ID: 930369752

View in Genome Browser
Species Human (GRCh38)
Location 2:50487892-50487914
Sequence TGGCATTTCCTGTGAATTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 7, 3: 22, 4: 246}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930369746_930369752 23 Left 930369746 2:50487846-50487868 CCCTCGCATCTGCACAGAAGGTA 0: 1
1: 0
2: 0
3: 4
4: 83
Right 930369752 2:50487892-50487914 TGGCATTTCCTGTGAATTCCTGG 0: 1
1: 0
2: 7
3: 22
4: 246
930369747_930369752 22 Left 930369747 2:50487847-50487869 CCTCGCATCTGCACAGAAGGTAA 0: 1
1: 0
2: 0
3: 4
4: 75
Right 930369752 2:50487892-50487914 TGGCATTTCCTGTGAATTCCTGG 0: 1
1: 0
2: 7
3: 22
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930369752 Original CRISPR TGGCATTTCCTGTGAATTCC TGG Intronic
901661443 1:10800337-10800359 TGGTAATTCCTGGGAAGTCCTGG - Intergenic
905854611 1:41300400-41300422 TGTCTTGTGCTGTGAATTCCTGG + Intergenic
906107982 1:43306008-43306030 TCACATTTCCTGTCAATTCACGG - Intronic
908723463 1:67150173-67150195 TGGTCTCTCCTCTGAATTCCAGG + Intronic
910213684 1:84819971-84819993 TAGCATTTCCTGAGAACTCTGGG + Intronic
910277250 1:85462954-85462976 TGTCCTGTCCTGTGAATTTCAGG + Intronic
911325412 1:96465677-96465699 TGGCAGTTACCGTGAATTGCAGG + Intergenic
913226818 1:116707874-116707896 TTTTATTTCCTGTGAATTACTGG - Intergenic
913228044 1:116717783-116717805 TAGCATTTGTTGAGAATTCCAGG - Intergenic
913455610 1:119027469-119027491 TGGCATTTGCTCTTAATTACTGG - Intergenic
915745611 1:158154677-158154699 TGGCATTTCTGGTACATTCCTGG + Intergenic
916149774 1:161775661-161775683 TGTCATTTGCTGAGAATTTCTGG + Intronic
917722652 1:177800697-177800719 TGGCATTTCATGGGAATTCCTGG + Intergenic
917741939 1:177969437-177969459 TGGCCTTTCCTGGGATTTGCTGG - Intronic
918348157 1:183624887-183624909 AAGCATTTCCTGTGGATCCCAGG - Intronic
918638668 1:186811695-186811717 TGGCATATTGTGTGACTTCCTGG - Intergenic
919077136 1:192827207-192827229 AGTCATTTCCTTTCAATTCCTGG - Intergenic
921328576 1:214012825-214012847 TGGAACTTCCTGGGTATTCCTGG - Intronic
921875463 1:220190920-220190942 TGGTTTTTCCTGTGAGTGCCTGG - Intronic
922703304 1:227774948-227774970 TGGCGTTTCCTGTGCACGCCTGG + Intronic
923307466 1:232701528-232701550 TGCCCTTTCCTGTGAGTTCCAGG + Intergenic
923548673 1:234943787-234943809 TGGCATTCCCTTTGAATAGCTGG - Intergenic
1066255771 10:33677182-33677204 TGGGATTTTCTGAGAGTTCCAGG - Intergenic
1067538619 10:47135642-47135664 TGACATTTACGGTGAGTTCCAGG + Intergenic
1067763109 10:49064795-49064817 CGGCATTTCCTTGTAATTCCTGG - Intronic
1068655859 10:59575887-59575909 TTGCATTTCCTGTTAAGTCCTGG + Intergenic
1071221110 10:83465146-83465168 AGACTTTTCCTGTGAATGCCGGG - Intergenic
1072411515 10:95206823-95206845 TGGCTTTTGCTGTGGATTTCTGG - Intronic
1073971265 10:109047414-109047436 AGCCTTTTCCTGTAAATTCCAGG - Intergenic
1076624888 10:131815764-131815786 GGGCACCTCCTGTGAATGCCTGG - Intergenic
