ID: 930372701

View in Genome Browser
Species Human (GRCh38)
Location 2:50524189-50524211
Sequence GTCCCTGAGGACGGGTGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 676
Summary {0: 1, 1: 0, 2: 5, 3: 74, 4: 596}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930372694_930372701 26 Left 930372694 2:50524140-50524162 CCCAGAGATCATGAGTTTATTAA 0: 1
1: 0
2: 0
3: 28
4: 230
Right 930372701 2:50524189-50524211 GTCCCTGAGGACGGGTGTGGTGG 0: 1
1: 0
2: 5
3: 74
4: 596
930372693_930372701 27 Left 930372693 2:50524139-50524161 CCCCAGAGATCATGAGTTTATTA 0: 1
1: 0
2: 1
3: 20
4: 275
Right 930372701 2:50524189-50524211 GTCCCTGAGGACGGGTGTGGTGG 0: 1
1: 0
2: 5
3: 74
4: 596
930372695_930372701 25 Left 930372695 2:50524141-50524163 CCAGAGATCATGAGTTTATTAAA 0: 1
1: 0
2: 1
3: 16
4: 270
Right 930372701 2:50524189-50524211 GTCCCTGAGGACGGGTGTGGTGG 0: 1
1: 0
2: 5
3: 74
4: 596

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930372701 Original CRISPR GTCCCTGAGGACGGGTGTGG TGG Intronic
900331376 1:2136353-2136375 GTGACTGAAGAGGGGTGTGGTGG + Intronic
900423786 1:2567136-2567158 CTGCCTGAAGCCGGGTGTGGTGG - Intergenic
900425885 1:2578426-2578448 GGCCATGTGGGCGGGTGTGGGGG - Intergenic
900862368 1:5242781-5242803 CTCCGTGAGGCTGGGTGTGGTGG - Intergenic
901055137 1:6445786-6445808 GTGCCTGGGGGCGGGGGTGGCGG - Exonic
901082326 1:6590525-6590547 GCCCCAGAGGCTGGGTGTGGTGG - Intergenic
901097399 1:6693199-6693221 ATTCCTGAGGTTGGGTGTGGTGG - Intronic
901690911 1:10972797-10972819 GTCTCTGTGGCTGGGTGTGGTGG + Intronic
902064160 1:13670575-13670597 AACCCTGTGGCCGGGTGTGGTGG + Intergenic
902173209 1:14629745-14629767 GGCACTGAAGAAGGGTGTGGTGG + Intronic
902223178 1:14979668-14979690 GGCCCTGAGGACTTGTGGGGAGG + Intronic
902281393 1:15377298-15377320 TTCCCTGAGGGTGGGAGTGGAGG + Intronic
902363988 1:15958917-15958939 GTCACTGAGGCCTGGTGTGGTGG - Intronic
902479232 1:16702828-16702850 GTGCCTGGGGGCGGGGGTGGCGG + Intergenic
902951004 1:19882721-19882743 GTGCCGGGGGACGGGTGAGGCGG + Exonic
903140553 1:21336405-21336427 TTCACTGAGGCCGGGCGTGGTGG + Intronic
903165248 1:21515674-21515696 GTCACTGGGGCCAGGTGTGGTGG - Intronic
903900890 1:26644399-26644421 ATCCCTGAGGCCAGGTGTGGTGG - Intergenic
904188305 1:28723218-28723240 GTTCCTGGGGCCGGGTGTGGTGG + Intergenic
904370527 1:30045016-30045038 GGCACTGAGGACTGGTGTGGAGG - Intergenic
904605048 1:31693416-31693438 GTGCTTGGGTACGGGTGTGGGGG - Intronic
904624886 1:31796842-31796864 TTCCCAGAGGAGGGGTATGGCGG - Intronic
904696661 1:32335330-32335352 GCCCCGGGGGACGGGGGTGGGGG - Intronic
904762208 1:32813605-32813627 GTATCTGAGGCCAGGTGTGGTGG - Intronic
905126551 1:35719471-35719493 GTCACTGAGGCCGGGTGCGGTGG + Exonic
905481782 1:38266746-38266768 GTTCCAGAGGAGGGATGTGGAGG - Intergenic
905917287 1:41694648-41694670 GTCTCTGAGGACAGGTGTTGGGG - Intronic
907034861 1:51207242-51207264 CTCACTGGGGCCGGGTGTGGTGG - Intergenic
907065902 1:51482751-51482773 CTTCCTAAGGCCGGGTGTGGTGG - Intronic
907198826 1:52708759-52708781 GTCCCCTGGGCCGGGTGTGGTGG + Intergenic
907257157 1:53188443-53188465 GACCCTGAGGCCGGGCGTGGTGG + Intergenic
907450232 1:54541643-54541665 GTCCATCAGGCCGGGCGTGGTGG - Intergenic
907667478 1:56446180-56446202 GGGGCTGAGGCCGGGTGTGGTGG - Intergenic
908354986 1:63320132-63320154 CTCCCTGGGGAAGGGGGTGGAGG - Intergenic
908530676 1:65030817-65030839 GTCACTGAGGCCAGGTGCGGTGG - Intergenic
909076438 1:71054655-71054677 GACCCTAAGGACAGGGGTGGGGG - Intergenic
909108799 1:71448309-71448331 GTGGCTGAGGCTGGGTGTGGTGG + Intronic
909357230 1:74723731-74723753 GACCCTGAAGACGGGTTGGGTGG + Intronic
912664248 1:111564797-111564819 GTCTCACAGGCCGGGTGTGGTGG - Intronic
913223627 1:116679531-116679553 TTGCCTGAGGACAGCTGTGGGGG + Intergenic
913681093 1:121187233-121187255 GGCGCTGAGGCCGGGTGCGGCGG - Exonic
914032923 1:143974873-143974895 GGCGCTGAGGCCGGGTGCGGCGG - Intergenic
914046523 1:144098050-144098072 GTCCCAGAGGCCGGGTGCAGTGG + Intergenic
914131587 1:144862636-144862658 GTCCCAGAGGCCGGGTGCAGTGG - Intergenic
914156523 1:145093093-145093115 GGCGCTGAGGCCGGGTGCGGCGG + Exonic
914225184 1:145714185-145714207 AGCCCTGAGGTCAGGTGTGGTGG + Intergenic
914800679 1:150960184-150960206 GTCCCCGTGGCCGGGTGCGGTGG + Intronic
915115350 1:153595152-153595174 GTGCCTGAGGCTGGGAGTGGTGG + Intergenic
915433539 1:155885869-155885891 GGCCTTGAGGCCGGGTGCGGTGG - Intergenic
915460315 1:156066649-156066671 GTCTCTTAGGCCGGGTGTGTTGG + Intronic
915625158 1:157109895-157109917 GCTCCTGAGGCCGGGGGTGGTGG - Intergenic
916253300 1:162759980-162760002 GTCAGTGGGGTCGGGTGTGGTGG + Intronic
916273135 1:162965754-162965776 ATCCATGAGCACTGGTGTGGAGG - Intergenic
917683164 1:177388442-177388464 GACACTGAGGCTGGGTGTGGTGG - Intergenic
918525757 1:185463122-185463144 GTTCCTGGGGACGGGTGAGATGG + Intergenic
920364329 1:205440164-205440186 GTCCCTGAGGAGGGGAGTCAGGG + Intronic
920676570 1:208042363-208042385 GTACCTGGGGTGGGGTGTGGTGG + Exonic
922143167 1:222910501-222910523 GTCCCAGAGGGAAGGTGTGGTGG + Intronic
923229048 1:231966575-231966597 CCCCCTGAGGATGGGTGTAGTGG + Intronic
923445532 1:234067412-234067434 GTCTCTGAGCAAGGGTGTGGTGG + Intronic
923755881 1:236790851-236790873 TAACCTGAGGCCGGGTGTGGTGG + Intergenic
924742115 1:246800501-246800523 GTCACTGAGGATGGCTGGGGAGG + Intergenic
1063466354 10:6247616-6247638 GTTCCTTAGGAGGGGTCTGGAGG - Intergenic
1063466376 10:6247702-6247724 GTTCCTTAGGAGGGGTCTGGAGG - Intergenic
1063496080 10:6509694-6509716 GTTCCTGGGGCCGGGTGTGGTGG - Intronic
1064390814 10:14940573-14940595 GTGCATGAGGCTGGGTGTGGTGG - Intronic
1064393477 10:14960737-14960759 GTGCCCGAGGCCGGGCGTGGTGG + Intronic
1064401182 10:15022554-15022576 GTGCATGAGGCTGGGTGTGGTGG - Intergenic
1064411484 10:15108470-15108492 GAGCCTGAGGCCGGGCGTGGTGG - Exonic
1064828105 10:19429280-19429302 GTCACTTAGGCCGGGCGTGGTGG + Intronic
1066373830 10:34839578-34839600 GTCTCTAAGGCCGGGTGTGGTGG - Intergenic
1067044041 10:42974598-42974620 GTCCCTGGGGAAGGGGCTGGAGG + Intergenic
1067208016 10:44236097-44236119 CTCTGTGAGGTCGGGTGTGGTGG + Intergenic
