ID: 930364001

View in Genome Browser
Species Human (GRCh38)
Location 2:50416382-50416404
Sequence GGGAACACAAAGCTTAAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 145}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930364001_930364003 -8 Left 930364001 2:50416382-50416404 CCTACCTTAAGCTTTGTGTTCCC 0: 1
1: 0
2: 1
3: 11
4: 145
Right 930364003 2:50416397-50416419 GTGTTCCCTCTACCAGTCCCAGG 0: 1
1: 0
2: 0
3: 13
4: 170
930364001_930364009 16 Left 930364001 2:50416382-50416404 CCTACCTTAAGCTTTGTGTTCCC 0: 1
1: 0
2: 1
3: 11
4: 145
Right 930364009 2:50416421-50416443 GACCTCCCCAAATATCCCTTTGG 0: 1
1: 0
2: 4
3: 26
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930364001 Original CRISPR GGGAACACAAAGCTTAAGGT AGG (reversed) Intronic
907074404 1:51565289-51565311 GGGAACATAAGGTTCAAGGTGGG - Intergenic
907497450 1:54854236-54854258 TGGAAAACAAAGATTAGGGTTGG + Intronic
908528477 1:65010739-65010761 GGGAGGCCAAAGCTTGAGGTTGG + Intergenic
915171667 1:153982432-153982454 GGGAACTAAAAGCCTAAAGTGGG + Exonic
917310275 1:173671111-173671133 GGGAAATCAAAACTTAAAGTGGG - Intergenic
917333625 1:173907229-173907251 GGGAACACAAACATTTAGGGAGG - Intronic
917626382 1:176850705-176850727 GGGAACAGCAAGTGTAAGGTGGG + Intergenic
920922081 1:210306284-210306306 ACGAACACAAATCTTAATGTGGG - Intergenic
1063143156 10:3273970-3273992 GTGAAGACAATGCTTAGGGTGGG - Intergenic
1063333315 10:5184304-5184326 GTGGACACAAAGGGTAAGGTTGG - Intergenic
1068300176 10:55128674-55128696 GAGAACACAGAGTTTAAGGGAGG - Intronic
1069362730 10:67661418-67661440 TGGATCACAGAGCTAAAGGTAGG + Intronic
1070892432 10:79951791-79951813 GGGAACACAAAGCTTTGGAGGGG + Intronic
1071293945 10:84205932-84205954 GGGAAGACAAAGCTAGAGGGAGG - Intronic
1072658049 10:97344450-97344472 GAGAACACAAGGCCTAAGCTTGG - Intergenic
1074407317 10:113190666-113190688 AGGGACACAAAGCTAAAGGATGG - Intergenic
1074613272 10:115041122-115041144 GGGAATCTAAATCTTAAGGTCGG + Intergenic
1074904111 10:117845726-117845748 AGGCACACAAAGCTTAATCTTGG + Intergenic
1076889617 10:133277195-133277217 GGGAACAGAAAGCCTCAGGCAGG + Intergenic
1077948787 11:6931762-6931784 AGCAACACAAATCTTCAGGTAGG - Intronic
1080308151 11:30858935-30858957 GAGAACAAGAAGCTGAAGGTAGG - Intronic
1083228022 11:61296696-61296718 GGGGCCACACAGCTTCAGGTAGG - Intergenic
1083673113 11:64310880-64310902 GGGTGCACAAAGTTTAAGATTGG - Intronic
1087384042 11:97447004-97447026 GGGGTCACAAGGCGTAAGGTGGG - Intergenic
1089000163 11:115045159-115045181 GGGAATGCTAAGCTTAGGGTGGG - Intergenic
1089500605 11:118929411-118929433 GGGGACACAAAGCTGGAGGGCGG + Intronic
1090435230 11:126681403-126681425 GGGAGCACGAAGCTTGAGGTAGG + Intronic
1091722680 12:2824593-2824615 CGGAAGACAGAGCTTAAGATGGG - Exonic
1092399537 12:8162606-8162628 GGGAAGACAAAGGATTAGGTGGG - Intronic
1092957338 12:13562756-13562778 GGGAACAGAGAGGTTAAGGTGGG - Exonic
1093477570 12:19573213-19573235 GGGAACATAAAGCCTGAGCTCGG - Intronic
