ID: 930373379

View in Genome Browser
Species Human (GRCh38)
Location 2:50533127-50533149
Sequence CTCAGTGCTTAGAGAGGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 678
Summary {0: 1, 1: 0, 2: 3, 3: 60, 4: 614}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930373379_930373382 0 Left 930373379 2:50533127-50533149 CCAGAACCTCTCTAAGCACTGAG 0: 1
1: 0
2: 3
3: 60
4: 614
Right 930373382 2:50533150-50533172 TGTTCCAGGTCTCCCTGCTTAGG 0: 1
1: 0
2: 2
3: 14
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930373379 Original CRISPR CTCAGTGCTTAGAGAGGTTC TGG (reversed) Intronic
900809147 1:4787842-4787864 CTCAGTGCTGGGGGAGCTTCTGG - Exonic
901002913 1:6157566-6157588 CTCAGTGCTGGGAGACGCTCAGG - Intronic
901403932 1:9033482-9033504 CTCAGCACTTAGGGAGGTTGAGG - Intergenic
901945363 1:12698180-12698202 CTCAGTGCTTTGGGAGGTTGAGG - Intergenic
902057539 1:13614669-13614691 CCCAGTGCTTTGAGAGGCTGAGG + Intronic
902531351 1:17092696-17092718 CCCAGTGCTTTGGGAGGTTGAGG + Intronic
903209141 1:21806355-21806377 CTCAGTGCTTTGGGAAGTTGAGG - Intergenic
903376386 1:22869055-22869077 CTCAGGGCTTTGAGGGCTTCAGG - Intronic
903622493 1:24707945-24707967 CTCAGTGCTTTGGGAGGCTAAGG + Intergenic
905059848 1:35130575-35130597 CACTGAGCTGAGAGAGGTTCCGG + Intergenic
905134981 1:35792087-35792109 CTCAGCACTTTGAGAGGTTGAGG - Intergenic
905207553 1:36351549-36351571 CTCAGGGCAGACAGAGGTTCTGG - Intronic
905357245 1:37393416-37393438 CTCAGTGCTAAGAGCTGTACAGG - Intergenic
905513017 1:38538347-38538369 CTCAGTGCTCAAACAGTTTCAGG - Intergenic
905639506 1:39579061-39579083 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
905700549 1:40010027-40010049 CCCAGTGCTTTGGGAGGTTGAGG - Intergenic
905805263 1:40872227-40872249 CCCAGTGCTTTGAGAGGCTGAGG + Intergenic
906220550 1:44075039-44075061 CCCAGTGCTTTGAGAGGCTGAGG + Intergenic
906490959 1:46268118-46268140 CCCAGTGCTTTGAGAGGCTGGGG + Intronic
906780246 1:48566876-48566898 CTCAGTGCTTTGGGAGGCTGAGG + Intronic
907006874 1:50923166-50923188 CTCAATGCTTTGAGAGGCTGAGG + Intronic
907081718 1:51629696-51629718 CCCAGTGCTTTGAGAGGCTGAGG + Intronic
907098278 1:51802035-51802057 CCCAGTGCTTTGAGAGGCTGAGG - Intronic
907688810 1:56642179-56642201 CTCAGTACTTTGAGAGGCTGAGG + Intronic
907797240 1:57729808-57729830 CTCAGTGCTTTAAGAGGCTAAGG + Intronic
908761007 1:67511960-67511982 CCCAGTGCTTTGAGAGGCTGAGG + Intergenic
909866500 1:80679245-80679267 CTCAGTGGATAGAGCGTTTCTGG + Intergenic
910873701 1:91857686-91857708 CCCAGTGCTTTGAGAGGCTGAGG + Intronic
911280597 1:95922628-95922650 CCCAGTGCTTTCAGAGGTTGAGG - Intergenic
911320138 1:96403884-96403906 CTCAGTGCTTTGTGAGGCTGAGG + Intergenic