1068493567 10:57755771-57755793 TTTCCTGAGGACAGATGTGGAGG - Intergenic
1069560046 10:69422873-69422895 GTTCTTGAGGAAGGGGGTGGGGG + Intergenic
1069657504 10:70100902-70100924 GTTCCAGTGGCCGGGTGTGGTGG - Intronic
1069764937 10:70848747-70848769 GTACATGAGGCCAGGTGTGGTGG - Intronic
1070951364 10:80433842-80433864 GAACCTGAGGTCAGGTGTGGTGG + Exonic
1072003344 10:91219163-91219185 GTACCTGAGGATGAATGTGGAGG - Intronic
1072098505 10:92206358-92206380 CTTTCTGAGGCCGGGTGTGGTGG - Intronic
1072358083 10:94632096-94632118 CTACCTGAGGCCAGGTGTGGTGG - Intergenic
1072488737 10:95882110-95882132 GTGCCAGAGGCCGGGCGTGGTGG - Intronic
1072647974 10:97274176-97274198 GTTCCTGAGGCCGGGCGCGGTGG + Intronic
1072802034 10:98398846-98398868 GCTCCTCAGGCCGGGTGTGGTGG + Intronic
1072867667 10:99081079-99081101 AGGCCTGAGGCCGGGTGTGGTGG - Intronic
1073481457 10:103788577-103788599 GTCCCTGAGGCCGGGTGCGGTGG + Intronic
1074772202 10:116741839-116741861 GTCCCTGGGGATGGGCGGGGAGG + Intronic
1075035668 10:119064995-119065017 ATACCCGAGGATGGGTGTGGTGG - Intronic
1075063354 10:119272287-119272309 GTGCATGAGGCCGGGCGTGGTGG + Intronic
1075563600 10:123486854-123486876 TGCCCTGAGGCTGGGTGTGGTGG + Intergenic
1076705364 10:132298407-132298429 GACTCTGAGGACGGCTGTGGTGG + Intronic
1077009245 11:372876-372898 GTGTTTGAGGACTGGTGTGGGGG + Exonic
1077225874 11:1438938-1438960 CTCCCTGAGGCTGGGTCTGGGGG - Intronic
1077270768 11:1678633-1678655 CTCCCTGGGGCCGGGCGTGGTGG - Intergenic
1077380877 11:2236831-2236853 GGCCCTGTGGACAGGGGTGGAGG - Intergenic
1077401080 11:2357805-2357827 GGCCCTGTGGACGGGGGTGGAGG - Intergenic
1077694495 11:4382081-4382103 GTACCTAAGGTTGGGTGTGGTGG + Intergenic
1078058287 11:8025506-8025528 TTCCCTGAGGATGGGTGGAGTGG - Intronic
1078141582 11:8697051-8697073 CTTCCAGAGGCCGGGTGTGGTGG - Intronic
1079216060 11:18513013-18513035 GTCCTTGAGGCTGGGTGGGGTGG - Intronic
1080012003 11:27469560-27469582 TTCCCTGGGGACAGGGGTGGGGG - Intronic
1080471001 11:32545775-32545797 ATACCTGAGGCTGGGTGTGGTGG + Intergenic
1081484466 11:43516766-43516788 GATGCAGAGGACGGGTGTGGGGG + Intergenic
1081578973 11:44339066-44339088 TTCCCAGAGGCCGGGGGTGGGGG + Intergenic
1083608677 11:63994536-63994558 GTCACTGAGGCTGGGTGTGGTGG - Intronic
1083669815 11:64293307-64293329 ATCCCTGAGGACGGGTGCAGTGG + Intronic
1084150556 11:67286111-67286133 GTCCCTGAGCCCGGGTGCTGGGG - Exonic
1084185952 11:67471312-67471334 GAACATGAGGCCGGGTGTGGTGG - Intergenic
1084556839 11:69880573-69880595 GTCCCTGAGGACAATTGGGGAGG - Intergenic
1084626328 11:70310669-70310691 GTACATGGGGCCGGGTGTGGTGG - Intronic
1084681854 11:70670930-70670952 GTCTCTGGGCACGGGTGTGCGGG - Intronic
1084918968 11:72453745-72453767 GTCCCAGAGGCCGGGCATGGTGG - Intergenic
1084948124 11:72649968-72649990 GTTCCTGAGGACGGCGGTTGGGG - Intronic
1085278136 11:75313063-75313085 CTCCCTCAGGCCAGGTGTGGTGG + Intronic
1085498715 11:76997011-76997033 GTAACAGAGGCCGGGTGTGGTGG - Intronic
1085753064 11:79178740-79178762 GACCCTGTGGGTGGGTGTGGGGG - Intronic
1089155784 11:116401334-116401356 GTCGCTGAGGACTGGTGAGGTGG - Intergenic
1089157451 11:116413456-116413478 GTGCCTGGGGAAGGGAGTGGTGG - Intergenic
1090482536 11:127080863-127080885 GTCCCTGGGGTGGGGTGGGGTGG + Intergenic
1091260739 11:134232172-134232194 GTCCCTGAGGACTGGTGATTGGG + Intronic
1091361773 11:134983674-134983696 GTCCCTGTCCCCGGGTGTGGGGG - Intergenic
1091402606 12:189826-189848 GTCCCAGGGGGCGGGTGTGGGGG - Intergenic
1091533341 12:1381484-1381506 GCCATTGAGGACGGCTGTGGTGG - Intronic
1091680680 12:2524612-2524634 GGGCCTGAAGACCGGTGTGGTGG - Intronic
1091834886 12:3578682-3578704 GCCACTAAGGACGGGGGTGGGGG + Intronic
1092499154 12:9028727-9028749 GACACTGAGGCCGGGTGCGGTGG - Intergenic
1092831683 12:12450136-12450158 GTCGCTTAGGACAGGTGTGGTGG + Intronic
1094248837 12:28335691-28335713 AATCCTGAGGACAGGTGTGGTGG - Intronic
1094298993 12:28939770-28939792 GTCCCTGCAGAAGAGTGTGGAGG - Intergenic
1095180917 12:39145453-39145475 GGCGCTGAGGACGCGTGTGCGGG + Intergenic
1095500311 12:42830307-42830329 GTCCCTGCGGTGGGGAGTGGAGG + Intergenic
1096302820 12:50446712-50446734 GTCCACTAGGCCGGGTGTGGTGG - Intronic
1096326445 12:50666732-50666754 TTGCCTGAGGCCGGGCGTGGTGG + Intronic
1096480047 12:51934087-51934109 GAACCTGAGGCCGGGCGTGGTGG - Intergenic
1096538117 12:52288246-52288268 GTCCCTGAGGCTGTGTGAGGGGG - Intronic
1096540660 12:52305120-52305142 GTCCCTGAGGCTGTGTGAGGGGG + Intronic
1097425445 12:59438469-59438491 TACCATGAGGTCGGGTGTGGTGG - Intergenic
1099341234 12:81437518-81437540 GTCCCATAGGCCAGGTGTGGTGG - Intronic
1099695628 12:86015094-86015116 GACACAGAGGCCGGGTGTGGTGG - Intronic
1100298198 12:93282351-93282373 GTCCTTGAGGCCGGGCGTGGTGG + Intergenic
1100298243 12:93282665-93282687 GTCCTTGAGGCCAGGTGTGGTGG + Intergenic
1100550865 12:95645088-95645110 GTCCCTGAGGCCAGGCGTGGTGG - Intergenic
1100687513 12:97003216-97003238 GTCCTTGAGGAGGGGCTTGGAGG + Intergenic
1101130727 12:101688671-101688693 GTACTTGAGGCTGGGTGTGGTGG + Intergenic
1101176894 12:102161391-102161413 TTACCTGAGGCTGGGTGTGGTGG - Intronic
1101352053 12:103939388-103939410 GACCCAGAGGACTGGTGTGGTGG - Intronic
1102023991 12:109703063-109703085 GCCTCTGAGGCCAGGTGTGGTGG + Intergenic
1102117755 12:110416249-110416271 TGCTCTGAGGCCGGGTGTGGTGG + Intergenic
1102332319 12:112044752-112044774 ATACATGAGGACAGGTGTGGTGG + Intronic
1102456007 12:113071254-113071276 GCCCCTGAGACCGGGTGTGGGGG - Intronic
1102487935 12:113270764-113270786 GTCCCAGAGGCCGGGCGCGGTGG - Intronic
1102496059 12:113320410-113320432 GTCCCTGAAGAAGGGCCTGGAGG + Exonic
1102699284 12:114825219-114825241 TTCCCTGGGGCCGGGTGTGGTGG + Intergenic
1103116142 12:118334586-118334608 GTTTCGGAGGCCGGGTGTGGTGG + Intronic
1103206319 12:119131897-119131919 GTGCCTAAGGAAGGGTGAGGTGG + Intronic
1103710992 12:122912532-122912554 TTCCTTGAGGCCGGGCGTGGTGG - Intergenic
1103738889 12:123078280-123078302 GACCCTGAGGCCTGGTATGGGGG - Intronic
1104093173 12:125532800-125532822 GTTCCTAAGGCCGGGTGTGGTGG - Intronic