1094401971 12:30071396-30071418 GGGAACAAAAAGGTAAAGGAAGG - Intergenic
1095569674 12:43670259-43670281 GAGAACACAAGGCTTAGGCTAGG + Intergenic
1095647728 12:44568291-44568313 GGAAACACATTACTTAAGGTTGG - Intronic
1096097316 12:48944509-48944531 GGGAATACACAGCTTAACGTGGG - Intronic
1096861605 12:54532691-54532713 GGAACCAGAAAGCTTAAGGATGG - Intronic
1099043788 12:77690017-77690039 GGGAAAAAATAGCTTAATGTTGG - Intergenic
1101233511 12:102765771-102765793 GGTAACACACAGCTTCACGTTGG - Intergenic
1102123985 12:110465573-110465595 GTGCAAACAAAGCTTTAGGTAGG + Intronic
1109253718 13:60051867-60051889 GAGAACACCGAGCTGAAGGTAGG + Intronic
1109399158 13:61802199-61802221 GGGAACATAAAGTTTCAGTTAGG + Intergenic
1109634841 13:65101681-65101703 GGTAACAAAAACCTCAAGGTAGG + Intergenic
1110677038 13:78261095-78261117 GGTAACACCATGCTTCAGGTTGG + Intergenic
1114403244 14:22429579-22429601 GGGATCACACGGCCTAAGGTAGG + Intergenic
1115965877 14:38887650-38887672 GGGAAAACAAAGTGAAAGGTTGG + Intergenic
1116578133 14:46602404-46602426 GGGAACACAATGCTTCAAGGAGG - Intergenic
1117258845 14:54007957-54007979 AGGAACACAAAACTTAAGTGAGG - Intergenic
1117571618 14:57054642-57054664 GGCAATACAAAGCCAAAGGTGGG + Intergenic
1117976101 14:61298336-61298358 GGGAACACTAAGTTTGAAGTTGG - Intronic
1121257022 14:92538480-92538502 TGGAACACAAAGCTTGAGTTTGG + Intronic
1122581674 14:102775774-102775796 GGTAACACACAGCATAAGGCAGG + Intergenic
1124121198 15:26890669-26890691 GGGAACACAGAACTTCAGCTGGG - Intronic
1124873170 15:33564063-33564085 GAGAAAACAAAGATCAAGGTGGG - Intronic
1127974269 15:63985595-63985617 GGGAAAGCAAAGCTTAAGGGTGG + Intronic
1128325725 15:66722815-66722837 GGGAACAGACAGCTGAAGGAGGG + Intronic
1129134068 15:73530678-73530700 GGGAAAACAAAGCAAAAGATTGG - Intronic
1133346914 16:5077471-5077493 GGTAACACACAGGTTCAGGTGGG - Exonic
1137649920 16:50110929-50110951 TGGAAAACAAGGCCTAAGGTAGG + Intergenic
1138472869 16:57252076-57252098 GGGAAGGCAGAGCTGAAGGTGGG - Intronic
1141369605 16:83474764-83474786 GGGAACCCAGAGCTTAGGGCTGG + Intronic
1143145882 17:4775075-4775097 GGTAGTACAAAGCCTAAGGTGGG + Intronic
1143779027 17:9219759-9219781 GGGAAAACAAAGGTCAAGGTAGG - Intronic
1145770096 17:27486662-27486684 GGGACCACAAATCCCAAGGTAGG - Intronic
1147495404 17:40910901-40910923 GGGAAGAAAAAGTTTAAGATGGG - Intergenic
1149262366 17:54893898-54893920 TGGAGCCCAAAGCTTAAAGTAGG - Intergenic
1149718846 17:58822031-58822053 ATGAACACAAAGCTTTAAGTGGG + Intronic
1154091971 18:11373492-11373514 TGAAACACAAAGCTTGAGGATGG - Intergenic
1157074470 18:44449992-44450014 GGGAACAGAAAGCAGAAGGGAGG - Intergenic
1157181103 18:45498881-45498903 GGGAACAGAAAGCTGACTGTGGG - Intronic
1157191218 18:45583327-45583349 GGGCAGACAAAGCTTCAGGGAGG - Intronic
1157244232 18:46039436-46039458 GAGAACAGCAAGCTTGAGGTGGG - Intronic
1158712252 18:59848021-59848043 GGGAACACAAAGGGAAAAGTGGG + Intergenic
1161823402 19:6545440-6545462 GGAAAAACAAAGTTTGAGGTGGG - Intergenic
