ID: 930362568

View in Genome Browser
Species Human (GRCh38)
Location 2:50400379-50400401
Sequence CCCCCCAATAGCACTCCTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 53}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930362568_930362574 24 Left 930362568 2:50400379-50400401 CCATAAGGAGTGCTATTGGGGGG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 930362574 2:50400426-50400448 CTCATATAAACATAATAAAGTGG 0: 1
1: 0
2: 3
3: 53
4: 451
930362568_930362575 25 Left 930362568 2:50400379-50400401 CCATAAGGAGTGCTATTGGGGGG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 930362575 2:50400427-50400449 TCATATAAACATAATAAAGTGGG 0: 1
1: 1
2: 4
3: 39
4: 595

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930362568 Original CRISPR CCCCCCAATAGCACTCCTTA TGG (reversed) Intronic
912755802 1:112324153-112324175 CCCTCCAGTAGCACTGCTCATGG + Intergenic
916578678 1:166088990-166089012 ACCCCCAATAGCTTTCCTTATGG + Intronic
917435950 1:175021530-175021552 CACCCCAATAACAATCCTTCTGG + Intronic
920352576 1:205347246-205347268 CCTCCGATTAGCACTCCTTAAGG - Intronic
1063053092 10:2474783-2474805 CCCCCCGAGGGCACTCCTTCTGG - Intergenic
1065279422 10:24119742-24119764 CCCTCCAATAGCAAACTTTAAGG - Intronic
1067733786 10:48833345-48833367 CCAGCCAATAGCCCCCCTTAAGG - Intronic
1073261987 10:102197393-102197415 TCTTCCAGTAGCACTCCTTAGGG - Intergenic
1076128063 10:127991910-127991932 CCCCTCAACACCACTCCTTCAGG + Intronic
1078780679 11:14436212-14436234 CCTGCCAATTTCACTCCTTAGGG + Intergenic
1084588313 11:70076271-70076293 CTCCCCAACAGCACCCCTTGCGG - Intergenic
1085572209 11:77569302-77569324 CCCAGCAATTGCAATCCTTAGGG + Intronic
1087195301 11:95298896-95298918 CCCCTCAATATCAACCCTTACGG + Intergenic
1089090551 11:115871072-115871094 CCCCCCAATGCCACTCCTCAGGG - Intergenic
1102753838 12:115320787-115320809 CCTCCCAATGGCAGTCCTAAAGG + Intergenic
1103012211 12:117466119-117466141 TCCCCCAACAGGACTCCTCAAGG + Exonic
1113165932 13:107442047-107442069 TCCCCAAATAGCACTCTTTGGGG - Intronic
1115955425 14:38773728-38773750 CTCCCCAAGGGCACTCATTAAGG + Intergenic
1121283068 14:92713404-92713426 CACCCCTATAGCACCCTTTATGG - Intronic
1130996916 15:88909075-88909097 CACCCCACTAGGACTCCTCATGG - Intronic
1133130527 16:3673764-3673786 GCCCCGAATAGGTCTCCTTACGG + Intronic
1135529034 16:23236769-23236791 CCCCCCAAAAGAACTACTTGAGG - Intergenic
1137645142 16:50066798-50066820 CTCTCCAAAAGCCCTCCTTAGGG + Intronic
1140559218 16:75958296-75958318 CATCCCAATAGCAATTCTTAAGG - Intergenic
1152183362 17:78839474-78839496 CCCCACAATATCACTGCTTTCGG + Intronic
1155705364 18:28803659-28803681 CCCCCCATCATCTCTCCTTAAGG - Intergenic
925235631 2:2274945-2274967 CCCCCTCATAGCACTACATAGGG - Intronic
929777109 2:44936457-44936479 CCCCCCAAAAGTAACCCTTAAGG + Intergenic
930362568 2:50400379-50400401 CCCCCCAATAGCACTCCTTATGG - Intronic
933138395 2:78763226-78763248 CCCCAAAATATCACCCCTTAAGG + Intergenic
938949942 2:136246209-136246231 CCCCCCACCAGCACTGCTTCTGG - Intergenic
945813661 2:214577461-214577483 CCCCTCACTCCCACTCCTTAGGG - Exonic
946720431 2:222600266-222600288 CCCCCAAATAAAACACCTTAGGG - Intronic
1173455563 20:43198648-43198670 CCCCCCACTTGCTCACCTTAGGG + Intergenic
1178937946 21:36880824-36880846 CCCTCCCAGAGCACTCCTTAGGG + Intronic
1180027864 21:45178545-45178567 CCTCCCAGAAGCAGTCCTTAGGG + Intronic
952897040 3:38084713-38084735 CCCCCCATCAGCAGTCCTTGAGG + Intronic
978594990 4:110367824-110367846 CACCCCAATCTCACTCCCTAGGG - Intronic
981766742 4:148259366-148259388 CCCCAAAATCGTACTCCTTAAGG - Intronic
982777834 4:159460138-159460160 CCCCCAAAAAAGACTCCTTAGGG - Intergenic
985514969 5:337721-337743 CCTTCCAAGCGCACTCCTTAGGG - Intronic
985974471 5:3405191-3405213 CCCCCCAAGACCAGCCCTTAAGG - Intergenic
994097015 5:95856610-95856632 CCCCCCAATAGCCTTCCCAAGGG - Intronic
997022987 5:130023922-130023944 CCCCCCAATAGCTCTTCAAAGGG + Intronic
1000104040 5:158041801-158041823 CCACCCAAGTGCACTCCATATGG - Intergenic
1003894985 6:10598987-10599009 CCACCCAATTGCCCTCGTTAAGG + Intronic
1008418955 6:51274266-51274288 CCCCCCAAAAGATCTCCTTTTGG - Intergenic
1010106717 6:72178870-72178892 TTCCCCAATAGCTCTCCTTGGGG + Intronic
1012241354 6:96876449-96876471 ACCCACAATAGCACTCCCTGGGG + Intergenic
1021927580 7:25548006-25548028 CCCCCCATTAGCACTACCTGTGG + Intergenic
1024875514 7:54018489-54018511 GCCCCCAGTAGCTCTCCTCAGGG + Intergenic
1026473112 7:70711127-70711149 CCCCCCCAGAGCACACCTTCGGG + Intronic
1028592103 7:92507999-92508021 TGCCCTAATAGAACTCCTTAAGG + Intronic
1031660943 7:124423221-124423243 TCCACCAATAGAAATCCTTAAGG + Intergenic
1032441739 7:131947501-131947523 TCCACCCATAGCTCTCCTTAGGG - Intergenic
1037048038 8:14334177-14334199 CCCTACCAAAGCACTCCTTAGGG + Intronic
1045014181 8:97984819-97984841 CCCACCAATATCTGTCCTTATGG + Intronic
1193478781 X:82000377-82000399 CCTCCCAAGAGCACTCTTAAAGG - Intergenic