ID: 930356143

View in Genome Browser
Species Human (GRCh38)
Location 2:50323270-50323292
Sequence CCTGATTTATGAGGTCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 251}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930356138_930356143 -7 Left 930356138 2:50323254-50323276 CCTCACAGTCAGAGTTCCTGATT 0: 1
1: 0
2: 9
3: 61
4: 453
Right 930356143 2:50323270-50323292 CCTGATTTATGAGGTCTGGGTGG 0: 1
1: 0
2: 0
3: 38
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930356143 Original CRISPR CCTGATTTATGAGGTCTGGG TGG Intronic
901056909 1:6452610-6452632 TCGGATTTAGGAGGTCTGGGCGG + Intronic
901829597 1:11883997-11884019 ACTGATTTCTGAGGTTTGGTGGG - Intergenic
902878621 1:19356133-19356155 CCTGATATGCTAGGTCTGGGTGG + Intronic
902951507 1:19886783-19886805 CCTGATTGAGTAGGCCTGGGTGG + Intronic
903695688 1:25204907-25204929 TCTGATTCAGTAGGTCTGGGTGG + Intergenic
905537143 1:38731151-38731173 TCTGATTCAGCAGGTCTGGGTGG - Intergenic
905609151 1:39333893-39333915 CCAGATTTATAAGTTCTGGCTGG - Intronic
906722826 1:48021716-48021738 CCTGATTTAGCTGGTCTGGTGGG + Intergenic
907261012 1:53218739-53218761 CCTGCTTTTTGTGGTTTGGGAGG - Intronic
908252317 1:62274738-62274760 CCTGCTTGTTGAGGCCTGGGGGG + Exonic
911179344 1:94847414-94847436 CCTGGCTGATGAGGTGTGGGTGG - Intronic
913964428 1:143363668-143363690 TCTGATTTAGTAGGTCTGGGTGG - Intergenic
914058797 1:144189274-144189296 TCTGATTTAGTAGGTCTGGGTGG - Intergenic
914120352 1:144777097-144777119 TCTGATTTAGTAGGTCTGGGTGG + Intergenic
916441560 1:164830862-164830884 TCTGATTTAATAGGTCTGGGCGG - Intronic
918246108 1:182660835-182660857 CCTGATTCAGTAGGTCTGAGAGG + Intronic
918343889 1:183589998-183590020 CCTGATTTAACTGGTCTGGGAGG - Intronic
918363446 1:183782477-183782499 CTTGATTTTTGAGGTCTGTTTGG + Intronic
920286906 1:204886555-204886577 CCTGATTCGGGAAGTCTGGGAGG + Intronic
921348010 1:214207024-214207046 CCTGATTAATGAGGTCATGTAGG + Intergenic
921389638 1:214605640-214605662 CCTTATTGCTGAGGTCTGGCCGG + Intronic
923035468 1:230282150-230282172 CCTGGTGTGTGAGGGCTGGGTGG + Intergenic
923631516 1:235651688-235651710 TCTGATTCCTTAGGTCTGGGTGG - Intergenic
924677256 1:246191883-246191905 TCTCATTTATTAGGACTGGGTGG - Intronic
924856777 1:247881938-247881960 CCTGAGTGAAGAGGACTGGGAGG + Intergenic
1063607761 10:7537751-7537773 CCTGATTGATAAGGTCTGTGTGG - Intergenic
1067843455 10:49700221-49700243 TCTGATTTAATGGGTCTGGGAGG + Intronic
1069791964 10:71028517-71028539 CCAGATCTATGGGGTCAGGGAGG + Intergenic
1069870342 10:71529138-71529160 CCTGATTCAGTAGCTCTGGGTGG + Intronic
1070358250 10:75661419-75661441 TCTGATTCAGGAGGTCTGGCTGG + Intronic