911416505 1:97581489-97581511 CTCAGTGCTTTGGAAGGTTGAGG + Intronic
911492552 1:98588507-98588529 CTTAGTGCTTTGAGAGGTCAAGG - Intergenic
911594217 1:99782247-99782269 CCCAGTGCTTTGAGAGGCTGAGG - Intergenic
911601565 1:99853635-99853657 CTCAGTGCTTTGGGAGGCTGAGG + Intronic
912906261 1:113710894-113710916 CTCAGCACTTTGAGAGGTTGAGG - Intronic
912938221 1:114022225-114022247 CTTAGTGCTTATATAGGTTGGGG - Intergenic
912999694 1:114567256-114567278 CCCAGTGCTTTGAGAGGCTGAGG - Intergenic
913257363 1:116965533-116965555 CTCACTGATTAGAGAGGCTGAGG - Intronic
914023660 1:143892332-143892354 GACAGGGCTTAGAGAGCTTCTGG - Intergenic
914896329 1:151677653-151677675 CTCAGTGCTTTGGGAGGTCAAGG - Intronic
915084492 1:153375842-153375864 CTCAGGGCTAAAAAAGGTTCAGG - Intergenic
915348483 1:155210154-155210176 CACAGGGCTCAGAGAGATTCCGG - Intronic
915424855 1:155817242-155817264 CCCAGTGCTTTGAGAGGCTAAGG - Intronic
915435988 1:155906853-155906875 CTCAGTGCTTTGGGAGGTCCAGG + Intronic
915854092 1:159362640-159362662 CCCAGTGCTTTGAGAGGCTGAGG + Intergenic
915982242 1:160427465-160427487 CTTAGTGCTTAGAGAGTTGGAGG - Exonic
916268755 1:162918363-162918385 CTTAGTGCTTATATAGGTTGGGG + Intergenic
917532360 1:175847363-175847385 CCCAGTGCTTTGAGAGGCTGAGG - Intergenic
917565797 1:176210346-176210368 CCCAGTACTTTGAGAGGTTGAGG + Intergenic
918352883 1:183675893-183675915 CCCAGTGCTTTGAGAGGCTGAGG + Intronic
918905502 1:190487337-190487359 CTCAGTGCTTTGAGAGGCAGAGG + Intergenic
919142723 1:193592959-193592981 CTCACTGCTAATAGAGGCTCTGG + Intergenic
920307087 1:205025876-205025898 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
920526248 1:206668836-206668858 CTCAGCACTTTGGGAGGTTCAGG + Intronic
920999532 1:211029078-211029100 CCCAGTGCTTTGAGAGGCTGAGG + Intronic
921567604 1:216738964-216738986 CCCAGTGCTTTGAGAGGCTAAGG - Intronic
922454710 1:225765476-225765498 CTCAGTTCTTCGGGAGGTTGAGG - Intergenic
922484651 1:225964025-225964047 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
923143720 1:231183346-231183368 CTCAGTGCTTTGGGAGGTTGAGG + Intronic
923168124 1:231387107-231387129 CTCAGTGCTTTGGGAGGCTGAGG - Intronic
923202749 1:231727834-231727856 CTCAGTGCTTTGGGAGGCTGAGG + Intronic
1063452490 10:6160007-6160029 CTCAGCACTTTGAGAGGCTCAGG - Intronic
1063615905 10:7600416-7600438 CCTAGTGCTCAGAGATGTTCAGG - Intronic
1063807291 10:9660144-9660166 CTCAGTGCTTTGGGAGGTCGAGG + Intergenic
1064811109 10:19199548-19199570 CTCAGTACTTTGAGAGGCCCAGG + Intronic
1065197631 10:23282510-23282532 CCCAGTGCTTTGAGAGGCTGAGG + Intronic
1065593385 10:27288482-27288504 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
1065656983 10:27961812-27961834 CTCAGTGCTTTGGGAGGCTGAGG + Intronic