1104745983 12:131210844-131210866 CTCCCTGGGGAGGGGTGTGTGGG + Intergenic
1105471733 13:20701342-20701364 GTCCTTGAGGCCGGGCATGGTGG - Intergenic
1105526126 13:21179323-21179345 ATAGCTGAGGCCGGGTGTGGTGG + Intergenic
1105840044 13:24246570-24246592 GTGACTCAGGCCGGGTGTGGTGG + Intronic
1105949995 13:25221346-25221368 TTCCCTGTGGCCAGGTGTGGTGG - Intergenic
1106037003 13:26052091-26052113 GTCCCTGAGGTCGGGGGTGGGGG - Intergenic
1106118633 13:26838711-26838733 GTCCCTGCGGACGGAAGTGTTGG + Intergenic
1107296351 13:38913322-38913344 GTCATTTAGGCCGGGTGTGGTGG - Intergenic
1107419710 13:40234869-40234891 ATCCCTGAGGCCGGGCGCGGTGG - Intergenic
1107681934 13:42861181-42861203 GTCCATGGGAGCGGGTGTGGTGG - Intergenic
1107951443 13:45465408-45465430 CTGCCTGGGGACGGCTGTGGGGG + Intronic
1109364056 13:61332563-61332585 GACACTGAGGACAGGTGTGTTGG - Intergenic
1110143296 13:72157956-72157978 ATTCCTGAGGCCGGGTGCGGTGG - Intergenic
1110484333 13:76020121-76020143 GTCCCTGAGCACAGGCCTGGGGG + Intergenic
1110561626 13:76916068-76916090 GTCTCTGTGGCTGGGTGTGGTGG - Intergenic
1110617587 13:77558524-77558546 GTACCGGAGGCCGGGCGTGGTGG + Intronic
1110840023 13:80131415-80131437 GTCCCTGGGGGCGGGGCTGGTGG - Intergenic
1110914175 13:81000339-81000361 GATCAAGAGGACGGGTGTGGTGG - Intergenic
1111081205 13:83309955-83309977 GTCTCTGGGGCCAGGTGTGGTGG - Intergenic
1113013033 13:105792984-105793006 ATACCTGAGGCCGGGTGTGGTGG + Intergenic
1114467871 14:22937236-22937258 TTCATTGAGGCCGGGTGTGGTGG - Intergenic
1114797637 14:25734801-25734823 GGACCTGAAGCCGGGTGTGGTGG + Intergenic
1115252052 14:31359437-31359459 TAGCCTGAGGCCGGGTGTGGTGG + Intronic
1115651228 14:35404146-35404168 GGCCTAGAGGACGGGTCTGGGGG + Intronic
1115676155 14:35677053-35677075 GTCCCTTGGGCCGGGTGTGGTGG + Intronic
1116837712 14:49787396-49787418 GTACCTTAGGCTGGGTGTGGTGG + Intronic
1117147125 14:52846652-52846674 GTGCCTGTGGCCAGGTGTGGTGG - Intergenic
1117571238 14:57051085-57051107 GTCCTTGATGCTGGGTGTGGTGG - Intergenic
1118201332 14:63676694-63676716 TTTCCTGAGGCTGGGTGTGGTGG - Intergenic
1119038614 14:71252126-71252148 TTTCCTGAGGCCGGGTGCGGTGG + Intergenic
1119381726 14:74233525-74233547 GTCTCTGAGGACCAGTGAGGAGG - Intergenic
1119822444 14:77629418-77629440 GTATCTGGGGCCGGGTGTGGTGG + Intergenic
1120014969 14:79462084-79462106 CTCTCAGAGGCCGGGTGTGGTGG + Intronic
1120513775 14:85446219-85446241 GTGGCTCAGGACGGGTGCGGTGG - Intergenic
1120825383 14:88950262-88950284 ATTCCTGAGGGTGGGTGTGGTGG + Intergenic
1120857420 14:89224841-89224863 GAACTTAAGGACGGGTGTGGTGG + Intronic
1120996530 14:90422214-90422236 GTCCCAGTGGCCAGGTGTGGTGG - Intergenic
1121013215 14:90533905-90533927 GGCCCTGAGGCCCTGTGTGGTGG + Exonic
1121509474 14:94501669-94501691 GTCCCTTGGGGCGGGGGTGGGGG - Intronic
1122348700 14:101075781-101075803 AACCCTGAGGATGGGTGTGGGGG + Intergenic
1122397214 14:101441976-101441998 GCCCGAGAGGAGGGGTGTGGTGG - Intergenic
1122543653 14:102510780-102510802 GCCTCTGAGAACGTGTGTGGGGG - Intergenic
1122791664 14:104186435-104186457 GAGCCTGCGGTCGGGTGTGGGGG - Intergenic
1122836762 14:104434409-104434431 GGCCCTCTGGACTGGTGTGGGGG + Intergenic
1124405037 15:29384699-29384721 GTCTCGGAGGTTGGGTGTGGAGG - Intronic
1125556228 15:40587641-40587663 GTTCCTTAGGAGGGGTGTGAGGG - Intergenic
1125981405 15:44005192-44005214 ATACCTGAGGCTGGGTGTGGTGG + Intronic
1126215660 15:46151617-46151639 GGCACTGAAGGCGGGTGTGGTGG + Intergenic
1126609969 15:50519425-50519447 CACCCTGAGGCCGGGTGCGGTGG + Intronic
1126650367 15:50914361-50914383 GTCTATGTGGACGGGTGTGGTGG + Intronic
1126965044 15:54042564-54042586 CTTACTGAGGCCGGGTGTGGTGG + Intronic
1127522153 15:59753818-59753840 ATCCCTTAGGCCAGGTGTGGTGG + Intergenic
1127848047 15:62888591-62888613 GTCAATGAGGCCGGGTGTGGTGG - Intergenic
1127951089 15:63807031-63807053 ATCACTCAGGCCGGGTGTGGTGG - Intronic
1127967919 15:63937574-63937596 GTCTCTGAAGAGGGGTGGGGAGG - Intronic
1128325259 15:66719902-66719924 GTCACTGGGGAGGGGGGTGGTGG + Intronic
1128546745 15:68573530-68573552 ATCCCTGAGGAAGTGTGGGGAGG + Intergenic
1128742656 15:70095057-70095079 ATCCCTGAGGAGGGGAGTGGAGG + Intronic
1129218473 15:74116271-74116293 CTCCATAAGGACAGGTGTGGTGG + Intronic
1129405874 15:75317291-75317313 GTCAATGAGGCCAGGTGTGGTGG - Intergenic
1130584329 15:85168773-85168795 GCCCCTGGGGGCGGGGGTGGGGG + Intergenic
1131097761 15:89666794-89666816 GGCACTGAGGACTGGAGTGGGGG + Intronic
1131395897 15:92085754-92085776 GTCCTTGGGGACAGGTGGGGAGG - Intronic
1131727082 15:95238417-95238439 GTCTGTGAGGCTGGGTGTGGTGG - Intergenic
1132044712 15:98553789-98553811 GTGCTTGAGGCCAGGTGTGGTGG + Intergenic
1132486600 16:195708-195730 ATCCTTGAGGCTGGGTGTGGTGG - Intronic
1132752028 16:1462239-1462261 ATCCATGAGGCCGGGTGCGGTGG + Intronic
1133336985 16:5012615-5012637 CTACCTGAGGCCGGGTGTGGTGG + Intronic
1134011470 16:10856518-10856540 CTACCTGTGGACGGGTGCGGTGG - Intergenic
1134019797 16:10913599-10913621 CTCACTGAGGCCGGGTGTGGTGG - Intronic
1134204694 16:12227610-12227632 GTCTCTGAGGCCGGGCGCGGTGG + Intronic
1134278266 16:12795794-12795816 GTCACTGAGGCCAGGCGTGGTGG + Intronic
1134441268 16:14301161-14301183 GTCCCTGGGCAGGGGTGTGGGGG + Intergenic
1135025729 16:18997660-18997682 GTGCCTGAGGCCGGGTGCGGTGG - Intronic
1135309683 16:21395787-21395809 TCCCCTGAGGCCAGGTGTGGTGG - Intergenic
1135522195 16:23186224-23186246 GACTCTGAGGACGGGCGTGCTGG - Exonic
1136306427 16:29374911-29374933 TCCCCTGAGGCCAGGTGTGGTGG - Intergenic
1136649071 16:31650666-31650688 GACAGTGAGGCCGGGTGTGGTGG + Intergenic
1137879384 16:52030975-52030997 TTCCCTGAGGCAGAGTGTGGTGG - Intronic
1138481234 16:57304654-57304676 CTCCTTGAGGCCAGGTGTGGTGG + Intergenic
1138765641 16:59599576-59599598 GTAGCTGAGGCTGGGTGTGGTGG - Intergenic
1139531184 16:67543456-67543478 GTTCCTGGGGACAGGTGAGGGGG + Exonic
1139746816 16:69081625-69081647 GGAACTGAGGCCGGGTGTGGTGG - Intronic
1139804330 16:69551204-69551226 GTGGCAGAGGCCGGGTGTGGTGG + Intergenic
1139875316 16:70141335-70141357 TTCTCTTAGGCCGGGTGTGGTGG - Intronic
1139916094 16:70429304-70429326 ATCCCTGAGGCCGGGTAAGGTGG + Intronic