1071138781 10:82482641-82482663 TCTGATATAGCAGGTCTGGGTGG - Intronic
1071331342 10:84564130-84564152 TCTGATTCAGTAGGTCTGGGTGG - Intergenic
1073107768 10:101042377-101042399 CCTAAAGTCTGAGGTCTGGGAGG - Intergenic
1073624140 10:105079121-105079143 TCTGATTCTGGAGGTCTGGGTGG - Intronic
1073985155 10:109199683-109199705 CCTGCTTCATGAGCACTGGGAGG - Intergenic
1075193751 10:120336047-120336069 CCTACTTTCTGAGGTTTGGGAGG + Intergenic
1075447628 10:122524836-122524858 CTTGACTGATGAGGACTGGGAGG + Intergenic
1077889119 11:6405918-6405940 CCTGCTTCATGAGGGCTGGCTGG + Intronic
1078463145 11:11530614-11530636 CCAGCTCTATGTGGTCTGGGAGG - Intronic
1079435448 11:20443173-20443195 CCTGATTTACAATGCCTGGGTGG - Intronic
1079498500 11:21074210-21074232 TCTGATTCAGTAGGTCTGGGAGG - Intronic
1082776832 11:57251814-57251836 CCTTTTTTATCAGCTCTGGGAGG + Intergenic
1084738214 11:71119740-71119762 TCTGATTCAGCAGGTCTGGGTGG + Intronic
1084935622 11:72585023-72585045 CCGGATTTCCGAGGCCTGGGAGG + Intronic
1086344726 11:85884390-85884412 TCTGATTCAGTAGGTCTGGGTGG - Intronic
1088326642 11:108607873-108607895 TCTGATTCAGTAGGTCTGGGTGG - Intergenic
1088589261 11:111388760-111388782 CCCGATATATGAATTCTGGGGGG - Intronic
1088878672 11:113956989-113957011 TCAGATTCAGGAGGTCTGGGAGG - Intergenic
1089129719 11:116202216-116202238 CCAGATGTCTGAGGTTTGGGAGG + Intergenic
1089947604 11:122493781-122493803 TCTAATTTAGGAGATCTGGGTGG - Intergenic
1090429221 11:126632096-126632118 ACTGATTCAGGAGGTCTGGGAGG + Intronic
1092909606 12:13135298-13135320 CCTCATTTATTAGGTCTAGTGGG - Intronic
1094044292 12:26150234-26150256 CCTGATGTGTGAGACCTGGGAGG - Intronic
1094166245 12:27446817-27446839 CCTGATTCAGTAAGTCTGGGAGG + Intergenic
1097637346 12:62138947-62138969 CCTTATTTCTGATCTCTGGGTGG - Intronic
1097709025 12:62898081-62898103 ACTCATTTATGAGGTGTGGGTGG - Intronic
1098528233 12:71511370-71511392 CCTGATTTACCAGGTTGGGGTGG - Intronic
1099402961 12:82222560-82222582 TCTGATTCAGGAGGTCTGCGAGG - Intergenic
1100139516 12:91599884-91599906 CTTCATTTATAAGGTCTGTGAGG - Intergenic
1100906358 12:99304654-99304676 ACTGATATATGAGTTCAGGGTGG - Intronic
1102903538 12:116657483-116657505 CCTGGTTTATGAGGAGTCGGAGG - Intergenic
1102943037 12:116961020-116961042 TCAGATTTATTTGGTCTGGGAGG + Intronic
1103482180 12:121257875-121257897 CCTGATTTATGGTGCTTGGGTGG - Intronic
1104004904 12:124885044-124885066 CCTGATTCAGTAGGTCTGGGTGG + Intergenic
1104603814 12:130172597-130172619 CCTGATTCCTTAGGTCTGGGTGG + Intergenic
1106901437 13:34358109-34358131 TCTGATTCAGCAGGTCTGGGTGG - Intergenic