1065773620 10:29100134-29100156 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
1065930522 10:30474689-30474711 CCCAGTGCTTTGAGAGGCTGAGG - Intergenic
1065959475 10:30722773-30722795 CCCAGTGCTTTGAGAGGTTGAGG + Intergenic
1065960403 10:30729588-30729610 CCCAGTGCTTTGAGAGGCTGAGG - Intergenic
1066293217 10:34032822-34032844 CACAGTGCTTTGGGAGGTTGAGG + Intergenic
1066310253 10:34189079-34189101 CTCAGTGCTTTGGGAGGCTGAGG + Intronic
1066418608 10:35243701-35243723 CCCAGTGCTTTGAGAGGCTAAGG - Intergenic
1066633031 10:37475349-37475371 CCCAGTGCTTTGGGAGGTCCAGG + Intergenic
1066995561 10:42559873-42559895 CTCAGCACTTAGAGAGGCTGAGG - Intergenic
1067129954 10:43554761-43554783 CCCAGTGCTTTGGGAGGTCCTGG + Intergenic
1067559514 10:47295152-47295174 CTTAGGGGTTAGAGAGGTTCAGG - Intergenic
1067815042 10:49467817-49467839 CCCAGTGCTTTGAGAGGCTGAGG - Intronic
1069937595 10:71929020-71929042 CTCAGTACTTTGGGAGGTTGAGG - Intergenic
1069952538 10:72029453-72029475 CTCAGTACTTTGGGAGGTTCAGG - Intergenic
1071891071 10:90008085-90008107 TTCAGTGCTTGGAAAGCTTCTGG - Intergenic
1072454851 10:95566908-95566930 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
1072520492 10:96226270-96226292 CTCAGTGCTTAGCATAGTTCTGG + Intronic
1072922344 10:99586690-99586712 CCCAGTGCTTTGGGAGGTTGAGG - Intergenic
1072976296 10:100061954-100061976 CTCAGCGCTTTGAGAGGCTGAGG - Intronic
1073029299 10:100512268-100512290 CTCAGTGTATAGAGAGGGTAAGG + Intronic
1073593097 10:104774845-104774867 CTCAGTGCTGAGAGGGACTCTGG - Intronic
1073620624 10:105044116-105044138 CTCAGTACTTTGAGAGGCTGAGG + Intronic
1073889894 10:108089374-108089396 CCCAGCACTTAGAGAGGCTCAGG + Intergenic
1074676943 10:115861851-115861873 CTCAGTGCTTTGAGAGGCCAAGG + Intronic
1075185764 10:120255471-120255493 CTCAGTACTTTGGGAGGTTGAGG + Intergenic
1075273434 10:121073088-121073110 CCCAGTGCTTTGAGAGGATGAGG - Intergenic
1075335134 10:121603309-121603331 CTCAGTGCTTTGGGAGGCTAAGG - Intergenic
1075387124 10:122062946-122062968 ATCAGGGCTCAGAGAGGTTAAGG + Intronic
1076133744 10:128030703-128030725 CTCAGTGTTCAGAGATGTCCAGG - Intronic
1077070852 11:671470-671492 CTCAGTGCTTTGAGAGGCTGAGG - Intronic
1077337304 11:2011132-2011154 CTCCGTGCTCAGGGAGCTTCTGG - Intergenic
1077943772 11:6872736-6872758 CCCAGCACTTTGAGAGGTTCAGG - Intergenic
1078314753 11:10285057-10285079 CCCAGTGCTTTGGGAAGTTCAGG + Intronic
1078404477 11:11057910-11057932 CTCAGTACTTTGAGAGGTCCAGG - Intergenic
1079052985 11:17179410-17179432 CCCAGTGCTTTGGGAGGCTCAGG - Intronic
1079269075 11:18965484-18965506 ATCAGTGATTAGAGGGGTTTGGG + Intergenic
1079316131 11:19409394-19409416 CTGAGTGCTTAGAGAGTGACTGG - Intronic