1166030667 19:40124272-40124294 TGGAACACAGAGCAGAAGGTAGG + Intergenic
930364001 2:50416382-50416404 GGGAACACAAAGCTTAAGGTAGG - Intronic
934621665 2:95813628-95813650 AGGGAAACAAAGCTTAGGGTTGG + Intergenic
934879117 2:97958036-97958058 GTGAACACGGAGGTTAAGGTAGG + Intronic
938112693 2:128579534-128579556 TTGAACACAAAGCTTGAGGATGG - Intergenic
940617408 2:156066541-156066563 GGGGACACAAATTTTAAGGCAGG - Intergenic
944314203 2:198267990-198268012 TGGAACTCAAAGCTTGAGGATGG + Intronic
944402221 2:199341144-199341166 GGCAAAAGAATGCTTAAGGTTGG + Intronic
946355465 2:219181804-219181826 GGGAACACAAAGATTGTGGCGGG - Intronic
1169875537 20:10293293-10293315 GGGAAATCAAAGCTTCAGGCAGG - Intronic
1169879643 20:10332462-10332484 GGAAACACAAAGCTTCAGAATGG + Intergenic
1181179246 22:21055528-21055550 GGGAACACCAGGCCTCAGGTGGG - Intronic
1183165695 22:36145606-36145628 GGAAACAAAAAGCATAAGATTGG + Intronic
950215731 3:11157139-11157161 AGGGACAGAAAGCTTAGGGTTGG + Intronic
953315427 3:41922581-41922603 TGGAACACAAAGCCAAAGGTGGG + Intronic
953634839 3:44654042-44654064 TGGAACACAAAGCAGAAAGTGGG - Intronic
954885514 3:53869977-53869999 GTGATCACAAGGCCTAAGGTAGG - Exonic
955081925 3:55665729-55665751 GGAAAGACAAATCATAAGGTGGG + Intronic
957840050 3:85656001-85656023 GGGAACAAAGAGCTTAAATTAGG - Intronic
958903492 3:99916185-99916207 TGGAACAGAAAGCTGAAGGCAGG + Intronic
960600712 3:119455365-119455387 GCTAACACAAAGCTTAAAATTGG - Intronic
963710928 3:148746650-148746672 GGGAACCCAAATATTAGGGTGGG + Intergenic
963768256 3:149361435-149361457 GGGCACATAAAGCTTAAGGTTGG - Intergenic
963960071 3:151299933-151299955 GGAAACACAAAGCTAAATGCTGG + Intronic
964055009 3:152443841-152443863 TGGAACACAAAACTTTAGCTAGG + Intronic
964085495 3:152812612-152812634 GGGAAGACAAACCCTAAGGGAGG + Intergenic
964164239 3:153682338-153682360 GTGGACACAAAGGTTGAGGTTGG - Intergenic
964606335 3:158564454-158564476 GCGAACACAGAGGTTCAGGTAGG - Intergenic
967100878 3:186215015-186215037 GGGGACACAGAACTCAAGGTAGG + Intronic
970934388 4:21551756-21551778 GGGAACAAAAATTCTAAGGTAGG - Intronic
971152607 4:24049777-24049799 GGGCACGCAGAGCTTAAAGTGGG - Intergenic
974566029 4:63579141-63579163 GGGAACCCAAAGCTTACTGATGG - Intergenic
975325388 4:73053339-73053361 GGGAAATCAAAACTTAAGGGGGG + Intergenic
975327897 4:73080716-73080738 GTGAACACAGAGGTTAAGGTAGG - Intronic
977276466 4:94983182-94983204 GGGAAAACAAAGCTTTAGACAGG - Intronic
981527758 4:145723338-145723360 GTGAACACAAAACATAATGTTGG - Intronic
984183338 4:176512330-176512352 GGGAACGCAAAGGTTATGGATGG - Intergenic
988407693 5:30845058-30845080 GGTACCACAAAGCAAAAGGTGGG + Intergenic
990449252 5:55919527-55919549 GGGAAAACAAAGCACAAGATAGG - Intronic
990526934 5:56637337-56637359 TGGAAGACAAGGCTTGAGGTTGG - Intergenic
993004185 5:82412909-82412931 GGGAACACAAGTCTGAATGTGGG - Intergenic
993916599 5:93751109-93751131 TGCTACAAAAAGCTTAAGGTAGG + Intronic
994540445 5:101089358-101089380 AGGAACACAAAGGTGAATGTGGG + Intergenic