1110897865 13:80778470-80778492 TCTGATTCATTAGGTCTGGGTGG + Intergenic
1112990402 13:105506550-105506572 TCTGATTCAGCAGGTCTGGGTGG + Intergenic
1113636804 13:111925063-111925085 GCTGATTCAGGAGGTCTAGGTGG + Intergenic
1116054714 14:39849063-39849085 TCTGATTTAATAGGTCTAGGTGG - Intergenic
1117668466 14:58081277-58081299 TCTGATTCAGTAGGTCTGGGTGG - Intronic
1117812856 14:59566986-59567008 GCTGATTTAACAGATCTGGGAGG - Intronic
1118020404 14:61707252-61707274 TCTGATTTATGAAGTCTGAATGG - Intronic
1118367230 14:65106291-65106313 TCTGATTTAGTAGGTCTGGGTGG - Intergenic
1118727941 14:68643745-68643767 CCCTTTTTAGGAGGTCTGGGAGG + Intronic
1119543374 14:75455169-75455191 CCTGATTCAGTAGGTCTGGGTGG + Intronic
1119970833 14:78968285-78968307 CATCATTGATGAGGTCTGGCAGG - Exonic
1120657090 14:87204115-87204137 CCTTATTTAGTAGGTTTGGGTGG - Intergenic
1121337104 14:93084118-93084140 CCTTGTTTCTGAGGTCAGGGAGG - Intronic
1121940618 14:98067256-98067278 TTTCATTTTTGAGGTCTGGGTGG + Intergenic
1122231494 14:100308230-100308252 CCTGGTTGAGGAGGTTTGGGAGG + Intergenic
1123990633 15:25680723-25680745 GCAGATTCATGAGGTCTGGGAGG - Intronic
1125419027 15:39485585-39485607 TCTGAGTTATGAGCTCTTGGAGG - Intergenic
1125818124 15:42603786-42603808 CCAGTTTTGTAAGGTCTGGGTGG + Intronic
1127393570 15:58526139-58526161 GCTGATTCAGTAGGTCTGGGAGG - Intronic
1127961675 15:63895060-63895082 TCTGATCTAGGAGGTCTGGGAGG + Intergenic
1129705341 15:77791043-77791065 CCTGGATCAGGAGGTCTGGGTGG + Intronic
1130440247 15:83945803-83945825 TCTGATTCCTTAGGTCTGGGTGG - Intronic
1131593267 15:93771931-93771953 TCTGATTTGTAAGTTCTGGGAGG + Intergenic
1131725348 15:95216657-95216679 TCTGATTCAATAGGTCTGGGTGG - Intergenic
1131981837 15:98002070-98002092 TCTGATGTATGAGGTGTGTGTGG + Intergenic
1132279134 15:100597437-100597459 TCTGATTTAGTGGGTCTGGGAGG + Intronic
1132986697 16:2771060-2771082 CCTGGTTCATGTGTTCTGGGGGG + Exonic
1133558407 16:6927161-6927183 TCTGAATTGTTAGGTCTGGGTGG + Intronic
1136073026 16:27799991-27800013 TCTGATTCAGGAGGTCTGGCGGG - Intronic
1138535317 16:57656965-57656987 CATGAATTCTGAGGTCTTGGGGG - Intronic
1138593942 16:58019278-58019300 TCTGATTTCTTAGGTCTTGGTGG - Intronic
1139335013 16:66225668-66225690 TCTGATTTAGTAGGTCAGGGTGG - Intergenic
1139598313 16:67970589-67970611 CCTGATCCAGGAGGTCTTGGTGG + Intergenic
1139760841 16:69183775-69183797 CCTTATTTTTGAGGTCTGAAGGG + Intronic
1141050160 16:80754398-80754420 CCTAATTTATGATGTTAGGGTGG - Intronic
1142181005 16:88670208-88670230 CTTGATTCATGATGCCTGGGTGG + Intergenic
1143047456 17:4093622-4093644 TCTGATTCAGGAGCTCTGGGTGG - Intronic