1141471390 16:84240945-84240967 ATCACTTAGGCCGGGTGTGGTGG + Intergenic
1141675474 16:85515240-85515262 GACCCTGAGGACGGGGATGGGGG - Intergenic
1141741563 16:85896840-85896862 GTCTCAGAGGACGGGAGGGGAGG - Intergenic
1142243446 16:88957534-88957556 TACACTGAGGACAGGTGTGGGGG - Intronic
1142597020 17:1034848-1034870 CTCCCTGCCGCCGGGTGTGGGGG + Intronic
1142707277 17:1703656-1703678 GTCTATGAGGCCGGGCGTGGTGG - Exonic
1142851452 17:2706739-2706761 GTCCCTGAGAAAGGCTGTGCTGG + Intronic
1142981897 17:3677254-3677276 GCCTCTGAGGAGGGGTGGGGAGG + Intronic
1143315799 17:6032623-6032645 ATCCCTGAGGCCGGGCGCGGTGG + Intronic
1143745698 17:8992498-8992520 ACCCCTGAGGCCGGGCGTGGTGG + Intergenic
1144488473 17:15687018-15687040 GGCCCTGATCACGGGTGTGGGGG + Intergenic
1144523375 17:15969161-15969183 GTCCCTTTGGCCGGGCGTGGAGG + Intronic
1144622209 17:16824767-16824789 GGTTCTGAGAACGGGTGTGGGGG - Intergenic
1144912539 17:18695287-18695309 GGCCCTGATCACGGGTGTGGGGG - Intergenic
1145768411 17:27475259-27475281 GTCTCTGAGCACAGGTGTGAAGG + Intronic
1145907450 17:28524211-28524233 GTCCCTGAGGACTTGTTTGCTGG - Intronic
1146181923 17:30703911-30703933 CCCCCTGAGGACGGGCGCGGTGG + Intergenic
1146781894 17:35681688-35681710 CACCCTGAGGCCAGGTGTGGTGG - Intronic
1146887676 17:36483346-36483368 GGCCATTAGGACGGGTCTGGAGG + Intergenic
1147272437 17:39284669-39284691 GTCCCTGAGGCCAGGCGTGATGG - Intronic
1147337590 17:39736983-39737005 TTCCCTCAGGCCGGGCGTGGTGG + Intergenic
1147376921 17:40027853-40027875 GGCCCTGAGGAGGGGTGTGGCGG - Intronic
1147428463 17:40357267-40357289 GTGGCTGAGGCCGGGGGTGGGGG - Intronic
1147474511 17:40697551-40697573 GTTCCTGAGGACGCGCTTGGGGG + Intergenic
1147611609 17:41804996-41805018 ATACTTGAGGCCGGGTGTGGTGG + Intronic
1148469728 17:47885483-47885505 GAGCCTCAGGAGGGGTGTGGGGG + Intergenic
1148657982 17:49302672-49302694 ATACATGAGGACGGGTGTGGTGG + Intronic
1148871222 17:50659695-50659717 GACACTGGGGCCGGGTGTGGTGG + Intronic
1148890575 17:50804265-50804287 GTGCCTGATGCCGGGCGTGGTGG - Intergenic
1149296033 17:55263818-55263840 GTCGCTGGGGAAGGATGTGGTGG - Intergenic
1150123250 17:62620340-62620362 CTCCCTAAGGCTGGGTGTGGTGG + Intergenic
1150288832 17:63969928-63969950 GTACCTGAGGCCAGGTGTGGTGG - Intronic
1150500824 17:65649427-65649449 GTGCATGAGGCCAGGTGTGGTGG + Intronic
1150641947 17:66955194-66955216 CTCTCTGAGGCCGGGTGCGGTGG + Intergenic
1150839076 17:68591384-68591406 GTCCTTGGGGCCGGGTGCGGTGG - Intronic
1151221963 17:72619567-72619589 GCAACTGAGGCCGGGTGTGGTGG - Intergenic
1151385486 17:73752839-73752861 GTCCCAGGGGTCGGGTGTGGCGG + Intergenic
1151457240 17:74233286-74233308 AGCCCTGAGGACTGGTGTGCTGG - Intronic
1151552559 17:74830402-74830424 GGCCGTGAGGACAGATGTGGAGG + Intronic
1151601864 17:75110673-75110695 GTCCTTGGGGCCGGGCGTGGTGG + Intronic
1151676823 17:75602959-75602981 CTCCCTGGGGTCTGGTGTGGCGG - Intergenic
1151961654 17:77408877-77408899 CTCCCTGAGGCAGGGTGTGCAGG + Intronic
1152085780 17:78217461-78217483 CTTCCTGAGGCCAGGTGTGGTGG - Intronic
1152312400 17:79559140-79559162 CTCCCTGAGGATGGGAGGGGCGG + Intergenic
1152622274 17:81371104-81371126 GACACTGAGGACGGGCGCGGTGG + Intergenic
1152780153 17:82224001-82224023 GTCTCTGTGCACGGGTGTAGGGG - Intergenic
1152780163 17:82224061-82224083 GTGTCTGTGCACGGGTGTGGGGG - Intergenic
1153354892 18:4123723-4123745 GACCCTGAGGAAGGGAGAGGAGG - Intronic
1153634666 18:7103517-7103539 CTGCCTGAGGCCTGGTGTGGTGG + Intronic
1153805439 18:8705791-8705813 GTCCTTGAGGAAGGGTCTGGCGG - Intronic
1155961609 18:32000111-32000133 GTCCTTGAGGCCAGGTGCGGTGG - Intergenic
1156856976 18:41793372-41793394 GTTAATGAGGCCGGGTGTGGTGG + Intergenic
1157387054 18:47266268-47266290 GTCACTGAGGCCAGATGTGGTGG - Intergenic
1158447599 18:57534616-57534638 GTCTCTGAGGATGGTTCTGGTGG - Intergenic
1158449653 18:57552685-57552707 GTAGCTGAGGCCAGGTGTGGTGG - Intronic
1160254627 18:77237862-77237884 TTACTTTAGGACGGGTGTGGTGG - Intergenic
1160500078 18:79397063-79397085 GTCCCTGAAACCCGGTGTGGGGG + Intronic
1161102057 19:2426171-2426193 CTACCCAAGGACGGGTGTGGGGG + Exonic
1161190484 19:2952134-2952156 CTGCCTAAGGCCGGGTGTGGTGG + Intergenic
1161221522 19:3120248-3120270 GTCCCTGGGCAGGGGAGTGGCGG + Intronic
1161263761 19:3353116-3353138 CTCCATGAGGCCGGATGTGGTGG + Intergenic
1161265628 19:3362453-3362475 GTATCTGAGGTCAGGTGTGGGGG + Intronic
1161383433 19:3978516-3978538 GCCCCGGAGGCCGGGCGTGGTGG + Intronic
1161483026 19:4520107-4520129 AGCCCTGAGGAAGGGTGTGCGGG - Intergenic
1161566177 19:5004139-5004161 GTCCTGGAGGGCGGGTGTGCTGG + Intronic
1161634976 19:5382442-5382464 CTCACTGTGGCCGGGTGTGGTGG - Intergenic
1161715739 19:5875332-5875354 GCATCTCAGGACGGGTGTGGGGG - Intronic
1161789661 19:6351767-6351789 AACCCTTAGGCCGGGTGTGGTGG + Intergenic
1162110780 19:8398522-8398544 GACCCTGGGGACAGGGGTGGTGG + Intronic
1162424141 19:10583873-10583895 GTCCCTGGAGGTGGGTGTGGGGG - Intronic
1162524621 19:11200304-11200326 GCACCTGAGGCCGGGTGGGGTGG + Exonic
1162661473 19:12172724-12172746 ATCCCAGAGGCCGGCTGTGGTGG + Intronic
1163027675 19:14522330-14522352 AACACTGAGGCCGGGTGTGGTGG + Intronic
1163307293 19:16488693-16488715 GTACCTCAGGCCGGGTGTCGCGG - Intronic
1163535075 19:17872303-17872325 CTCCATGAGGGCGGGTGCGGAGG - Exonic
1163658171 19:18560293-18560315 GTTTCAGAGGCCGGGTGTGGTGG - Exonic
1164652012 19:29897592-29897614 GTCCCTGTGGCCAGGTGTTGGGG - Intergenic
1165077132 19:33286082-33286104 GTGCCCCAGGCCGGGTGTGGTGG - Intergenic
1165176344 19:33932952-33932974 GTCCCTGGGGCCGGGCGCGGTGG - Intergenic
1165714614 19:38036372-38036394 GTCCCTGGGGACGGGGAAGGAGG - Intronic
1166052028 19:40266083-40266105 GTCCCTGAGGACAGAAGTGAAGG - Intronic
1166068907 19:40376590-40376612 GAACCTGAGGACGGGTGTATAGG - Exonic
1166307920 19:41945616-41945638 GTCACTGAGGCCGGGGATGGGGG - Intergenic
1166864981 19:45830342-45830364 GTCTCTGAGGCACGGTGTGGCGG + Intronic
1167564483 19:50247776-50247798 GTCAGTGAGGCCGGGTGTGGGGG + Intronic
1168098386 19:54128286-54128308 GTACCTGGGGACGGGTGGGTGGG - Exonic