1077239652 11:1503860-1503882 TGTCACTTCCAGTGAAGTCCAGG - Intergenic
1078671693 11:13371370-13371392 TGGGATTTGCTGTGAATATCAGG - Intronic
1079906525 11:26254989-26255011 TGGGATTTGATTTGAATTCCGGG - Intergenic
1080007886 11:27429032-27429054 TGGCATTTCTTCTCAATTCTAGG - Intronic
1081286635 11:41278649-41278671 TTGCATTTCCATTAAATTCCTGG + Intronic
1081305168 11:41502846-41502868 TGGCATTACCTGTCATTACCTGG + Intergenic
1081699437 11:45143856-45143878 TGGCATTTCCTGAGAACTTAAGG - Intronic
1088178214 11:107078622-107078644 TGGTAATTTCAGTGAATTCCTGG - Intergenic
1091088142 11:132743619-132743641 TGGCTTTTCCTTTGGATTCCAGG - Intronic
1091477299 12:788059-788081 TGGGATTTCCTGAGAAATCCTGG - Intronic
1092215435 12:6678574-6678596 TGGGATTTCCTGTGTACTCTGGG - Intronic
1092615968 12:10215743-10215765 TGCCTTTTCCTTTTAATTCCTGG + Intronic
1093709414 12:22312893-22312915 TTTCATTTCTTGTGAATTACTGG + Intronic
1099021431 12:77409482-77409504 TGGAATTACCTGTGAATTATGGG + Intergenic
1103317207 12:120065645-120065667 TGGCATTCTCTGTGCATGCCAGG + Intronic
1104126920 12:125856387-125856409 TGGCATTTCATGTTAATCCTGGG + Intergenic
1106684163 13:32039982-32040004 TGGCATTAGCTGAGAAATCCTGG - Intronic
1106967453 13:35088545-35088567 TGGCTTTTCCAGTGTATTCTGGG + Intronic
1108039751 13:46329129-46329151 TGACATTTCCCCTGAATTCATGG + Intergenic
1108877865 13:55070908-55070930 TTGAATTTCCTATGGATTCCAGG + Intergenic
1109402570 13:61854383-61854405 TTACATTCTCTGTGAATTCCAGG + Intergenic
1110997861 13:82136581-82136603 TGGTATTTCATGTTAATTGCAGG - Intergenic
1111196405 13:84879824-84879846 TTGTATATCCTGTGAATTTCAGG + Intergenic
1111714449 13:91862484-91862506 GGGCATTTCTTGTGAATTGCAGG - Intronic
1112415047 13:99197243-99197265 TGACCTTTACTATGAATTCCTGG - Intergenic
1112435141 13:99386596-99386618 TGGCATTACCTGTGCAAACCTGG + Intergenic
1113154840 13:107308137-107308159 TGAGATTTCCAGTGATTTCCTGG - Intronic
1113626732 13:111853305-111853327 TGGAATTGCCTGTGAATTGCTGG - Intergenic
1113819936 13:113206170-113206192 ATGCATTTACTGTGAATTCATGG + Intronic
1114387502 14:22270150-22270172 AGACATTTCCTATTAATTCCAGG - Intergenic
1116730700 14:48618182-48618204 TGGAACTTCCTGTGGATTACTGG - Intergenic
1116779542 14:49221457-49221479 TGGCATATACAGTGAAGTCCTGG - Intergenic
1117658384 14:57979787-57979809 TGGCTTTCCCTGTGAGTTGCTGG + Intronic
1117839026 14:59838363-59838385 AGTTATTTCCTGTGAATTCCTGG - Intronic
1118478341 14:66140047-66140069 TGTCAGTTCCTGTGAACTCCAGG - Intergenic
1119185429 14:72638322-72638344 TGACATTTGCTGTGCATTCCAGG + Intronic
1119854266 14:77887461-77887483 AGGCAGTTCCTGGGAACTCCAGG - Intronic
1122694211 14:103545011-103545033 TGGCTTGTCCTCTGAATTCTAGG - Intergenic
1123736283 15:23187399-23187421 GGGCATTTCCTGTGAATTGCAGG - Intergenic
1124286990 15:28410372-28410394 GGGCATTTCCTGTGAATTGCAGG - Intergenic
1124295711 15:28501255-28501277 GGGCATTTCCTGTGAATTGCAGG + Intergenic