1143816529 17:9520021-9520043 CCTAAATTATGAGCTCTGTGAGG + Intronic
1143998074 17:11025803-11025825 TCTGATTCAGTAGGTCTGGGAGG - Intergenic
1144423672 17:15120987-15121009 TCTGATTCAGGAGGTCTGGGCGG - Intergenic
1146087256 17:29841072-29841094 CCTGGTGTATGATGGCTGGGAGG + Intronic
1146195400 17:30808212-30808234 TCTGATTTAGCAGTTCTGGGTGG - Intronic
1147310903 17:39595750-39595772 ACTGATTTATGAGGCCGTGGAGG - Intergenic
1148388974 17:47256478-47256500 ACTGATTTGTGAGGTTGGGGGGG - Intronic
1149112236 17:53047540-53047562 GCTGATGTATGGGGTCTGGTAGG - Intergenic
1149467549 17:56891777-56891799 CCTGATGTATAAGTTCAGGGTGG - Exonic
1149528903 17:57379430-57379452 CGTGATTTATGAGATGTGTGTGG + Intronic
1150143788 17:62751404-62751426 TCTGATTCAGAAGGTCTGGGTGG - Intronic
1150682916 17:67297478-67297500 CCTGAGTCAGGAGGTCTGCGAGG - Intergenic
1151173261 17:72266214-72266236 TCTGATTTAGTAGGTGTGGGTGG - Intergenic
1152164033 17:78689857-78689879 GCTGGTTTCTCAGGTCTGGGAGG - Intronic
1157743772 18:50116741-50116763 GCTGATTTAGTGGGTCTGGGTGG - Intronic
1159210653 18:65316999-65317021 GCTGATTTCTGAGCTCTGGGGGG + Intergenic
1159464755 18:68767223-68767245 CTTCACATATGAGGTCTGGGAGG - Intronic
1160031807 18:75268571-75268593 CCTGATTTAGGTGGTCAGAGTGG - Intronic
1161457408 19:4376472-4376494 TCTGAGGTCTGAGGTCTGGGCGG - Intronic
1161876861 19:6918470-6918492 CTCAATTTATGATGTCTGGGGGG + Intronic
1164763847 19:30747935-30747957 CCTTCTTTATCAGGTCTTGGTGG + Intergenic
1168508401 19:56955244-56955266 TCTGATTTAGCAGGTCTGGCTGG + Intergenic
1202698200 1_KI270712v1_random:141159-141181 TCTGATTTAGTAGGTCTGGGTGG - Intergenic
927933839 2:27063632-27063654 CCTGATTTATGCCCTCTGAGGGG - Intronic
928655279 2:33444556-33444578 CATTATTTATGAGCTGTGGGTGG - Intronic
930252057 2:49045322-49045344 TCTGATTGAGTAGGTCTGGGTGG - Intronic
930356143 2:50323270-50323292 CCTGATTTATGAGGTCTGGGTGG + Intronic
930514271 2:52386526-52386548 CCTGATACATGAGGTTAGGGTGG - Intergenic
930713134 2:54568015-54568037 TCTGACTTAGGAGGTCTGTGGGG - Intronic
930897144 2:56459680-56459702 GCTCCTTTATGAGGTCTAGGAGG - Intergenic
931045728 2:58350524-58350546 TCTGATTTAATAGGTCAGGGTGG + Intergenic
931598564 2:63977951-63977973 CCTTATTTAAGAGGTCTGCAGGG - Intronic
933881446 2:86673916-86673938 TCTGATTCAGTAGGTCTGGGTGG + Intronic
934279453 2:91598942-91598964 TCTGATTTAGTAGGTCTGGGTGG - Intergenic
935713943 2:105923411-105923433 TCTGACTCAGGAGGTCTGGGTGG + Intergenic
936615862 2:114047035-114047057 CTTAATTTATAAGGACTGGGAGG + Intergenic
938117707 2:128613112-128613134 TCTGATTGATGAGGCCTGAGGGG + Intergenic
940066590 2:149636791-149636813 CCTGAGTCAATAGGTCTGGGGGG + Intergenic