1168215926 19:54925709-54925731 GTCACTGAGGCCGGGCGCGGTGG + Intronic
1202686077 1_KI270712v1_random:51465-51487 GTCCCAGAGGCCGGGTGCAGTGG + Intergenic
1202713271 1_KI270714v1_random:28734-28756 GTGCCTGGGGGCGGGGGTGGCGG + Intergenic
925092969 2:1169775-1169797 GTGCCCGAGGACGTGTGGGGTGG - Intronic
926260893 2:11260158-11260180 GTTGCTTAGGCCGGGTGTGGTGG + Intronic
927730407 2:25466045-25466067 GTACTTAAGGCCGGGTGTGGTGG + Intronic
928139485 2:28715962-28715984 ATCCCTTGGGCCGGGTGTGGTGG - Intergenic
929105444 2:38360568-38360590 TTCCCCGAGGCTGGGTGTGGTGG - Intronic
929421816 2:41798422-41798444 TTCCTGGAGGCCGGGTGTGGTGG - Intergenic
929521891 2:42660372-42660394 GCCCCTCTGGCCGGGTGTGGTGG - Intronic
930055776 2:47250945-47250967 GTTCCTGATGACGGGTCGGGGGG - Intergenic
930185805 2:48411040-48411062 GTCCCTGAGGATAGGGATGGGGG - Intergenic
930287087 2:49444037-49444059 GTTACAGAGGGCGGGTGTGGTGG - Intergenic
930372701 2:50524189-50524211 GTCCCTGAGGACGGGTGTGGTGG + Intronic
930519525 2:52447820-52447842 ATACCTGAGGCCGGGCGTGGTGG + Intergenic
930788970 2:55303666-55303688 GTTCCTCAGGCCGGGCGTGGTGG - Intronic
931125488 2:59271582-59271604 TAACCTGAGGCCGGGTGTGGTGG - Intergenic
931240422 2:60447337-60447359 GCCACAGAGGCCGGGTGTGGTGG + Intergenic
931726804 2:65119216-65119238 GTTCTTGAGGCCTGGTGTGGTGG + Intronic
932012579 2:67993134-67993156 GTTACTGGGGCCGGGTGTGGTGG - Intergenic
932198474 2:69804756-69804778 GTTCTTGAGGCCAGGTGTGGTGG + Intronic
932446376 2:71784235-71784257 GTCGCAGAGGCTGGGTGTGGTGG + Intergenic
932471616 2:71962961-71962983 CTCCCGGAGGAAGGGTGAGGAGG + Intergenic
932932296 2:76056588-76056610 GTTCAGGAGGCCGGGTGTGGTGG - Intergenic
934886432 2:98029453-98029475 GTCCCTGAGGCCAGGTGCTGGGG + Intergenic
934989295 2:98910230-98910252 CTCCTTGAGGCCAGGTGTGGTGG + Intronic
935075469 2:99739099-99739121 ATCCGTGAGGATGGGGGTGGAGG + Intronic
935091623 2:99900426-99900448 GTCACTGAGAAGGGGAGTGGGGG - Intronic
935374251 2:102379154-102379176 GACCCTGGGGCCGGGTGTGGTGG + Intronic
935416794 2:102827817-102827839 GTGGCTTAGGCCGGGTGTGGTGG + Intronic
935814510 2:106834779-106834801 GCCCCTGAGGATGGGTGAGATGG + Intronic
935976747 2:108585904-108585926 GTGTCTGAGGCCGGGCGTGGTGG + Intronic
936099602 2:109563831-109563853 ATTCCTGAGGACTGGTATGGAGG + Intronic
936507446 2:113118747-113118769 GCCCCTGAGGCTGGGCGTGGTGG + Intronic
937409715 2:121663174-121663196 GTAAATGAGGCCGGGTGTGGTGG + Intergenic
938450693 2:131416977-131416999 GGCCCTTCGGCCGGGTGTGGTGG + Intergenic
938926592 2:136048776-136048798 CTTTCTGAGGCCGGGTGTGGTGG - Intergenic
939779999 2:146434341-146434363 GCCACTTAGGCCGGGTGTGGTGG + Intergenic
940698967 2:157017758-157017780 CTTCCTGATGATGGGTGTGGGGG + Intergenic
941965263 2:171294525-171294547 GTCCTTGAGGATGGGCGCGGTGG - Intergenic
942079466 2:172386308-172386330 GTCCCTTAGCAGGGGGGTGGGGG + Intergenic
942298790 2:174542276-174542298 TTACTTGAGGCCGGGTGTGGTGG + Intergenic
943366465 2:186971819-186971841 CTCTTTGAGGCCGGGTGTGGTGG - Intergenic
944423830 2:199558374-199558396 CTCCCTGCTGACGTGTGTGGAGG - Intergenic
944554049 2:200870379-200870401 GTCCTGGAGGCCGAGTGTGGTGG - Intergenic
944660532 2:201917959-201917981 GACCCTGAGGTCGGGTGCGGTGG - Intergenic
944668988 2:201979755-201979777 TACCCTGAGGCCAGGTGTGGTGG - Intergenic
945052475 2:205837087-205837109 GTTCCTTAGGCCGGGTGCGGTGG + Intergenic
945238015 2:207650702-207650724 CTTACTGAGGCCGGGTGTGGTGG - Intergenic
945992780 2:216410399-216410421 GCCTTTGAGGCCGGGTGTGGTGG - Intergenic
946942660 2:224785907-224785929 GAAGCTGAGGCCGGGTGTGGTGG + Intronic
947219114 2:227776089-227776111 TTCCCTGAGGCTGGGTGTGGTGG - Intergenic
947666596 2:231909886-231909908 TTGCCAGAGGACGGATGTGGCGG + Intergenic
948800205 2:240430026-240430048 GTCCCTGGGGAGGGGGATGGGGG - Intergenic
1168822596 20:785699-785721 ATCCCTGAGCAGGTGTGTGGTGG - Intergenic
1170364150 20:15581737-15581759 GTCCTTGAAGAAGGGTGTGCTGG + Intronic
1170664183 20:18371956-18371978 GTACTTGAGGCCGGGTGTGATGG + Intergenic
1170749999 20:19137034-19137056 GTCTTTGAGGCCAGGTGTGGTGG + Intergenic
1171211346 20:23319419-23319441 GGCCCAGAGGTGGGGTGTGGAGG + Intergenic
1171883439 20:30634289-30634311 GCCCATGAGGACAGCTGTGGGGG - Intergenic
1172120927 20:32598334-32598356 GTCCTGGAGGAGGGGTCTGGGGG - Intronic
1172346775 20:34208062-34208084 GTGCTGGAGGCCGGGTGTGGTGG - Intronic
1172664188 20:36587775-36587797 GTGCCTGAGGCCAGGCGTGGTGG + Intronic
1173227649 20:41171297-41171319 GCCACTGAGGCCGGGCGTGGTGG + Intronic
1173253789 20:41378605-41378627 GCCCATTAGGCCGGGTGTGGTGG + Intergenic
1174015551 20:47485352-47485374 GTGACTGAGGCCGGGCGTGGTGG + Intergenic
1174050969 20:47767355-47767377 GAGTCTGAGGCCGGGTGTGGCGG + Intronic
1174452568 20:50629107-50629129 GGCCCTGAGGCCGGGAGGGGAGG + Intronic
1174456054 20:50649586-50649608 GTCCCTGTGGGTGGGGGTGGGGG - Intronic
1174647875 20:52101694-52101716 GGCCCTGAGGTCAGGTGTGGTGG - Intronic
1175997521 20:62818210-62818232 GTCCCCGTGGAGGGCTGTGGAGG + Intronic
1177409594 21:20712537-20712559 ATCCAGGAGGCCGGGTGTGGTGG + Intergenic
1177725421 21:24960544-24960566 TTTGCTGAGGCCGGGTGTGGTGG - Intergenic
1177974273 21:27827671-27827693 GTAAATGAGGCCGGGTGTGGTGG - Intergenic
1178015717 21:28343857-28343879 GTCACTGGGGCCAGGTGTGGTGG + Intergenic
1178126197 21:29518024-29518046 TTCCCTGAGGCTGGGTGTGGTGG - Intronic
1178187265 21:30237042-30237064 GTCCCTGAGCATGGGTGACGAGG + Intergenic
1178866270 21:36330147-36330169 GTGGCTCAGGACGGGTCTGGTGG - Intronic
1179521932 21:41951354-41951376 TTTCCTGGGGACGGGGGTGGGGG - Intronic
1179535217 21:42047030-42047052 GTCTCCTAGGCCGGGTGTGGTGG - Intergenic
1179908438 21:44435911-44435933 GTCCCTGTGGATGGGTGGGGAGG - Intronic
1179968209 21:44818635-44818657 CTTCTTGAGGACGGGTGTGGAGG - Intronic
1180001826 21:44998571-44998593 CTCCCTGAAGACGGTTGGGGAGG + Intergenic
1180218407 21:46341652-46341674 GTCCAGGAGGCCAGGTGTGGAGG - Intronic
1180234678 21:46450720-46450742 ATGCCTGAGGCCAGGTGTGGTGG - Intergenic
1180889728 22:19278101-19278123 GTCCCTGAAGAGCGGTGTGCTGG - Intronic
