ID: 930365699

View in Genome Browser
Species Human (GRCh38)
Location 2:50436587-50436609
Sequence TATCTGCCCTGAAACCTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 99}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930365699_930365700 14 Left 930365699 2:50436587-50436609 CCAGATAGGTTTCAGGGCAGATA 0: 1
1: 0
2: 0
3: 8
4: 99
Right 930365700 2:50436624-50436646 AAGTGTGACTTTTCAGAACAAGG 0: 1
1: 0
2: 2
3: 14
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930365699 Original CRISPR TATCTGCCCTGAAACCTATC TGG (reversed) Intronic
904435080 1:30489593-30489615 TATCTGAGCTGAAACCTCTCAGG - Intergenic
905111705 1:35599676-35599698 TCTCTGCCCTTAAAACTTTCTGG - Intronic
906415668 1:45619870-45619892 TTTCTGCCAGGAAACCTTTCAGG - Intergenic
909390562 1:75115972-75115994 TTTCTGTCCTGTAAACTATCAGG + Intergenic
910888689 1:91994534-91994556 TAACTTCCATGACACCTATCTGG + Intronic
919789906 1:201284277-201284299 GATCTGCCCTGCATCCTGTCTGG + Intronic
920852727 1:209639515-209639537 GCTCTGCCATGAAACCTATGGGG - Intronic
921734995 1:218617280-218617302 TTACTGCCCTGAAAACTATTAGG + Intergenic
924073231 1:240305019-240305041 TATCTTCCCAGAATCCTTTCTGG + Intronic
1068392802 10:56420828-56420850 TATCTGCTGTCAAATCTATCTGG + Intergenic
1068437944 10:57015896-57015918 GCTCTGCCCAGAAACTTATCTGG - Intergenic
1073628731 10:105126315-105126337 CTTCTGCCCTGCAACCTCTCCGG + Intronic
1079177243 11:18153661-18153683 TATCTGCCCTGTGGCCCATCTGG + Intronic
1080183685 11:29453787-29453809 TATTTTCCCTGAAACTTCTCAGG + Intergenic
1081289798 11:41309977-41309999 TATCTGCCCTTAAACCTTCCTGG + Intronic
1083269944 11:61567090-61567112 TCTCTGTCCTGAAACCTTTCTGG - Intronic
1087229455 11:95643873-95643895 TACCTGCCCTGCATCCTATCAGG + Intergenic
1088451392 11:109984818-109984840 TATATGCCCTGAAACCAACTCGG - Intergenic
1088943382 11:114483815-114483837 TCTCTGCCCAGAGACCAATCAGG - Intergenic
1093989304 12:25572054-25572076 GATTTGCACTGAAACGTATCTGG - Intronic
1105224983 13:18423912-18423934 GATCTGCCCTGAGCCCTATGAGG - Intergenic
1106920718 13:34560710-34560732 TATCTTCCTACAAACCTATCAGG + Intergenic
1107876170 13:44792267-44792289 TATGTGCCAGGAAACCTACCAGG + Intergenic
1111017385 13:82399073-82399095 TATATTCCTTGAAACCTCTCTGG - Intergenic
1112388848 13:98964425-98964447 AATCTGCCCTGAATCCTGGCTGG - Intronic
1115369148 14:32592543-32592565 TATCTGCCTTGAAATGTACCTGG - Intronic
1117086066 14:52202671-52202693 TCTCTGCCCTGAATACTCTCAGG - Intergenic
1131803979 15:96102549-96102571 CTTCTGCCCTGAAATCCATCAGG - Intergenic
1135168142 16:20158436-20158458 TATCTGCACTGATACCTAATTGG - Intergenic
1140548362 16:75834945-75834967 TATGTGCCCTGATTCCTAACAGG + Intergenic
1149119706 17:53147640-53147662 TATCTCCTCTGAAAACAATCAGG - Intergenic