1124789848 15:32717738-32717760 TGTGATTTGCTGTGCATTCCAGG + Intergenic
1126694157 15:51312169-51312191 TGTCCTTTCCAATGAATTCCAGG - Intronic
1131328096 15:91468636-91468658 TGGCCTGCCCTGTGAATTTCAGG - Intergenic
1131823423 15:96295751-96295773 AGCCATTTCCTGTGACTTCGTGG + Intergenic
1134156774 16:11850769-11850791 TAGCATTTACTGAGAACTCCTGG + Intronic
1135055522 16:19228893-19228915 TAGCATTTGCCGTGAATCCCTGG + Intronic
1136694512 16:32065854-32065876 TGGAAATTCCTGGGAATTCTGGG - Intergenic
1136795009 16:33009118-33009140 TGGAAATTCCTGGGAATTCTGGG - Intergenic
1136874903 16:33845264-33845286 TGGAAATTCCTGGGAATTCTGGG + Intergenic
1137734860 16:50716322-50716344 TGTCATTTCCTAAGGATTCCAGG + Intronic
1138627487 16:58264189-58264211 AGCCAGTTCCTGTGACTTCCAGG + Intronic
1138631367 16:58296547-58296569 AGGCATTTCCTGAGCTTTCCAGG + Intronic
1138948470 16:61881332-61881354 TGACTTTTCCTCTGAGTTCCAGG - Intronic
1139892162 16:70260272-70260294 GGGCATTGCCTTTGATTTCCTGG - Intronic
1140922126 16:79549204-79549226 TGGCATTTCCTGAGCAGTCATGG + Intergenic
1141055908 16:80813806-80813828 TTTCATTTCCTGTGTGTTCCTGG - Intergenic
1141355650 16:83344173-83344195 TGGCATTTCCAGTGAATCACGGG - Intronic
1203097270 16_KI270728v1_random:1270773-1270795 TGGAAATTCCTGGGAATTCTGGG - Intergenic
1143291611 17:5835756-5835778 TGGCCTATCCTGTGAATTTTAGG - Intronic
1147320689 17:39644093-39644115 TAGCATTTCCTGTGGATTATGGG + Intronic
1149045857 17:52244591-52244613 TGGCATCTCCTCTGAGCTCCAGG + Intergenic
1149299863 17:55295336-55295358 GATCATTTCCTGTGAATTACTGG - Intronic
1149445531 17:56710446-56710468 TGGCATTGCCTGTAAATTCCCGG - Intergenic
1150313402 17:64148127-64148149 TGGCGTTTCCTGTGTCCTCCAGG - Exonic
1150611971 17:66740333-66740355 TGGTGTTTCCTGAGACTTCCTGG - Intronic
1150919320 17:69466628-69466650 TAGCAATCCCTGTGAATGCCGGG + Intronic
1151258366 17:72897521-72897543 TGGCATTTCTTCTGAATTAGGGG - Intronic
1151484436 17:74389626-74389648 TGGCTCTTCCTGGGCATTCCCGG - Intergenic
1151497132 17:74464905-74464927 TGGCATTTCCTGTGCCCACCTGG + Intergenic
1155676925 18:28440850-28440872 TGGCAGTTTCTGTGAATACCTGG + Intergenic
1157245639 18:46051980-46052002 TGGCATTCCCTGAGAACCCCTGG + Intronic
1157407307 18:47432956-47432978 TGGCATCCCCTGTGAAATCAGGG - Intergenic
1157486354 18:48090141-48090163 TGGTTTTTCCTGTGAGTCCCCGG + Intronic
1159619118 18:70617289-70617311 TTGCATATCCTGTGCATTCAAGG + Intergenic
1160196365 18:76758804-76758826 TTGCATTTCCAGTCACTTCCAGG - Intergenic
1162845698 19:13390822-13390844 TCCCATTTCCTGTGAATCCTTGG - Intronic
1163202101 19:15776905-15776927 TGGTATATCATGGGAATTCCTGG + Intergenic
1163330226 19:16631789-16631811 TGGCTTTTTCTGTTAATCCCTGG - Intronic
1163405415 19:17119032-17119054 TGGCCATTCCTCTGAACTCCTGG - Intronic
1167737810 19:51307664-51307686 TGGGATCTGCTGTGAAGTCCAGG - Intergenic