941143522 2:161815114-161815136 CCTGACTCAAGAGGTCTGGATGG - Intronic
941161668 2:162042892-162042914 ACTGATTTGTGGGGTGTGGGTGG + Intronic
941490882 2:166140947-166140969 TCTTATTTAGAAGGTCTGGGTGG - Intergenic
941900399 2:170672478-170672500 CCTGATTCTCCAGGTCTGGGTGG - Intergenic
942051995 2:172148522-172148544 TCTGATTCATGGGCTCTGGGGGG - Intergenic
944150799 2:196556010-196556032 CCTGCTTGGGGAGGTCTGGGAGG - Intronic
945015167 2:205507580-205507602 CCTTATTTATGGAGTCTGGGTGG - Intronic
945850340 2:214998704-214998726 TCTGATTTATTATATCTGGGTGG + Intronic
947182521 2:227424128-227424150 CCTGATTCAGCAGTTCTGGGAGG - Intergenic
947624344 2:231610485-231610507 TCTGATTTAGTAGGCCTGGGTGG - Intergenic
947769028 2:232656169-232656191 CCTGAAGTGTGAGGTCTGTGTGG + Intronic
1168865765 20:1085139-1085161 TCTGATTTAGTAGGTCTGAGAGG - Intergenic
1169723667 20:8705562-8705584 CCTGAATTATGCTGTCTGGATGG + Intronic
1169783115 20:9330237-9330259 CCTGGTTTATGAGGTCTCTTTGG + Intronic
1169790810 20:9408526-9408548 CCTGAATCATGAGGCCTTGGAGG - Intronic
1169879467 20:10330773-10330795 CCTGATTTACAAGGTCTGGCGGG - Intergenic
1169965515 20:11213308-11213330 TCTGATTCAGCAGGTCTGGGCGG - Intergenic
1170493033 20:16897944-16897966 CCTGATTCAGGAGGTCTGGATGG - Intergenic
1170628004 20:18044165-18044187 TCTGATTCAGGAGGTCTGGTAGG + Intronic
1170816147 20:19716102-19716124 TCTGATTCAGGAGTTCTGGGTGG + Intronic
1170846954 20:19970215-19970237 TCTGATTCCAGAGGTCTGGGAGG - Intronic
1170874218 20:20235394-20235416 TCTGATGCAGGAGGTCTGGGTGG - Intronic
1170946335 20:20894452-20894474 GCTGGATTATGAGCTCTGGGAGG + Intergenic
1171231839 20:23493145-23493167 CCTTCTCTTTGAGGTCTGGGTGG + Intronic
1172785643 20:37466584-37466606 CCTGTCTTCTGGGGTCTGGGAGG - Intergenic
1172978590 20:38924585-38924607 CCTGATTGAAGAGGGCTGGAAGG + Intergenic
1174686120 20:52456853-52456875 CCTGATCTATTAGGACTGGAGGG + Intergenic
1175318055 20:58065639-58065661 TCTGATTCAGCAGGTCTGGGTGG - Intergenic
1175531850 20:59678940-59678962 TCTGAGTTAGCAGGTCTGGGTGG + Intronic
1178030515 21:28520579-28520601 TCTGATTAAGAAGGTCTGGGTGG + Intergenic
1179834898 21:44024333-44024355 TCTGATTGAACAGGTCTGGGTGG + Intronic
1181333739 22:22114809-22114831 CCTTATTGCTGAGGTCTGGCCGG + Intergenic
1182363313 22:29760580-29760602 CCTGATTTAGCAGATCTGGAGGG + Intronic
1183489831 22:38110415-38110437 CCTGATTTCTGTGCCCTGGGAGG + Intronic
949591878 3:5503207-5503229 TCTGATTCAGGAGGTCTGGGTGG - Intergenic
950223131 3:11211935-11211957 TCTGATTCAGGAGGTCTGGGAGG - Intronic
951605127 3:24424495-24424517 TCTGATTCAGTAGGTCTGGGTGG - Intronic