1079695848 11:23481865-23481887 TTCAGTACTTTGAGAGGTTGAGG + Intergenic
1080264053 11:30382660-30382682 CCCAGTGCTTTGGGAGGTTGAGG - Intergenic
1080632221 11:34088408-34088430 CTCAGTGCTTTGGGAGGCTGAGG + Intronic
1080823145 11:35826050-35826072 ATCAGTGCTTTGAGAGGCTCAGG - Intergenic
1080838446 11:35962294-35962316 GTCAGTGCTAAGTGAGATTCTGG + Intronic
1081625131 11:44650552-44650574 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
1082651510 11:55799664-55799686 CTAAGAGCTAAGAGGGGTTCAGG - Intergenic
1084554444 11:69867597-69867619 CTCAGTGCTTAGAAAAGCTCAGG - Intergenic
1085602052 11:77863763-77863785 CTCAGTGCTTTGAGGGGCTGAGG - Intronic
1086053328 11:82619497-82619519 CTCAGAACTTTGGGAGGTTCAGG + Intergenic
1086169307 11:83817622-83817644 CCCAGTGCTTTGAGAGGCTGAGG + Intronic
1086871503 11:92042891-92042913 CTCAGTGCTTTGGGAGGCTGCGG + Intergenic
1087109586 11:94449103-94449125 CACAGAGCTTAGAAATGTTCTGG - Intronic
1087186449 11:95203339-95203361 CTCAGTGCGTAAAGAAGTACTGG - Intronic
1087380857 11:97403044-97403066 CTCAATGCTTTGAGAGGTTGGGG - Intergenic
1087814807 11:102646890-102646912 CTCAGTACTTCGAGAGGCTGAGG - Intergenic
1087898963 11:103619093-103619115 CCCAGTGCTTTGAGAGGCTGAGG + Intergenic
1088015675 11:105056451-105056473 CTCAGTGCTTTGGGAGGTGAAGG + Intronic
1088684446 11:112273224-112273246 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
1089283407 11:117390395-117390417 CTCAGTGCTTTGGGAGGCTGAGG + Intronic
1089483399 11:118825684-118825706 CTCAGTACTTTGGGAGGTTGAGG - Intergenic
1090016504 11:123090886-123090908 CTTAGTGCTTATATAGGTTGTGG + Intronic
1090167020 11:124560229-124560251 CCCAGTGCTTTGAGAGGCTGAGG - Intergenic
1090767931 11:129893300-129893322 CTCAGTACTTTGGGAGGTCCAGG + Intronic
1091265615 11:134269067-134269089 CTCAGTGCTTTGAGAGGCCTAGG + Intergenic
1202820288 11_KI270721v1_random:66314-66336 CTCCGTGCTCAGGGAGCTTCTGG - Intergenic
1091950403 12:4588173-4588195 CCCAGTGCTTTGAGAGGCTGAGG - Intronic
1092175699 12:6404765-6404787 CCCAGTGCTTTGGGAGGTTGAGG - Intergenic
1093631440 12:21414062-21414084 CTTAGTGCTTATATAGGTTGGGG - Intronic
1094143611 12:27206032-27206054 CTCAGTGGTTAGAGAAGCTGTGG - Intergenic
1094438876 12:30452915-30452937 CTCAGTGCCTAGAAAGGAGCTGG + Intergenic
1094444963 12:30519548-30519570 CTTAGTGCTTATATAGGTTGGGG - Intergenic
1094501833 12:31028477-31028499 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
1096250237 12:50026927-50026949 CCCAGTGCTTTGGGAGGCTCAGG - Intronic
1096912970 12:55002613-55002635 CTCATTGCTCAGAGTGGTTGGGG - Intergenic
1097617046 12:61896556-61896578 CTCTGTGCTTAGAGAGTTTTAGG + Intronic