1167786494 19:51642077-51642099 TGAGATTTCCTTTGAATTCACGG - Intronic
1168690382 19:58373152-58373174 TGGGTTTTCCTGAGACTTCCCGG + Intronic
928599841 2:32893674-32893696 TGGCATATCATGGGACTTCCTGG - Intergenic
928914876 2:36459917-36459939 TGGGATTGTCTGTGAAGTCCAGG + Intronic
930369752 2:50487892-50487914 TGGCATTTCCTGTGAATTCCTGG + Intronic
930393767 2:50794046-50794068 TGGAATGTCCTGTGAATTTTAGG - Intronic
931510337 2:62984893-62984915 TGCCATTTCCTGGGTATCCCTGG + Intronic
932462368 2:71891265-71891287 GTGCATTTCCTGTGCCTTCCTGG - Intergenic
933134484 2:78715563-78715585 TGACATTTGCTTTGATTTCCCGG + Intergenic
935308299 2:101759335-101759357 TGGCATTTCCTCTGAGTTGGCGG + Intronic
936369357 2:111890655-111890677 TGTCATTTCCTGGGAATGGCTGG - Intergenic
936371893 2:111908812-111908834 GGGCATTTCATTTGCATTCCAGG + Intronic
937337210 2:121069334-121069356 TGGCCTGTCCTCTGAACTCCTGG - Intergenic
937394763 2:121525049-121525071 TGGCCTCTCCTGTGAAATCTTGG - Intronic
939257854 2:139767722-139767744 TGTCATTTTCTGTGAAATTCAGG + Intergenic
939668435 2:144979357-144979379 TATCATTTTCTCTGAATTCCTGG + Intergenic
941542249 2:166801397-166801419 TGGCATTTCCTTTGAGCTGCAGG - Intergenic
941990803 2:171555183-171555205 AGTCATTTCCTGTTAATTCTGGG + Exonic
942078510 2:172379271-172379293 TGGCATTGTCTTTGAATCCCTGG + Intergenic
942695039 2:178632652-178632674 TGTCATCACCTGTGATTTCCTGG + Exonic
942824080 2:180152818-180152840 TTGCATTTCTGGTGTATTCCTGG + Intergenic
944383216 2:199135864-199135886 TGGGTTTTCTTATGAATTCCAGG + Intergenic
944591967 2:201226162-201226184 TGGTATTTCCTTTTAATTACTGG - Intronic
944781088 2:203017387-203017409 TGGAATTTTCTTTGACTTCCTGG + Intronic
945200727 2:207278288-207278310 TGGCTTTCCCTGTGATTCCCAGG + Intergenic
945342610 2:208675070-208675092 TAGCATTTCCTGTGACCTGCAGG - Intronic
946663762 2:222028459-222028481 TGGGTTTTCATGTAAATTCCAGG - Intergenic
946988416 2:225300920-225300942 TGGCATTTCCTGTGGAGTGTGGG - Intergenic
947610249 2:231520752-231520774 TGGCATTTCCAGATCATTCCTGG - Intergenic
947664096 2:231892341-231892363 TTGCATTTCCTGTGGGTTCTGGG - Intergenic
947804854 2:232959274-232959296 CGGTGTTTCCTGTAAATTCCTGG + Intronic
947892333 2:233635675-233635697 TGGCATCACCTCTGACTTCCAGG + Intronic
948851240 2:240707563-240707585 TGGCAGTTCTAGTGAATTGCTGG - Intergenic
1169537240 20:6558357-6558379 TCGCATTTCATGTTAATTCCTGG - Intergenic
1170571209 20:17633884-17633906 TGCCGTTTTCTGTGAATTTCTGG - Intronic
1170963226 20:21043971-21043993 TTGAATTGGCTGTGAATTCCTGG - Intergenic
1172202363 20:33135498-33135520 TGGCTCTTTCTGTGAATTTCAGG - Intergenic
1172916729 20:38448898-38448920 TGGCCTTTCCTGTGCCTTCCGGG + Intergenic
1173118497 20:40269083-40269105 TCGCATCCCCTGTGACTTCCAGG + Intergenic
1173119300 20:40274341-40274363 TCGCATCCCCTGTGACTTCCAGG + Intergenic
1173428968 20:42968614-42968636 TGGCATTTCCTGGAGTTTCCGGG + Intronic
1173469349 20:43310596-43310618 TCTCATTTCCTGTGTAATCCTGG + Intergenic