951983131 3:28587666-28587688 CCTGACTTATGAGGTATGCAGGG - Intergenic
952277472 3:31891299-31891321 TATGATTCAGGAGGTCTGGGTGG + Intronic
952295827 3:32061072-32061094 AGTGATGTGTGAGGTCTGGGAGG - Intronic
953129712 3:40126227-40126249 TCTGATTCAGGAGGTCTGGATGG - Intronic
953774899 3:45808342-45808364 TCTGATTCTAGAGGTCTGGGAGG - Intergenic
955324255 3:57997605-57997627 CCTGATTCAGTGGGTCTGGGTGG + Intergenic
955583028 3:60445191-60445213 TCTGATTCACTAGGTCTGGGTGG + Intronic
956530930 3:70217816-70217838 TCTGAGTTATGAGGGCTTGGGGG + Intergenic
956884994 3:73550250-73550272 TCTGGTTCATTAGGTCTGGGGGG - Intronic
958449976 3:94260621-94260643 TCTGATATGGGAGGTCTGGGTGG - Intergenic
959128806 3:102325318-102325340 TCTGATTCAATAGGTCTGGGTGG + Intronic
961977052 3:131036745-131036767 TCTGATTTAGCAGGTCTGGTAGG + Intronic
962187823 3:133278871-133278893 TCTAATTCATTAGGTCTGGGTGG - Intronic
962244235 3:133778254-133778276 CCTGCTTAAAGAGGTCAGGGAGG + Intronic
965087409 3:164116388-164116410 TCTGATTCAGTAGGTCTGGGTGG - Intergenic
965666155 3:171095642-171095664 CCAGATTTATGATGTCTCTGGGG + Intronic
969587262 4:8101505-8101527 CCTGTTCTAGGCGGTCTGGGAGG - Intronic
970012484 4:11474586-11474608 CCTGATTTTGGAGGTCAAGGAGG + Intergenic
970776259 4:19678103-19678125 CTTGATTCGTTAGGTCTGGGTGG + Intergenic
971748306 4:30612953-30612975 GCTGATTCACTAGGTCTGGGTGG + Intergenic
972417904 4:38860897-38860919 GCTGATGTAAGTGGTCTGGGAGG + Intergenic
979296774 4:119041853-119041875 TCTGATTTACTAGGTTTGGGTGG + Intronic
981024406 4:140062393-140062415 TCTGATTTAATAGGTCTGGGAGG - Intronic
981135087 4:141201650-141201672 CCTGATTTAAGAGGTCCTTGAGG - Intronic
982171457 4:152665750-152665772 TCTGATGTAATAGGTCTGGGAGG + Intronic
985771968 5:1817494-1817516 GCTGAGTTGGGAGGTCTGGGAGG + Intergenic
985884176 5:2663632-2663654 CCTGATTTAGGAAGTGTGTGGGG - Intergenic
985966168 5:3340212-3340234 CCTGGTCTCTGAGGTCAGGGTGG + Intergenic
987266718 5:16263394-16263416 CCTGATTTAGTTGGTCTGAGAGG + Intergenic
990536906 5:56732198-56732220 CCTGATCTAGTAGGTCTGGGTGG + Intergenic
990653600 5:57930014-57930036 TCTGATTCAATAGGTCTGGGTGG - Intergenic
991079935 5:62587910-62587932 CCACTTTCATGAGGTCTGGGAGG + Intronic
992315179 5:75545039-75545061 TCTGATTTATTTGGTATGGGAGG + Intronic
995239141 5:109865952-109865974 CATTATTTATGAGGTTTTGGAGG - Intronic
995677918 5:114684245-114684267 TCTGATTTACTAGGTCTGGGTGG - Intergenic
995685149 5:114764755-114764777 CTTCTTTTAGGAGGTCTGGGAGG + Intergenic
995805624 5:116048905-116048927 AATGAATTATGATGTCTGGGAGG + Intronic
996331658 5:122336505-122336527 ACAAATTTCTGAGGTCTGGGAGG - Intronic