1099103522 12:78472938-78472960 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
1100137678 12:91573718-91573740 ATCAGTGCTTGCAGAGGTTAGGG + Intergenic
1100556259 12:95696917-95696939 CTCAGTACTTTGGGAGGTTGAGG + Intronic
1101881129 12:108626749-108626771 CTCAGTGCTTTGAGAGGCCGAGG - Intronic
1102281017 12:111618997-111619019 CTCAGTGCTTTGAGAGGCTAAGG + Intergenic
1102381283 12:112468811-112468833 CTCAGTGCTTTGGGAGGCTGAGG + Intronic
1102555357 12:113723251-113723273 CTCAGTGCTTTTAGAGGCTGAGG + Intergenic
1102609228 12:114096472-114096494 ATCAGTGCTTTAAGAGGTTGAGG - Intergenic
1102674995 12:114651524-114651546 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
1102886650 12:116527014-116527036 CCCAGTGCTTTGGGAGGTTGAGG + Intergenic
1102887018 12:116529975-116529997 CCCAGTGCTTTGGGAGGTTGAGG + Intergenic
1103453644 12:121047875-121047897 CTTAGTGCTTATATAGGTTGAGG + Intergenic
1103922904 12:124408494-124408516 CTCAGTGCTTTGGGAGGGCCAGG + Intronic
1103983482 12:124751786-124751808 CTCAGTGCTTTGGGAGGTTGAGG - Intergenic
1104850459 12:131870916-131870938 CCCAGTGCTTTGAGAGGCTGAGG - Intergenic
1105040873 12:132959991-132960013 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
1105350107 13:19607309-19607331 CACAGTGCTTTGAGAGGCTCAGG - Intergenic
1105391274 13:19981019-19981041 CCCAGTGCTTTGAGAGGCTGAGG + Intronic
1106116737 13:26824231-26824253 CTCAGTCCTTTGAGAGGCTGAGG - Intergenic
1106288268 13:28336996-28337018 CTCAGTGCTTTGGGAGGCTGAGG - Intronic
1108044394 13:46369463-46369485 CTCAGTGCTTTGAGAGGCTGAGG - Intronic
1108397972 13:50008413-50008435 CTCAGTGCTTTGCGAGGCTGAGG + Intronic
1109450018 13:62500598-62500620 CTCAGAGCTTTGGGAGGCTCAGG + Intergenic
1110791501 13:79591289-79591311 CTCAGAGCTTTGAGAGGTCCTGG + Intergenic
1111645600 13:91028144-91028166 CCCAGAGCTTTGAGAGGTTGAGG + Intergenic
1111807285 13:93053430-93053452 CTTAGTGCTTACATAGGTTGGGG + Intergenic
1111905017 13:94245306-94245328 CTCAGTGCTTTGGGAGGTTGAGG + Intronic
1112368857 13:98777328-98777350 CTCAGCACTTTGAGAGGCTCAGG - Intergenic
1112668987 13:101613355-101613377 CTCAGCACTGAGAGTGGTTCTGG - Intronic
1113634822 13:111912366-111912388 CTCAATACTTTGAGAGGTTGAGG - Intergenic
1113859978 13:113475634-113475656 CCCAGTGCTTTGAGAGGTGGAGG + Intronic
1113860605 13:113483323-113483345 TTCAGTGATTAGAGAGGCTTTGG - Intronic
1115632399 14:35258240-35258262 CCCAGTGCTTTGAGAGGCTGAGG - Intronic
1118194120 14:63608851-63608873 CTCAGTGCTTTGGGAGGCTGAGG + Intronic
1118376914 14:65185430-65185452 CCCAGTGCTTTGGGAGGTTGAGG - Intergenic
1119265989 14:73263575-73263597 CACACTGCTTAGGGTGGTTCTGG + Intronic
1120541632 14:85758600-85758622 CCCAGTGCTTTGAGAGGCTAAGG + Intergenic