1149910224 17:60559989-60560011 GCTCTGCCCGGAAACTTATCCGG + Intergenic
1153194325 18:2576957-2576979 TCTCTGCCATGAAACCAATTTGG + Intronic
1154528380 18:15315610-15315632 GATCTGCCCTGAGCCCTATGAGG + Intergenic
1159864291 18:73686488-73686510 TATCTCCCTTAAAACCTTTCTGG - Intergenic
1166431107 19:42728867-42728889 TATCAGCCCTGAGCCCTATGTGG - Intronic
1166444110 19:42844108-42844130 TATCAGCCCTGAGCCCTATGTGG - Intronic
1166451548 19:42906666-42906688 TATCAGCCCTGAGCCCTATGTGG - Intronic
1166463791 19:43014860-43014882 TATCAGCCCTGAGCCCTATGTGG - Intronic
1166469943 19:43071444-43071466 TATCAGCCCTGAGCCCTATGTGG - Intronic
1166481078 19:43174959-43174981 TATCAGCCCTGAGCCCTATGTGG - Intronic
1166490660 19:43257946-43257968 TATCAGCCCTGAGCCCTATGTGG - Intronic
1167469250 19:49666258-49666280 GATTTGCCCTGAAACCTCTTGGG + Intronic
1167552046 19:50168016-50168038 TAGCTGCCCGCAAACCTCTCTGG + Intergenic
930365699 2:50436587-50436609 TATCTGCCCTGAAACCTATCTGG - Intronic
931929262 2:67110720-67110742 TATTTGCCCTGAGATCTATTGGG - Intergenic
933290589 2:80433854-80433876 TTTTTCCCCTGAAAACTATCAGG - Intronic
938527486 2:132147074-132147096 GATCTGCCCTGAGCCCTATGAGG + Intergenic
946969024 2:225071091-225071113 TTTCTGCCCTGAAGGCAATCTGG - Intergenic
948445019 2:238025867-238025889 TAAGTGCCCTGACATCTATCAGG - Intronic
1170696803 20:18666482-18666504 TATCTGCAATTAAATCTATCTGG - Intronic
1171101424 20:22387034-22387056 TATCTGGCCTGGAAAATATCTGG + Intergenic
1173419126 20:42884985-42885007 TACTTCCCCTGAAACATATCAGG + Intronic
1175929779 20:62488218-62488240 TATGTGCCCAGAAACCTGTGTGG - Intergenic
1176114859 20:63427762-63427784 CTTCTGCTCTGGAACCTATCAGG - Intronic
1176769034 21:13052930-13052952 GATCTGCCCTGAGCCCTATGAGG - Intergenic
1177651818 21:23968066-23968088 GCTCTGCCCAGAAACTTATCTGG + Intergenic
1180178847 21:46108826-46108848 TTTCTGGCCTGAAACCTCTATGG + Intronic
1180516145 22:16146998-16147020 GATCTGCCCTGAGCCCTATGAGG - Intergenic
1183666684 22:39250194-39250216 TATCTGCCCTGCAAGCTGGCTGG + Intergenic
1184669688 22:46006230-46006252 TATCTGACTTCAAACCTCTCCGG + Intergenic
952419589 3:33119034-33119056 TTTCTCCCCTCAAACCTGTCAGG + Intronic
954047513 3:47945494-47945516 TATCTGGCCTGATACCTAGGTGG + Intronic
954878999 3:53821366-53821388 TATCTGCCCTGAAGCCCCACTGG - Intronic
958186179 3:90122190-90122212 CATCTACCCTGACACTTATCAGG - Intergenic
963486955 3:145946929-145946951 TATATGTCCTCAAAGCTATCTGG + Intergenic
964703682 3:159595853-159595875 ACTCTGCCATGAAACCTATCTGG - Intronic
964852199 3:161106397-161106419 TATCTGCAGTGAAACCTGTCTGG - Intronic
966379370 3:179328089-179328111 TTTCTGCCTTGAAACCTGACTGG + Intronic
