - Intergenic
1196884521 X:120230210-120230232 AGTAACAGCAGACTTAAAGCAGG - Intergenic
1198178369 X:134179245-134179267 AGTAAAAATTGACTAAATGTAGG - Intergenic
1198688086 X:139249001-139249023 GGGAAAAGAAGACAAAAAGCAGG + Intergenic
1198705277 X:139442049-139442071 ATTAAAAGTAGATTATTAGCAGG - Intergenic
1198721595 X:139627388-139627410 AGTAAAATAAGACTTAAGGCAGG - Intronic
1199596049 X:149506591-149506613 AGCAACAGTTGACAAAAAGCTGG + Intronic
1199643946 X:149887142-149887164 AGTAAAAGCAGGCCAAAAGAAGG + Intergenic
1200285536 X:154818984-154819006 AGTAACAACAGACTTAAAGCAGG + Intronic
1200309248 X:155060677-155060699 AGAAAAAGATGACTAAAAGCAGG - Intergenic
1200456417 Y:3399746-3399768 AGTAACAGCAGATTTAAAGCAGG + Intergenic
1201193146 Y:11466352-11466374 AGGAAATGCAGACCAAAAGCAGG + Intergenic
1201318835 Y:12675422-12675444 AGTAACAGCAGATTTAAAGCAGG + Intergenic
1201988855 Y:20002348-20002370 AATTAAAGTAGACAAAAGGCTGG + Intergenic
1202063001 Y:20907788-20907810 AGCAAGAGCAGATTAAAAGCTGG + Intergenic