1121132402 14:91460261-91460283 CCCAGTGCTTTGGGAGGTCCAGG - Intronic
1121670000 14:95701825-95701847 CTTAGTGCTTATATAGGTTGGGG - Intergenic
1121858288 14:97290784-97290806 CTCTGTGCTTAGAAAGGTCCTGG + Intergenic
1122014978 14:98787625-98787647 CTCAGTACTTTGGGAGGTTGAGG - Intergenic
1122181427 14:99957719-99957741 CTCAGTGCTTAGGGAGGCTGAGG - Intergenic
1122776307 14:104118371-104118393 CCCAGTGTTTAGAGAGCTGCGGG + Intergenic
1123712772 15:23001591-23001613 CCCAGTGCTTTGAGAGGCTGAGG - Intronic
1123963279 15:25429752-25429774 CCCAGTGCTTTCAGAGGTTGAGG + Intronic
1124147683 15:27143328-27143350 CCCAGTGCTTAGAGAGGCTAAGG - Intronic
1124426583 15:29568439-29568461 CTCAGTGCTTTGGGAGGCTGAGG + Intronic
1124963566 15:34416547-34416569 CTCAGTGCTTTGGGAGGCTGAGG + Intronic
1124980185 15:34562773-34562795 CTCAGTGCTTTGGGAGGCTGAGG + Intronic
1125166940 15:36717339-36717361 ATCAGTGGTTACAGAGGTGCAGG - Intronic
1125472863 15:40021591-40021613 CTCAGTGCTTAGTGTGTTTTGGG + Intronic
1125561846 15:40639822-40639844 CCCAGTGCTTTGGGAGGTTGAGG + Intronic
1126014832 15:44340506-44340528 CCCAGTGCTTTGAGAGGCTGAGG - Intronic
1126044519 15:44626126-44626148 CCCAGTGCTTTGGGAGGTTGAGG - Intronic
1126199597 15:45971049-45971071 CTCAGCACTTAGGGAGGTTGAGG - Intergenic
1126782692 15:52151853-52151875 CTCAGTGCTTTCAGAGGCTGAGG + Intronic
1126960894 15:53992895-53992917 CTCAGGTATTTGAGAGGTTCAGG - Intergenic
1127416047 15:58758142-58758164 CCCAGTGCTTTGGGAGGTTGAGG - Intergenic
1128012966 15:64316140-64316162 CCCAGTGCTTTGAGAGGCTGGGG - Intronic
1128966487 15:72063278-72063300 TTCAGTGGTTTGAGAGTTTCAGG - Intronic
1129341768 15:74890859-74890881 CTAAGTGCTAAGAGTGGTTGGGG - Intronic
1129665414 15:77576835-77576857 CTCTGTGATTAGAGAAGTACAGG + Intergenic
1130640116 15:85664948-85664970 CCCAGTGCTTTGGGAGGTTGAGG + Intronic
1133132889 16:3688732-3688754 CTCAGTGCTTTGGGAGGTCGAGG - Intronic
1133323780 16:4931111-4931133 CTCAGTGCTTTGGGAGGCTAAGG + Intronic
1133586995 16:7205265-7205287 CCCAGTGCTTAGGGAGGCTGAGG + Intronic
1133737010 16:8623450-8623472 CTCAGGACTTAGAGATGTCCTGG - Intronic
1133751531 16:8729871-8729893 CTCAGTGGGTAGAGAGTGTCAGG + Intronic
1133783516 16:8957491-8957513 CCCAGTGCTTTGAGAGGTTCAGG + Intronic
1133982084 16:10640362-10640384 CTCAGTGCTTCAAGAGGTTGAGG - Intronic
1134175353 16:12001765-12001787 CCCAGTGCTTTGAGAGGTTGGGG + Intronic
1135033006 16:19053931-19053953 CCCAGTGCTTTGAGAGGTGGAGG - Intronic
1135042911 16:19131676-19131698 CTCTGTGTTTAGAGAGAGTCAGG + Intronic
1135046792 16:19162497-19162519 CCCAGTGCTTTGGGAGGTTAAGG + Intronic
1135072292 16:19362658-19362680 CACAGGGCTTGGAGAGCTTCTGG - Intergenic