997736300 5:136215055-136215077 GCTGATTCATTAGGTCTGGGTGG + Intronic
999263276 5:150250631-150250653 CCTGGATCATGAGGTCTGGAGGG + Intronic
999267631 5:150277243-150277265 GCTGATTTAGGAGGTGTGGGTGG - Intronic
1000054552 5:157593391-157593413 TCTGATTCAAGAGGTCTGGGTGG - Intergenic
1002058459 5:176612030-176612052 GATAATTTATGAGCTCTGGGGGG + Intergenic
1003176720 6:3757516-3757538 TCTGATTCAGGAGGCCTGGGTGG + Intergenic
1003537201 6:6985641-6985663 CCTGGCTCTTGAGGTCTGGGAGG + Intergenic
1006205518 6:32338248-32338270 TCTGATTTAGTAGGTCGGGGTGG + Intronic
1006839018 6:37016190-37016212 TCTGAATCAGGAGGTCTGGGTGG + Intronic
1007093041 6:39196308-39196330 TCTGATTTAGGAGGTCTAGAAGG + Intronic
1008162108 6:48091404-48091426 TCTGATTCAGAAGGTCTGGGTGG - Intergenic
1010004757 6:70983634-70983656 CCTATTCTATGAGGTCTTGGTGG + Intergenic
1010833285 6:80556588-80556610 GCTGATTTATGAAGACTGTGTGG - Intergenic
1010865207 6:80967884-80967906 CCTCATCTCAGAGGTCTGGGAGG - Intergenic
1014186205 6:118436838-118436860 CCTGGTTTAGTAGGTCTGAGTGG + Intergenic
1015093967 6:129392371-129392393 TCTGATTCAGGAGGTCTGGGAGG - Intronic
1015123778 6:129729527-129729549 CCTGAATTATTAGTTCTGGCTGG - Intergenic
1017903025 6:158734565-158734587 CATGACTTGTGATGTCTGGGAGG - Intronic
1018660890 6:166086582-166086604 TCTGATTCAGCAGGTCTGGGGGG + Intergenic
1019213080 6:170421963-170421985 TCTGATTTAGGAGGGCTGTGGGG + Intergenic
1019307213 7:341446-341468 TGTGATTTAGGAGGTCGGGGCGG - Intergenic
1019894226 7:3971238-3971260 GCTGATTTAGGAGGGGTGGGTGG + Intronic
1023576054 7:41628138-41628160 TCTGATTGGGGAGGTCTGGGTGG - Intergenic
1023833093 7:44051633-44051655 ACTGATTGATGAGAGCTGGGTGG - Intronic
1023942933 7:44781632-44781654 CCCGGTGTATGTGGTCTGGGTGG - Intergenic
1025016045 7:55439923-55439945 TCTGATTCAGTAGGTCTGGGTGG + Intronic
1027150873 7:75732825-75732847 CCTGATTCAGTAGTTCTGGGTGG + Intronic
1027775103 7:82455098-82455120 CCTGATTCAGTAGGTCTGGGTGG + Intergenic
1029686650 7:102153219-102153241 CCAGGTTTATGGGGCCTGGGTGG - Intronic
1030297500 7:107943646-107943668 TCTGATTCAGTAGGTCTGGGTGG + Intronic
1032536636 7:132669880-132669902 AATGATTTCTCAGGTCTGGGTGG - Intronic
1034783111 7:153900075-153900097 TCTGATTCAGTAGGTCTGGGTGG - Intronic
1034863054 7:154616514-154616536 GCTGGTTTAGGAGGGCTGGGAGG + Intronic
1035443906 7:158926497-158926519 CCTGAGTGAGGTGGTCTGGGTGG + Intronic
1036474246 8:9078691-9078713 ACTGATTCAGCAGGTCTGGGTGG - Intronic
1036664618 8:10730535-10730557 CCTGATTTATCAGCTTCGGGCGG + Intronic
1037293830 8:17380198-17380220 CCTGATTCATGAGATATTGGTGG - Intronic