1181267070 22:21636628-21636650 GTCCCTGAGCACGTGGGTGATGG - Exonic
1181645241 22:24227532-24227554 GTACTTTAGGCCGGGTGTGGTGG - Intronic
1182117562 22:27765942-27765964 GCCACTGAGGATGGGTGTGCCGG - Intronic
1182272428 22:29163662-29163684 ATGCCTGAGGCCGGGCGTGGTGG - Intronic
1182618106 22:31602304-31602326 GTCCCTGAGGAGATGTGTGGAGG + Intronic
1182856054 22:33518594-33518616 GTGCCTGAGGCCGGGCGCGGTGG - Intronic
1183160481 22:36110016-36110038 CTGACTGAGGCCGGGTGTGGTGG - Intergenic
1183291476 22:37004287-37004309 GTCTTTGAGGACTGGTGGGGTGG - Intronic
1183514364 22:38255309-38255331 GGCCATGAGGCCGGGTGCGGTGG - Intronic
1183556406 22:38530780-38530802 CATCCTTAGGACGGGTGTGGTGG + Intronic
1183687722 22:39371187-39371209 GTTTCTGAGGCCGGGCGTGGTGG + Intronic
1183828592 22:40406350-40406372 GTCCCTGAGGATGGGGGTTGGGG + Intronic
1184045805 22:41971626-41971648 CTTCCTGAGGACGGGGGTGAGGG - Intergenic
1184750927 22:46486224-46486246 GTACCTGAGGCCGGGCGCGGTGG - Intronic
1184971561 22:48025770-48025792 GTCCCTGAGGACCAGAGTGCAGG + Intergenic
1185016195 22:48344274-48344296 GCACATGAGGCCGGGTGTGGTGG + Intergenic
949887576 3:8708785-8708807 GAGCCTGAGGTCAGGTGTGGAGG + Intronic
950310739 3:11955540-11955562 GTGCCTGAGGATGGGTGAGCTGG + Intergenic
950353079 3:12376234-12376256 TGCCCTGAGGCCGGGTGCGGTGG - Intronic
950536009 3:13578765-13578787 CAGCCTGAGGCCGGGTGTGGTGG + Intronic
950625738 3:14245349-14245371 TTGCCTGGGGACGGGGGTGGAGG - Intergenic
950723150 3:14898876-14898898 GCCCCTGAGGAGGGGTGGAGGGG + Intronic
950769732 3:15301843-15301865 GTCCCTGAGCTCAGGTTTGGGGG - Intronic
950810099 3:15642873-15642895 ATCCCTCAGGCCAGGTGTGGTGG + Intronic
950879702 3:16313328-16313350 GACCATGAGGCTGGGTGTGGTGG - Intronic
951431029 3:22607316-22607338 AGCCCTGAGGCCGGGCGTGGTGG + Intergenic
952822227 3:37495237-37495259 GTCTCTCAGGCCGGGTGTGGTGG - Intronic
953944511 3:47134909-47134931 GTCATTCAGGCCGGGTGTGGTGG - Intronic
954137599 3:48589226-48589248 GTCACTGAGCAGGGGGGTGGAGG + Intronic
954333257 3:49901986-49902008 GTCCCTGAGGATATGGGTGGTGG + Intronic
954359201 3:50109923-50109945 GTCGCCGGGGCCGGGTGTGGTGG + Intronic
954389678 3:50262006-50262028 GACCCTGGGGCTGGGTGTGGTGG + Intergenic
954819712 3:53315250-53315272 GTTTCTGAGGCCGGGTGTGGTGG + Intronic
954990460 3:54836519-54836541 GCCCTTGAGGACAGGCGTGGTGG - Intronic
956177086 3:66483309-66483331 GTGTCTGAGGATGGGGGTGGGGG + Intronic
956666062 3:71642947-71642969 GTCACTGAGGCTGGGTATGGTGG - Intergenic
956855629 3:73272043-73272065 GCCCCCAAGGCCGGGTGTGGTGG - Intergenic
957529686 3:81425352-81425374 TTCCAGGAGGCCGGGTGTGGTGG + Intergenic
959323060 3:104903966-104903988 GTCCCTGGGGGCAGGTCTGGAGG + Intergenic
960638025 3:119803043-119803065 ACCCCAGAGGCCGGGTGTGGTGG + Intronic
960714270 3:120560023-120560045 GTCCCTGAGGTCAGCAGTGGGGG + Intergenic
960976279 3:123177823-123177845 ATCCATGAGGCTGGGTGTGGTGG - Intronic
964629614 3:158795800-158795822 GTACCTGTGGCCGGGCGTGGTGG - Intronic
964689223 3:159431270-159431292 GTCCTTGATGACGTGTGTGTGGG + Intronic
964752866 3:160068344-160068366 TTCTCTGAGGCCGGATGTGGTGG - Intergenic
965371059 3:167863221-167863243 GGCCATGAGGCCGGGCGTGGTGG - Intergenic
965457404 3:168920498-168920520 ATAACTGAGGCCGGGTGTGGTGG + Intergenic
965577422 3:170231912-170231934 GTTACTGAGGCCGAGTGTGGTGG + Intronic
965964193 3:174467305-174467327 CAACCTGAGGCCGGGTGTGGTGG + Intronic
966746502 3:183282052-183282074 GACCCTGAGGCTGGGGGTGGTGG - Intronic
967907815 3:194516258-194516280 GTCCCCGAGGCCAGGCGTGGTGG - Intergenic
968597816 4:1494517-1494539 GGTCCTGAGGCGGGGTGTGGGGG - Intergenic
968627634 4:1634339-1634361 GTGTGTGTGGACGGGTGTGGAGG - Intronic
968677554 4:1892271-1892293 CTCACTCAGGCCGGGTGTGGGGG - Intronic
969398752 4:6939727-6939749 GTTCCTGAGGAGAGGGGTGGGGG + Intronic
969548065 4:7845132-7845154 GTCCAGGAGGCCAGGTGTGGTGG + Intronic
969918292 4:10511520-10511542 GGCCCTGAGGAAGGAGGTGGAGG - Intronic
971793199 4:31195696-31195718 GTATTTTAGGACGGGTGTGGTGG - Intergenic
972240360 4:37184736-37184758 ATATCTGAGGCCGGGTGTGGTGG - Intergenic
972521323 4:39859944-39859966 GTTCCTCAGGCTGGGTGTGGTGG + Intronic
972563585 4:40250064-40250086 GACACTGAGGCTGGGTGTGGTGG + Intergenic
974849482 4:67387490-67387512 GTCACTTAGGCAGGGTGTGGTGG + Intergenic
975328270 4:73084894-73084916 ATCCCTCAGGACAGGTGTGGTGG + Intronic
975973305 4:80068479-80068501 GTCAGTGAGGTGGGGTGTGGTGG + Intronic
975979765 4:80144186-80144208 GAAGCTGAGGCCGGGTGTGGTGG + Intergenic
976619318 4:87112077-87112099 TTTCCTGAGGAAGGGTGTGAAGG + Intronic
976730018 4:88252338-88252360 ATACCTGAGGCCAGGTGTGGTGG + Intergenic
977364292 4:96047668-96047690 GAGCCTGAGGCCAGGTGTGGTGG + Intergenic
977423113 4:96828690-96828712 ATTCCTGAGGCTGGGTGTGGTGG - Intergenic
977646416 4:99417511-99417533 GTGCCAGAGGACTGGGGTGGAGG - Intronic
979479483 4:121199829-121199851 GTACCTGAGGACGGTTGTGTAGG + Intronic
980937010 4:139235167-139235189 ATCCCTCAGGCCGGGTGCGGTGG - Intergenic
980968831 4:139550161-139550183 GGCACTGAGGCCAGGTGTGGTGG - Intronic
981312158 4:143307817-143307839 GTCCCTGAGGTGGAGTGTGAGGG - Intergenic
981323321 4:143417693-143417715 GTGCCCGAGGTCAGGTGTGGTGG - Intronic
982554479 4:156841791-156841813 CTGCCTGAGGCCAGGTGTGGTGG - Intronic
983113473 4:163782381-163782403 GTCCAGCAGGCCGGGTGTGGTGG + Intronic
983318752 4:166167648-166167670 GTGTCTCAGGCCGGGTGTGGTGG - Intergenic
984966939 4:185147940-185147962 GTCGCTTAGGATGGATGTGGTGG - Exonic
984977889 4:185245997-185246019 GTCCTTTAGGCCGGGTGCGGTGG + Intronic
985239784 4:187917870-187917892 GTCCATTAGGCCGGGCGTGGTGG + Intergenic
985275373 4:188233085-188233107 GCTCCTGAGGCCAGGTGTGGTGG + Intergenic
985525464 5:399181-399203 GTCTCTGAGGCCGGGGCTGGTGG + Intronic
985565982 5:617574-617596 GTCCCGGTGGCAGGGTGTGGGGG + Intronic
985566431 5:620697-620719 GTCCCAGTGGTGGGGTGTGGGGG - Intronic
985670838 5:1205856-1205878 GTCCCTATGGGAGGGTGTGGGGG - Intronic
985949427 5:3212077-3212099 GTCCCTGCGGAAGTGTGTGTGGG + Intergenic
987139210 5:14928455-14928477 GTAGATGAGGCCGGGTGTGGTGG + Intergenic