1135096703 16:19570311-19570333 CCCAGTGCTTTGGGAGGTTGAGG - Intronic
1135433844 16:22411309-22411331 CCCAGTGCTTTGGGAGGCTCAGG - Intronic
1135664062 16:24320981-24321003 CTCAGTGCTTTGGGAGGCTCAGG - Intronic
1135668291 16:24353940-24353962 CCCAGTACTTTGAGAGGTTGAGG + Intronic
1135733686 16:24914343-24914365 CTCAGCACTTTGAGAGGTTGAGG - Intergenic
1135767922 16:25193893-25193915 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
1136507307 16:30713008-30713030 CTCAGTACTTTGGGAGGTTGAGG - Intronic
1136588704 16:31203985-31204007 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
1137484122 16:48877447-48877469 ATCATTGCTTAGAGAGTATCAGG - Intergenic
1137654585 16:50149243-50149265 CCCAGTGCTTTGGGAGGTTTAGG - Intergenic
1137969203 16:52967030-52967052 CCCAGTGCTTCGGGAGGTCCAGG - Intergenic
1137979695 16:53059089-53059111 CTCAGTGCTTTGAGAGGCCAAGG - Intronic
1138367091 16:56489029-56489051 CCCAGTGCTTTGGGAGGTTGAGG - Intronic
1138737051 16:59262650-59262672 CTCAGTGCTTCGGGAGGCTGAGG - Intergenic
1138998338 16:62478822-62478844 CACAGTGCTGTGAGAGGTTGGGG - Intergenic
1139345746 16:66302501-66302523 CTTAGTGCTTAGAGAGGCTGAGG - Intergenic
1139397994 16:66655865-66655887 CTCAGTGCTTTGGGAGGCTAAGG + Intronic
1140225730 16:73075196-73075218 CACAGTGCTTAGAGAGGCTGAGG + Intergenic
1140433560 16:74925776-74925798 CTCAGTGCTTTGGGAGGCTAAGG + Intronic
1141330123 16:83103201-83103223 CTCAGTACTTTGGGAGGTTGAGG - Intronic
1141375597 16:83527197-83527219 CTCAGTGCTTTGGGAGGCTGAGG + Intronic
1141923955 16:87154753-87154775 CCCAGTGCTTTGGGAGGTTGAGG + Intronic
1142649559 17:1339071-1339093 CTCAGTGCTCAGAGAGGCTGAGG + Intergenic
1143073297 17:4316732-4316754 CTCAGTGCTTTGGGAGGTCAAGG + Intronic
1143711401 17:8738074-8738096 CTCAGTGCTTTGGGAGGCTGAGG - Intronic
1144508994 17:15859072-15859094 CTCAGTGCTTTGGGAGGCTTAGG - Intergenic
1144648961 17:16995194-16995216 CTAAGTGCTTTGAGAGGCTGAGG + Intergenic
1145073320 17:19830450-19830472 CTTAGTGCTTTGAGAGGCTGAGG - Intronic
1145111691 17:20169121-20169143 CTCAGTACTTTGAGAGGCTGAGG - Intronic
1145173111 17:20676712-20676734 CTCAGTGCTTTGGGAGGCTTAGG - Intergenic
1146775780 17:35614438-35614460 CTCAGTACTTTGAGAGGCTGAGG - Intronic
1146862048 17:36311600-36311622 CTCAGTGCTTTGGGAGGCTAAGG + Intronic
1147045566 17:37749291-37749313 CTCAGTGCCTGGAGAAGTGCTGG + Intergenic
1147092376 17:38115703-38115725 CTCAGTGCTTTGGGAGGCTAAGG + Intergenic
1147131015 17:38408997-38409019 CTCAGTGCTTTGAGAGGCCAAGG - Intergenic
1147134380 17:38426843-38426865 CTCAGGTCTTAGAGGGGTTGGGG - Intergenic
1147173753 17:38637970-38637992 CCCAGTGCTTTGAGAGGTCAAGG + Intergenic
1147181439 17:38688499-38688521 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