1039093941 8:33863079-33863101 ACTCATTTATGAGGTCTTGATGG + Intergenic
1039746004 8:40427912-40427934 CCTCAGTTGTGAGCTCTGGGAGG + Intergenic
1040013719 8:42683301-42683323 TCTGATTCAGGAGGTCTGGGTGG - Intergenic
1041109671 8:54472626-54472648 CGTCAGTCATGAGGTCTGGGTGG + Intergenic
1042641228 8:70937380-70937402 TCTGATTTAGTTGGTCTGGGTGG - Intergenic
1044379538 8:91517937-91517959 CCTGGTTTATGAGGGTGGGGTGG - Intergenic
1044730667 8:95226334-95226356 CCTGATCCAGGAGGCCTGGGTGG + Intergenic
1045894199 8:107194620-107194642 CCTGATTCAGCAGGTCTGAGTGG - Intergenic
1046912294 8:119641720-119641742 CCTGATTCATTAGGTCTGGCAGG + Intronic
1047338913 8:123961300-123961322 TCTGATTGAGTAGGTCTGGGTGG - Intronic
1049839748 8:144763344-144763366 CCTGATCTGTGGGGTCAGGGAGG + Intergenic
1051130794 9:13858075-13858097 ACTGATTCAAGAGGTCTGGGAGG - Intergenic
1051808098 9:21018898-21018920 CTTGATTTATAAGCTATGGGAGG + Intronic
1052216615 9:25973476-25973498 TCTGATTCAGTAGGTCTGGGTGG - Intergenic
1052739648 9:32381293-32381315 TCTGATTCATTAGGTCAGGGTGG - Intergenic
1053367181 9:37531293-37531315 ACAGATTTATGGGGTATGGGAGG - Intronic
1054775896 9:69123040-69123062 CCTGATTCAGCAGATCTGGGTGG - Intronic
1056297016 9:85203221-85203243 TCTGATTTAGCAGGTCTGGGTGG + Intergenic
1056589637 9:87955936-87955958 CCTGATTTATGAGGACCGAAAGG + Intergenic
1058794191 9:108482480-108482502 CCTGAATTACAAGGTCTTGGAGG + Intergenic
1059463981 9:114454361-114454383 ACTCATTTATTAGTTCTGGGAGG - Intronic
1061165415 9:128919522-128919544 CCTTAGTGATGAGGCCTGGGTGG + Intergenic
1062060967 9:134494815-134494837 CCTGATTTAAGAGTTTGGGGAGG - Intergenic
1186742320 X:12531516-12531538 TCTGATTTTTGAGGCCTGGCTGG + Intronic
1186791891 X:13007759-13007781 TCTGATTCAAGAGGTCTAGGTGG + Intergenic
1187233202 X:17441997-17442019 TCTGATTTAGTAGGTCTGGAGGG + Intronic
1187667009 X:21624897-21624919 CCTGAATTATGAGCTATTGGGGG - Intronic
1187785375 X:22879346-22879368 CATGTTTTCTTAGGTCTGGGTGG - Intergenic
1189211926 X:39290928-39290950 TCTGATTCAGGATGTCTGGGTGG + Intergenic
1193350636 X:80460452-80460474 CGTTATTTATGTGGTCTGTGAGG + Intergenic
1193350691 X:80461564-80461586 CGTTATTTATGTGGTCTGTGAGG - Intergenic
1196065587 X:111460684-111460706 CATTATTTCTGAGATCTGGGTGG + Intergenic
1196125395 X:112093336-112093358 CCTGATTAGAGAGGGCTGGGAGG - Intergenic
1196983686 X:121243751-121243773 TCTGAGGTATGTGGTCTGGGAGG + Intergenic
1197264913 X:124358831-124358853 TCTGATTTAACAGGTCTGGGTGG + Intronic
1198525562 X:137496907-137496929 TCTGATTTAGTAGGTCTGAGTGG - Intergenic
1201142964 Y:11043654-11043676 TCTGATTCAGCAGGTCTGGGTGG + Intergenic