1174051879 20:47772632-47772654 TGGCATTTCCAATGTAGTCCAGG + Intronic
1175099066 20:56565292-56565314 TGACATTTCCTGTATCTTCCAGG + Intergenic
1175501414 20:59453573-59453595 TGGCCTGTCCTGTGCATTGCAGG + Intergenic
1176197692 20:63844895-63844917 TGGCATCTGCTGTGATTTCAGGG - Intergenic
1177600495 21:23304441-23304463 TGGCATTTCTTATGACTCCCAGG - Intergenic
1178162669 21:29938220-29938242 TGGCATATTCTGTTAGTTCCTGG + Intronic
1179617370 21:42590587-42590609 AGGCAGTCCCTCTGAATTCCAGG - Intergenic
1180018349 21:45102529-45102551 TGCCATTTCCTTGGCATTCCTGG - Intronic
1180594188 22:16962904-16962926 TGGCAGTGTCTGTGAGTTCCTGG + Intronic
1181725048 22:24805936-24805958 CACCATTTCCTGTGACTTCCTGG + Intergenic
1182064141 22:27418389-27418411 TGGCATTCCCACTGAATTCCAGG - Intergenic
1182383512 22:29914219-29914241 TGGCAATGCATGAGAATTCCAGG + Intronic
950419677 3:12891483-12891505 TGGCATATCCTGGGGCTTCCTGG - Intergenic
951834298 3:26964025-26964047 TTGCATTTCTAGTGAGTTCCTGG - Intergenic
954682660 3:52354237-52354259 TGGCATTTACTGTGTCATCCTGG - Intronic
959669836 3:108963986-108964008 TGTCATTGCCTGTGAATTACTGG - Intronic
961038808 3:123662724-123662746 TAGCCTTTCCTGTGTGTTCCTGG - Intronic
963628030 3:147697711-147697733 TGCCATTTCCATTGAATTCTTGG - Intergenic
965856478 3:173094695-173094717 TGGCTTTTACTGTCAAATCCTGG + Intronic
966040279 3:175476426-175476448 TTCCCTTTCCTGTGAATTCTAGG - Intronic
966104663 3:176322018-176322040 TGGCATCTCCTGTGACTTGCAGG - Intergenic
966105449 3:176327312-176327334 TCGCATCTCCTGTGACTTGCAGG - Intergenic
967155236 3:186685752-186685774 AGGCATTTCTGGTGAATTCATGG + Intergenic
967158288 3:186713160-186713182 AGGCATTCCTGGTGAATTCCTGG + Intergenic
968986230 4:3876067-3876089 TGGAAAGTCCTCTGAATTCCAGG + Intergenic
969317060 4:6388686-6388708 TGGCATTTCCGGGCATTTCCAGG - Intronic
971456712 4:26852012-26852034 GGGCTTTTCCTCTGAATTCCTGG + Intergenic
971488860 4:27190316-27190338 TGGCAAGTCTTGTGAATTTCTGG - Intergenic
971742107 4:30534291-30534313 TAGCATCTGCTGTGAATTCAAGG + Intergenic
972220242 4:36947120-36947142 TGACATTTCTTGTGATCTCCAGG - Intergenic
972521148 4:39858238-39858260 TGATATTTCCTGTGAATTTTAGG - Intronic
974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG + Intronic
974625469 4:64421624-64421646 TGGCATTTTCTCAGAGTTCCTGG - Intergenic
975651859 4:76601323-76601345 GGGCCTTTCCTGTGCATTGCAGG - Intronic
976133002 4:81904892-81904914 TTGCATTTCCTCTGAGTCCCTGG - Intronic
977985016 4:103373015-103373037 TGGCATGTCATGGGAATTCTGGG - Intergenic
979979626 4:127238399-127238421 TGGATTTTCCTTTGATTTCCAGG - Intergenic
982301946 4:153888401-153888423 TGAGATTTCATGTGAAATCCAGG + Intergenic
983538234 4:168880686-168880708 TGGCAGTTCCTGCAAGTTCCAGG - Intronic
983578003 4:169279335-169279357 TGGCAATCCATGTGATTTCCTGG - Intergenic
984178682 4:176453284-176453306 TGGCATTTCTAATGAATTGCTGG + Intergenic