988506433 5:31827403-31827425 TTTCCTGAGGCTGGGTGTGGTGG + Intronic
988597248 5:32606433-32606455 GTTGCTGACGCCGGGTGTGGTGG - Intergenic
990937914 5:61170021-61170043 GACACTGAGGCTGGGTGTGGTGG - Intergenic
991334339 5:65530088-65530110 GTACCTGGGGCCGGGCGTGGTGG - Intronic
991582725 5:68173705-68173727 GACCCTGAGGCCAGGTGTGGTGG + Intergenic
995033694 5:107509616-107509638 GACACTCAGGCCGGGTGTGGTGG - Intronic
995041261 5:107590678-107590700 GTCCATGAGGCCAGGTGTGGTGG - Intronic
997233414 5:132259062-132259084 GTCCCTGGGGCCGAGTGAGGTGG + Intronic
997599963 5:135132346-135132368 AGCCCGGAGGAGGGGTGTGGTGG + Intronic
997937284 5:138124288-138124310 GTGCTTAAGGCCGGGTGTGGTGG - Intronic
998154353 5:139776043-139776065 GTCCCTGAGGAGGGGTTCAGGGG + Intergenic
998839896 5:146242075-146242097 GTCCTTGAGGCCGTGTGTGATGG - Intronic
999364458 5:151012940-151012962 GTCCTTGAGGACGAATGGGGTGG - Intergenic
999365354 5:151020376-151020398 GTCCCTGTGGACGTGGGAGGCGG - Intergenic
999722940 5:154412332-154412354 AACCATGAAGACGGGTGTGGTGG - Intronic
999784836 5:154881761-154881783 GTCCATAAGGCCGGGTGTGGTGG + Intergenic
1000234281 5:159343272-159343294 GGCCCTGAGGAGGGATTTGGTGG - Intergenic
1001216953 5:169865306-169865328 GTCCCTGAGGTCAGGGGAGGTGG + Intronic
1001438860 5:171722546-171722568 ATTCCTGAGGCTGGGTGTGGTGG - Intergenic
1001959910 5:175873385-175873407 GATCCTGAGGACGTGTGTGCCGG - Intronic
1002432644 5:179212357-179212379 GGCCCTGAGGGCGGGTGCAGTGG + Intronic
1002432677 5:179212472-179212494 GGCCCTGAGGGCGGGTGCAGTGG + Intronic
1002432719 5:179212619-179212641 GGCCCTGAGGGCGGGTGCAGTGG + Intronic
1002432730 5:179212651-179212673 GGCCCTGAGGGCGGGTGCAGTGG + Intronic
1002432741 5:179212683-179212705 GGCCCTGAGGGCGGGTGCAGTGG + Intronic
1002432752 5:179212715-179212737 GGCCCTGAGGGCGGGTGCAGTGG + Intronic
1002489434 5:179563957-179563979 GTCATTAAGGCCGGGTGTGGTGG - Intronic
1002643258 5:180640535-180640557 GGCCCCAAGGAGGGGTGTGGTGG - Intronic
1002791581 6:441371-441393 GGCCCTGAGCAGGGGTGAGGTGG - Intergenic
1003018116 6:2484749-2484771 GTGACTTTGGACGGGTGTGGTGG + Intergenic
1003065553 6:2901726-2901748 GGCCTTGGGGATGGGTGTGGGGG - Intronic
1005761600 6:28972859-28972881 CTCCCTTAGGGCGGGTATGGTGG - Intergenic
1005896245 6:30181752-30181774 GGCCCTGAGGACAGGTCTGCTGG - Intergenic
1006327078 6:33362463-33362485 GTGACTTAGGCCGGGTGTGGTGG + Intergenic
1006389386 6:33749593-33749615 GTCCCTGAGGACCTGAGTGGTGG - Intergenic
1006436026 6:34026611-34026633 CTGCCAGAGGAGGGGTGTGGAGG - Intronic
1006793324 6:36717408-36717430 GACCCTGAGGAAGTGAGTGGGGG + Exonic
1006937260 6:37727172-37727194 ATCCATTAGGCCGGGTGTGGTGG + Intergenic
1007396583 6:41581410-41581432 GTCCCTGAGGGAGGGGCTGGAGG + Intronic
1007487813 6:42194542-42194564 CTCCCTGAGGACACTTGTGGAGG + Intronic
1007569192 6:42877069-42877091 GTTACTGAGGTCAGGTGTGGTGG - Intergenic
1007591853 6:43026378-43026400 GTCTTGGAGGCCGGGTGTGGTGG + Intronic
1010014916 6:71093412-71093434 GTCCCTGAGGAGGGATGGAGAGG + Intergenic
1010965513 6:82202011-82202033 TTGCTTGAGGCCGGGTGTGGTGG - Intronic
1012010159 6:93773856-93773878 GTACTTGAGGCCGGGCGTGGTGG + Intergenic
1013118492 6:107121130-107121152 GTCCGGGAGGCCAGGTGTGGTGG + Intergenic
1013154908 6:107484101-107484123 CTCCCTGAGGCCAAGTGTGGTGG - Intergenic
1015775962 6:136814555-136814577 TTTCCTGGGGCCGGGTGTGGTGG - Intergenic
1017586867 6:155936178-155936200 TTCTTTGAGGACTGGTGTGGTGG - Intergenic
1017872915 6:158502160-158502182 GTTCCTGGGTACGGGGGTGGAGG - Exonic
1018756140 6:166851232-166851254 GCCCCTGAGGACTGGTGGCGTGG - Intronic
1018952662 6:168389251-168389273 GTCCCTGGGGTCAGGTGAGGAGG - Intergenic
1019420785 7:949786-949808 TGCCCTGTGGCCGGGTGTGGAGG - Intronic
1019522062 7:1465573-1465595 ATGCCTGAGGCCGGGTGCGGTGG - Intergenic
1019600639 7:1882003-1882025 GTCCCTTAGAGAGGGTGTGGGGG - Intronic
1019815505 7:3197083-3197105 GTGCCTGGGGACGGGGGTGGGGG + Intergenic
1019948130 7:4346491-4346513 GTCAATGAGGCTGGGTGTGGTGG - Intergenic
1020128211 7:5545019-5545041 GACCCCGAAGCCGGGTGTGGTGG + Intronic
1020183461 7:5940653-5940675 TTCCATGAGGCTGGGTGTGGTGG + Intronic
1020202666 7:6092464-6092486 GTCCTTGAGGCCGGGCGTGGTGG - Intergenic
1020299449 7:6784105-6784127 TTCCATGAGGCTGGGTGTGGTGG - Intronic
1021195755 7:17672669-17672691 TTCCTTGAGGATGGGGGTGGAGG + Intergenic
1021308506 7:19062204-19062226 GTTACTTAGGCCGGGTGTGGTGG - Intronic
1021482809 7:21136522-21136544 CTACCTGAGGCCGGGTGCGGTGG + Intergenic
1023982171 7:45076578-45076600 GTCCCTGGGGGCTGGGGTGGAGG + Intergenic
1024026297 7:45412753-45412775 GTGCCTGAGGCCGGGCGTGGTGG - Intergenic
1024293571 7:47825240-47825262 GTCCTTTAGGCCAGGTGTGGTGG + Intronic
1024701234 7:51906443-51906465 GTGCCTCAGGCCGGGCGTGGTGG - Intergenic
1024729508 7:52238820-52238842 GTGCCTGGGGAAGGGTGGGGAGG - Intergenic
1025106205 7:56174271-56174293 GACGATGAGGACGGGGGTGGGGG + Intergenic
1026125670 7:67577430-67577452 CACCCGGAGGAAGGGTGTGGAGG + Intergenic
1026863142 7:73806670-73806692 ATCATTGAGGCCGGGTGTGGTGG + Intronic
1027170454 7:75868170-75868192 TTTACTGAGGCCGGGTGTGGTGG - Intronic
1027602716 7:80259140-80259162 TCCTCTGAGGCCGGGTGTGGTGG - Intergenic
1027782545 7:82537167-82537189 ATACCTGAGGCCAGGTGTGGTGG - Intergenic
1028389368 7:90296611-90296633 GTGCCTCAGGCTGGGTGTGGTGG - Intronic
1029352366 7:100023296-100023318 GCTCCTGAGGCCGGGGGTGGTGG - Intronic
1029403505 7:100359376-100359398 GACCCTGAGGCCGGCTATGGTGG - Exonic
1029408098 7:100389951-100389973 GACCCTGAGGCCGGTTGTGGTGG - Exonic
1029584585 7:101462283-101462305 CTCCCTGAGGCTGGGTGCGGTGG - Intronic
1029842052 7:103375719-103375741 GTGCCTGAGGCTGGGTGTGGTGG - Intronic
1029846660 7:103418855-103418877 GTCACTGAAGACTGCTGTGGGGG - Intronic
1031171907 7:118302772-118302794 GTGCCTGTGGTGGGGTGTGGGGG - Intergenic
1032074011 7:128827715-128827737 GTTTCTGAGGACGGTTGCGGGGG + Intergenic
1032141115 7:129330746-129330768 GTACCAGAGGCCGGGCGTGGTGG - Intronic
1032229180 7:130059638-130059660 TGCCCTGAGGAAGGGAGTGGAGG - Intergenic