968229499 3:196997003-196997025 CAGCTGCCCTGAAACTTCTCAGG + Intronic
970206012 4:13656154-13656176 ACGCTGCCCTGAAACATATCTGG + Intergenic
971127145 4:23766525-23766547 TATCTGCCGTGAAATCTGTCAGG + Intronic
982190496 4:152849978-152850000 TATCTGCCCTGACACTTTTTTGG + Intronic
983735888 4:171059520-171059542 TATCTGCCATGAATCTCATCTGG - Intergenic
983910858 4:173237160-173237182 CATCTGCCCTGAAAGCTTTGAGG + Intronic
987029662 5:13964207-13964229 TGTCTGCTCTGAGTCCTATCTGG - Intergenic
987297945 5:16570652-16570674 TATCTGCCTTGACTCATATCTGG - Intronic
994409765 5:99392240-99392262 TAGCTTCCCTGAACCGTATCTGG - Intergenic
994484055 5:100373040-100373062 TAGCTTCCCTGAACCTTATCTGG + Intergenic
997534001 5:134602135-134602157 TTTCTGCCCTAAAATCTATTTGG + Exonic
997724035 5:136105441-136105463 TATCTACCCTGAGACATTTCTGG + Intergenic
998528053 5:142860497-142860519 TGACTGCCCAGAAACCAATCCGG - Intronic
998727513 5:145034507-145034529 GCTCTACCCTGAAACTTATCAGG - Intergenic
999214096 5:149917350-149917372 TATCTGCACTGAAATCTCTAGGG - Intronic
1000266252 5:159640987-159641009 TTTCTGCCCTGGAGCCTGTCTGG - Intergenic
1002837874 6:880601-880623 CCTCTGCCATGAAACCTTTCTGG - Intergenic
1004289497 6:14353097-14353119 CATTTGCCCTTAAACCTAACAGG - Intergenic
1004413373 6:15402109-15402131 CCTTTGCCCTGAAACCTCTCTGG - Intronic
1004449827 6:15735109-15735131 TATGTCCCCTGAAACTTAACAGG + Intergenic
1005661298 6:28001733-28001755 GCTCTGCCCAGAAACTTATCTGG - Intergenic
1011549057 6:88512732-88512754 TATATGCTCTGAAAACTACCAGG - Intergenic
1012703464 6:102493304-102493326 TATCTGCCCTAGACCCTTTCTGG - Intergenic
1014285661 6:119494595-119494617 CATCTGCCTTGAAACCTTTGAGG - Intergenic
1020747035 7:12091251-12091273 GCTCTGCCCAGAAACTTATCCGG - Intergenic
1024798870 7:53052477-53052499 AATGTGCCCTGAAACACATCCGG + Intergenic
1024968702 7:55049474-55049496 TATCAGCCCTTAAACATCTCTGG + Intronic
1028729162 7:94125458-94125480 AATCTACCTTGAAAACTATCTGG - Intergenic
1030548650 7:110931236-110931258 TCCCTGGCCTGAAACATATCAGG + Intronic
1039508011 8:38066248-38066270 TTTCAGCCCCAAAACCTATCAGG + Intergenic
1041615062 8:59897087-59897109 AATCAGCCCTGAAACCTGTCAGG + Intergenic
1048877683 8:138849963-138849985 TATCTGCCCTGCAAACCATGAGG - Intronic
1052087291 9:24283568-24283590 TATCAACACTGAAACGTATCAGG - Intergenic
1053706168 9:40754347-40754369 GATCTGCCCTGAGCCCTATGAGG + Intergenic
1054416244 9:64877952-64877974 GATCTGCCCTGAGCCCTATGAGG + Intergenic
1189774587 X:44459207-44459229 CAACTACCCTGAAACCTTTCAGG - Intergenic
1192158318 X:68763316-68763338 TACCTGCCCTGAAATCTTGCTGG - Intergenic
1194707778 X:97196361-97196383 TATCTGCTCTGAAGCCAAGCAGG + Intronic
1195871214 X:109488455-109488477 TTTCTGCCCTGAACCCTGACTGG + Intergenic