984527732 4:180876609-180876631 AGGAATTTCCTTTGAAATCCTGG - Intergenic
985661355 5:1158675-1158697 TGGAATTTCCTAGAAATTCCAGG + Intergenic
985999403 5:3618505-3618527 TGGCATTTCCTCTGAATGGGAGG - Intergenic
986315810 5:6585595-6585617 TTGCCTTCCCTGTGAATTTCAGG - Intergenic
987031038 5:13977297-13977319 TGGCTTTTCCAGTGAGGTCCCGG - Intergenic
987814957 5:22887952-22887974 TAGTAATTCCTTTGAATTCCTGG - Intergenic
988916463 5:35899190-35899212 TGTCATTTTCTCTCAATTCCGGG + Intergenic
990430098 5:55726112-55726134 TGGAATTTGTTGTCAATTCCTGG - Intronic
990811548 5:59730657-59730679 TGGCATCTTCTGTGGCTTCCAGG + Intronic
991565594 5:68001074-68001096 TGACATTCCCTTTGACTTCCTGG - Intergenic
992084517 5:73265887-73265909 TGGAATTTCCTGGGAAGTCAGGG + Intergenic
992336705 5:75777838-75777860 TGGCATCACCTCTGAATTCCAGG + Intergenic
993015970 5:82534962-82534984 AGACTTTCCCTGTGAATTCCTGG - Intergenic
993057946 5:83003973-83003995 TGGCGTTGCATCTGAATTCCTGG - Intergenic
993184371 5:84598079-84598101 TTGCATTTCCTGTGAATTGCTGG - Intergenic
993668153 5:90726869-90726891 TAGCCTTTCCTCTGTATTCCAGG + Intronic
995681969 5:114730359-114730381 TGGCATTTGGTGAGAATTTCAGG - Intergenic
996146475 5:119983138-119983160 TGGCATAACCTGAGAATTTCTGG + Intergenic
996175185 5:120347698-120347720 TGGCTTTTCCAGTGATTGCCTGG - Intergenic
996324885 5:122261514-122261536 TAGCATTTCAGGAGAATTCCCGG + Intergenic
997534630 5:134609198-134609220 TGGCATGTCCTATCATTTCCAGG + Intronic
998123169 5:139596187-139596209 TGGCGTTTCTTGTGTATTCTTGG + Intronic
999702550 5:154241238-154241260 TGGCAGTTCCTTAGAATTCTGGG + Intronic
1002582106 5:180215236-180215258 TGGCTTTTCCTAGGCATTCCAGG - Intergenic
1004299316 6:14442894-14442916 GGGGCTTTCCTGCGAATTCCAGG + Intergenic
1004900238 6:20186780-20186802 TGGCTTTTCCTCTGAATTTCTGG - Intronic
1005175257 6:23037150-23037172 TTGCAGTCCCTTTGAATTCCTGG - Intergenic
1005715729 6:28545664-28545686 TCTCATTTCCTGTGACTTCTAGG - Intergenic
1007759002 6:44121266-44121288 TGGCATTTCATGCCACTTCCTGG + Intronic
1009027695 6:58019690-58019712 TGGGTTTTCCTTTCAATTCCAGG + Intergenic
1009203229 6:60771167-60771189 TGGGTTTTCCTTTCAATTCCAGG + Intergenic
1009341981 6:62567120-62567142 TGGCATTTACAGTGAAATCCTGG - Intergenic
1011413788 6:87095166-87095188 TGGAATTTCCTGTTGATCCCAGG - Intergenic
1011699894 6:89946205-89946227 TTTCCTTTCCTGTGAATTGCTGG - Intronic
1012191380 6:96284426-96284448 GGGAATTTTCTGTGAAATCCTGG - Intergenic
1014681352 6:124434105-124434127 TGGCATTTGCTGTGTTCTCCAGG + Intronic
1016095964 6:140037533-140037555 TGGCCTTTTCTGTAAATTTCAGG + Intergenic
1019256992 7:58937-58959 AGGCATCTCCTGTTCATTCCCGG + Intergenic
1020552430 7:9623417-9623439 TGTCATTTATTGTGAAATCCAGG - Intergenic
1021009253 7:15441792-15441814 TGTCTTTTCCTAAGAATTCCTGG - Intronic
1021162769 7:17297529-17297551 TGGGAGTTCCTGTGAACTTCGGG + Intergenic