1032438727 7:131924332-131924354 ATACCTAAGGCCGGGTGTGGTGG - Intergenic
1032580446 7:133098803-133098825 GGCCCTGGGGCCAGGTGTGGTGG - Intergenic
1033154837 7:138948048-138948070 GTCCCTGAGGCCGGGTGCAGTGG - Intronic
1033332049 7:140424996-140425018 GTCCTTTAGGCCAGGTGTGGTGG + Intronic
1033708307 7:143910345-143910367 GTCCCAAAGGATGTGTGTGGTGG - Intergenic
1034000612 7:147408471-147408493 GACCTTGCGGCCGGGTGTGGTGG + Intronic
1034344110 7:150375466-150375488 GTCTCTGAGGCTGGGCGTGGTGG + Intronic
1034623148 7:152471808-152471830 GTCCTTGGGGCCGGGTGTGGTGG + Intergenic
1034697446 7:153066423-153066445 GTCACTGAGGACTGGAGTGAGGG + Intergenic
1034885643 7:154796316-154796338 GTCCCTGAGGACGGGTCTTACGG - Intronic
1034973479 7:155433958-155433980 ATACCTGAGGCCGGGCGTGGTGG - Intergenic
1035251932 7:157603430-157603452 GTTTCTGGGGACGAGTGTGGTGG - Intronic
1035876298 8:3193505-3193527 GACCCAGAGGACGGGCGGGGAGG - Intronic
1035953038 8:4045060-4045082 GTGCCTGAGGTATGGTGTGGAGG + Intronic
1036435573 8:8730163-8730185 TTCCCTGAGGCCGGGTGTGGTGG + Intergenic
1036951451 8:13143697-13143719 GTCACTGATGCTGGGTGTGGTGG - Intronic
1037723023 8:21460536-21460558 GGCCCTGGGCACTGGTGTGGTGG - Intergenic
1038481103 8:27902323-27902345 CTCCCTGGGGATGGGTGGGGAGG - Intronic
1038769280 8:30461680-30461702 GTACATGAGGCCGGGTGCGGTGG - Intronic
1039411578 8:37359592-37359614 CTCCCTCTGGAAGGGTGTGGTGG - Intergenic
1040485340 8:47865866-47865888 GTCCCAGAGGCCGGGTGCAGTGG + Intronic
1040520842 8:48174660-48174682 GTCACTGAGGCTGGGTGTAGTGG + Intergenic
1041023327 8:53659283-53659305 AGCACTGAGGATGGGTGTGGTGG + Intergenic
1041109855 8:54473905-54473927 GTCCCTAAGGCCGGGCGCGGTGG - Intergenic
1041708065 8:60867620-60867642 GTCCTGGGGGAAGGGTGTGGAGG - Exonic
1042511476 8:69616838-69616860 ATTCTTGAGGCCGGGTGTGGTGG - Intronic
1042545182 8:69945067-69945089 GCCTTTGAGGTCGGGTGTGGTGG + Intergenic
1042554321 8:70021467-70021489 GAGCCTGAGGCCAGGTGTGGTGG - Intergenic
1044090350 8:87992702-87992724 GTATCTGGGGCCGGGTGTGGTGG + Intergenic
1045059558 8:98400094-98400116 ATCCCTGAGCATGGGTCTGGAGG - Intergenic
1047236782 8:123048654-123048676 GGCACTGAGGACGGGTGTGGTGG - Intronic
1047772866 8:128044445-128044467 GTGCCTGAGGCTGGGTGTGGAGG - Intergenic
1047972417 8:130096836-130096858 GTCCTTGAGGCCGGGCATGGTGG + Intronic
1048977128 8:139679340-139679362 CTCCCTGAGCACGGGGGTGTGGG + Intronic
1049039189 8:140099542-140099564 TTCCCTGCGGACGGCTGCGGAGG - Intronic
1049144061 8:140984719-140984741 GGGACTGAGGATGGGTGTGGAGG - Intronic
1049537305 8:143188385-143188407 GTGCCTGAGCATGGGTGTGGGGG - Intergenic
1049594146 8:143475778-143475800 GTCCCTGAGGTGGGGGTTGGGGG - Intronic
1050081431 9:1919819-1919841 GTCCCTGAGAAGGGGTGGGCAGG + Intergenic
1050518934 9:6476878-6476900 ATGCCTGAGGCCGGGCGTGGTGG - Intronic
1051355660 9:16237896-16237918 GTACCAGAGGACGGCGGTGGCGG + Intronic
1051421404 9:16892968-16892990 GACCCTGTGGCTGGGTGTGGTGG + Intergenic
1052753836 9:32520856-32520878 GTGACTCAGGCCGGGTGTGGTGG + Intronic
1054953639 9:70883171-70883193 GACCATGGGGATGGGTGTGGAGG - Intronic
1055491184 9:76806803-76806825 GTGCCTGAGGCCGGGTGCGGTGG - Intronic
1056504952 9:87249774-87249796 GTCATTGAGGCCAGGTGTGGTGG - Intergenic
1056950832 9:91039691-91039713 GTCCCTGAAGACAGTGGTGGAGG - Intergenic
1057481427 9:95448028-95448050 GTCACTGCGGAGGGCTGTGGCGG + Intronic
1057578150 9:96260874-96260896 CCCCCTCAGGTCGGGTGTGGAGG + Intronic
1057824062 9:98358848-98358870 GTCCCTGAGGCAGGGGATGGAGG - Intronic
1058062759 9:100515498-100515520 CCCCCTGAGGCCGGGTGTGGTGG + Intronic
1058692672 9:107532605-107532627 CTACCTTTGGACGGGTGTGGAGG - Intergenic
1058843660 9:108934450-108934472 GTCCCGGAGGGCGGGGGTGGCGG + Exonic
1059175826 9:112169519-112169541 GGTCCTGAGGCCAGGTGTGGGGG - Intronic
1059379305 9:113910715-113910737 GGCCCTGAGCACAGGTGTGAAGG - Intronic
1060733056 9:126050011-126050033 GTCCCCTGGGACGGGGGTGGGGG + Intergenic
1061913917 9:133739110-133739132 CACCCAGAGGAGGGGTGTGGAGG + Intronic
1062077291 9:134597625-134597647 GTCACTGTGGACGGCTGTGCAGG + Intergenic
1062088139 9:134659104-134659126 GCCTTTGAGGCCGGGTGTGGTGG + Intronic
1062307520 9:135917613-135917635 TCCCCCGAGGCCGGGTGTGGTGG + Intergenic
1062619454 9:137413067-137413089 GTTACTGAGGCTGGGTGTGGTGG - Intronic
1062639807 9:137513202-137513224 GTCTTTGAGGCCGGGTGCGGTGG + Intronic
1185585561 X:1240027-1240049 GCACCAGAGGACGGGTCTGGAGG - Intergenic
1186827678 X:13357348-13357370 GGACCTCAGGACGGGTGCGGTGG - Intergenic
1186838969 X:13465857-13465879 CTACCTGAGGCCGGGTGCGGTGG - Intergenic
1187048941 X:15676693-15676715 GTCCCTGAAGACAGGGGAGGTGG - Intergenic
1187338755 X:18402930-18402952 CTACCTGAGGCTGGGTGTGGTGG - Intergenic
1187385272 X:18842843-18842865 GTCCATGGGGCCGGGCGTGGTGG - Intergenic
1187884754 X:23879146-23879168 GACTCTGTGGTCGGGTGTGGTGG + Intronic
1187989543 X:24854541-24854563 GTACCCCAGGCCGGGTGTGGTGG + Intronic
1188291798 X:28398572-28398594 GTCACTGAGTAAGGGTGGGGTGG + Intergenic
1189417986 X:40831786-40831808 GTCCCTGAGGGCAGCTGTGCCGG + Intergenic
1189500467 X:41551607-41551629 GTCACTGAGGCCTGGTGTGGTGG + Intronic
1189953152 X:46252741-46252763 CTACCTGAGGCTGGGTGTGGTGG - Intergenic
1189983937 X:46536981-46537003 CTCACACAGGACGGGTGTGGTGG + Intronic
1190190353 X:48271868-48271890 GTCCTAGAGGCCAGGTGTGGTGG + Intronic
1190689274 X:52900054-52900076 GTCCATGTGGCCGGGCGTGGTGG + Intronic
1190696709 X:52955738-52955760 GTCCATGTGGCCGGGCGTGGTGG - Intronic
1191819450 X:65287466-65287488 TTCCTTGAGGCCAGGTGTGGTGG + Intergenic
1192347043 X:70318975-70318997 ATCCTTTAGGCCGGGTGTGGTGG + Intronic
1192735687 X:73847505-73847527 TGCCCTGAGGCCGGGTGTGGTGG - Intergenic
1193502905 X:82302182-82302204 GAACCTGGGGCCGGGTGTGGTGG + Intergenic
1197224909 X:123947255-123947277 TGCACTGAGGCCGGGTGTGGTGG + Intergenic
1197750640 X:129961402-129961424 GCCCCTGAGGACAGTTGGGGCGG - Intergenic
1198176782 X:134164353-134164375 GTGCCTGAGGCCGGGTGCAGTGG + Intergenic
1200310881 X:155076121-155076143 CTCTCTGAGGCCGGGTGCGGTGG + Intronic