994625625 5:102215145-102215167 GGGTAAACAAAGCATAAGTTAGG - Intergenic
995588639 5:113675025-113675047 GTGGACACAAAGGTTGAGGTTGG + Intergenic
1000644746 5:163747678-163747700 GGGAAAAAAAAATTTAAGGTAGG - Intergenic
1005599422 6:27411520-27411542 ATGAACACAAAGCATAATGTAGG + Intergenic
1005986979 6:30881723-30881745 GGGCACACACAGCAAAAGGTGGG - Intronic
1006909368 6:37554286-37554308 GGGAACACACAGAGAAAGGTAGG + Intergenic
1009490869 6:64289150-64289172 GGAAACACACAAATTAAGGTGGG - Intronic
1011111316 6:83839530-83839552 GTAAACACAGAGCTTAAGTTTGG - Intergenic
1015985373 6:138879294-138879316 GTGAACAGAAAGCTCAAGGAAGG - Intronic
1018210245 6:161474436-161474458 GGAAACACCAAACTTCAGGTAGG - Intronic
1019294299 7:265869-265891 GAGACCACAGAGCTGAAGGTGGG + Intergenic
1023306785 7:38838913-38838935 GGGGACTGATAGCTTAAGGTGGG - Intronic
1025150911 7:56548624-56548646 GGGAAGAAAAAGATTAAGGGAGG + Intergenic
1025737919 7:64169567-64169589 GGGAAGAAAAAGATTAAGGGAGG - Intronic
1025766177 7:64453629-64453651 GGGAAGAAAAAGATTAAGGGAGG - Intergenic
1032921598 7:136555267-136555289 GGGAAGACAAAGCTTAGGTCAGG - Intergenic
1033483965 7:141769917-141769939 TGCTACAAAAAGCTTAAGGTAGG + Intronic
1040892472 8:52331538-52331560 GGGAAGACACAGCTTTAGGTAGG + Intronic
1040978251 8:53217736-53217758 GGGCACACAGAGCTGGAGGTGGG - Intergenic
1043679958 8:83011053-83011075 GGGAACTCAAAACTTGAGCTTGG + Intergenic
1044029477 8:87216730-87216752 GGTAAAACAAAGCTAAAGGTTGG - Intronic
1044479704 8:92671158-92671180 GGGAAAGCAAAGCATGAGGTAGG - Intergenic
1044732106 8:95237422-95237444 GGGAACTCAAACCTTGAAGTTGG + Intergenic
1047005015 8:120611204-120611226 AGGAATCCAAAGCTTAAGGGTGG - Intronic
1048872797 8:138812855-138812877 GGGAATCCAGAGCTTAGGGTTGG - Intronic
1049792548 8:144478620-144478642 GCCCACACAAAGCTTAAGTTTGG - Intronic
1051069516 9:13147521-13147543 GCGAACACAAAGGGCAAGGTAGG - Intronic
1051600030 9:18863372-18863394 GGAAACCCAAAGCTTACGCTAGG + Intronic
1053153159 9:35755734-35755756 GGGAGCACAAAGCAGGAGGTGGG - Exonic
1055769450 9:79701864-79701886 GGGAACCCACAGCCTAAAGTGGG + Intronic
1058077410 9:100664807-100664829 AGGAACTCAAAGCTCAAGATAGG + Intergenic
1058374020 9:104302944-104302966 CAGAACCCAAAGCTTAAAGTAGG - Intergenic
1058976294 9:110128041-110128063 GGGAACCCGAAGCATAAGGAAGG - Intronic
1060957290 9:127651496-127651518 AGAAACACAAAGCCTAAGGTGGG + Intronic
1186648686 X:11535527-11535549 GAGGAGAAAAAGCTTAAGGTGGG - Intronic
1186807206 X:13152326-13152348 AGGAATACCAAGCTGAAGGTGGG + Intergenic
1188341429 X:29006601-29006623 GGCAAGACAAAGCTAAAGGATGG - Intronic
1189384166 X:40523702-40523724 GTGAAGACAAAGGTTAAGGAAGG - Intergenic
1197958928 X:131982775-131982797 AGGAACATAAATCTTAATGTTGG + Intergenic
1198245535 X:134827714-134827736 GGGAACAGAAAGGTTCAGGGTGG - Intronic
1198522039 X:137462805-137462827 GGGAACACAACTCTTACTGTTGG + Intergenic
1199672628 X:150159783-150159805 GAGAACACAAAGCTCCAAGTTGG + Intergenic