1026329137 7:69336902-69336924 CTGCATTCCCTGGGAATTCCAGG + Intergenic
1028307985 7:89290444-89290466 TGGCATTTTCTGGGCCTTCCTGG + Intronic
1029898310 7:104010374-104010396 TGGCCTGCCCTGTGATTTCCAGG + Intergenic
1032590717 7:133189841-133189863 TGGAATTTGCTTTGAGTTCCAGG - Intergenic
1034311894 7:150095667-150095689 TGTCTTTTTCTGTGCATTCCTGG - Intergenic
1034794963 7:154004991-154005013 TGTCTTTTTCTGTGCATTCCTGG + Intronic
1035328606 7:158082130-158082152 TCGCATTTCCTGTCTGTTCCAGG - Intronic
1035545306 8:477519-477541 TGGGATTTCCTTTGAATCCGTGG + Intergenic
1036396739 8:8377058-8377080 AGGCATTACCTGTGCATACCTGG + Exonic
1036930415 8:12951301-12951323 GGGCATTTCCGCTGAAGTCCGGG + Intronic
1037920683 8:22803323-22803345 TGGCCTCTCCTGGGAGTTCCAGG + Intronic
1039234911 8:35491414-35491436 TGGCATTTCTTGTGTAAGCCAGG - Intronic
1039368708 8:36961888-36961910 TGTCATTTCCTGTAAATTTTAGG + Intergenic
1039957351 8:42217773-42217795 TTGCATGTCCTGTGGCTTCCTGG + Intergenic
1040418550 8:47218404-47218426 TGGAATTTCCTGGGAATTCCAGG - Intergenic
1043020022 8:74988700-74988722 TGGCATGTGCTGGTAATTCCAGG + Intronic
1043777718 8:84290702-84290724 TGGCATCCCCTGTGACTTGCAGG - Intronic
1044920099 8:97160632-97160654 TGAGATTTCATGTGAATTTCAGG + Intergenic
1046173013 8:110536981-110537003 TGTCATTTACTGTGAATTTTAGG + Intergenic
1047249054 8:123167799-123167821 TGGCATTTACTGGGAGGTCCAGG + Intergenic
1047860094 8:128956436-128956458 TGGGATTTCCCCTGAACTCCTGG - Intergenic
1048175141 8:132145123-132145145 GGGAATTTCCTGTGCATTGCAGG - Intronic
1053351464 9:37416128-37416150 CTGCATTTCCTTTGAGTTCCCGG - Intergenic
1056004076 9:82248438-82248460 TGGCATTTCGATTGAATTTCTGG - Intergenic
1056424230 9:86460594-86460616 TTTCATTTCCTGTGCAGTCCTGG + Intergenic
1056568544 9:87796300-87796322 TGTCATTTCCTTTCATTTCCTGG - Intergenic
1188963966 X:36527797-36527819 TGGCTTTTTGTGTGAATCCCCGG - Intergenic
1189374528 X:40456444-40456466 TGGCCTGTCCTGTGAATTTCAGG + Intergenic
1190165885 X:48072437-48072459 TGGTATAGGCTGTGAATTCCGGG - Intergenic
1190796906 X:53754400-53754422 TAGAAATTCCTCTGAATTCCAGG + Intergenic
1192913187 X:75627102-75627124 TTGCATTTCCTTTGGATTCCTGG + Intergenic
1194122262 X:89975830-89975852 TGGCCTTTGCTGTGTCTTCCTGG + Intergenic
1194997339 X:100605543-100605565 TGGTATTTCTTGTGATTTCATGG - Intergenic
1195318769 X:103704239-103704261 TTGCTTTGCCTGTGAATTCTGGG + Intergenic
1196149388 X:112355758-112355780 TGGCACTTTCTGTGAAATTCAGG - Intergenic
1196978764 X:121188473-121188495 TGGTATATCTTGTGAAATCCTGG - Intergenic
1198390486 X:136169075-136169097 CGGCATTTGGTGTGAATTCTAGG + Intronic
1198628623 X:138608423-138608445 TTGCATTTCCCATGAATTTCAGG + Intergenic
1199953950 X:152727619-152727641 TGGCCTTGCCTGGGAATTACTGG + Exonic
1200475121 Y:3633265-3633287 TGGCCTTTGCTGTGTCTTCCTGG + Intergenic
1201568144 Y:15387425-15387447 AGACATTTCCTGTAAATGCCAGG + Intergenic