1147309456 17:39586250-39586272 CCCAGTGCTTTGGGAGGTTGAGG - Intergenic
1147735083 17:42631695-42631717 CCCAGTGCTTTGAGAGGCTGAGG + Intergenic
1147764232 17:42822929-42822951 CTCAGTGCTTTGGGAGGCTGAGG - Intronic
1147891940 17:43723442-43723464 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
1148093577 17:45037213-45037235 CCCAGTGCTTTGGGAGGTTGAGG + Intronic
1148373221 17:47116679-47116701 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
1148424667 17:47583662-47583684 CTCAGTGCTTTGGGAGGCTAAGG + Intronic
1148453228 17:47794732-47794754 CCCAGCACTTTGAGAGGTTCAGG + Intergenic
1148802053 17:50234760-50234782 CTCAGTGCTTTGAGAGGCCAAGG - Intergenic
1149016462 17:51914100-51914122 CTCAGGGCTCAGAGTGGATCAGG - Intronic
1149371193 17:55994769-55994791 CTCAGTGCTTTGGGAGATTGAGG - Intergenic
1149381887 17:56102827-56102849 CCCAGTGCTTTGAGAGGTCAAGG - Intergenic
1149970399 17:61212351-61212373 CTCAGTGCTTTGGGAGGCTGAGG - Intronic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1150585928 17:66517515-66517537 CTCAGTGCTTACACAGAATCTGG + Intronic
1150767486 17:68013665-68013687 CCCAGTACTTTGGGAGGTTCAGG - Intergenic
1151145070 17:72032795-72032817 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
1151464446 17:74275472-74275494 CCCAGTGCTTTGAGAGGCCCAGG + Intronic
1152737780 17:82005722-82005744 CTCTGTGCTGAGTGAGGTTCGGG - Intronic
1152828962 17:82485749-82485771 CTCAGGGCTGAGAGAGGCTCTGG - Intronic
1152960436 18:76611-76633 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
1153884475 18:9451133-9451155 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
1153964622 18:10168281-10168303 CTCAGTCCTTAGGGAGGTGGAGG + Intergenic
1154408528 18:14119704-14119726 CTCAGTGCTTTCAGAGGCTGAGG - Intronic
1155139877 18:23035429-23035451 CCCAGTGCTTTGAGAGGCTGAGG - Intergenic
1155255801 18:23997164-23997186 CTCAGTGCTTTGGGAGGTCAAGG + Intronic
1155699768 18:28729641-28729663 CTCGGTTCTTAGAGATGTCCTGG - Intergenic
1156518168 18:37698611-37698633 CTGGATGCTGAGAGAGGTTCAGG + Intergenic
1156764010 18:40629367-40629389 CTCAGTACTTTGGGAGGCTCAGG + Intergenic
1156937746 18:42731379-42731401 CTTAGTGCTCAGAGAGGTGAAGG + Intergenic
1157492688 18:48135636-48135658 CTCTGGGCTTAGAAAGGCTCAGG - Intronic
1159258545 18:65980345-65980367 CACAGTGCTTTGGGAGGTTAAGG - Intergenic
1159841672 18:73405566-73405588 CCCAGTGCTTTGAGAGGTCAAGG - Intergenic
1161188581 19:2939719-2939741 CCCAGTACTTTGAGAGGCTCAGG + Intronic
1161366826 19:3884844-3884866 CTCAGCGCTTAGAGAGGCCGAGG + Intronic
1161599338 19:5171442-5171464 CCCAGTGCTTTGAGAGGCTGAGG - Intronic
1162055934 19:8064083-8064105 CTCAGTGCTTTGAGAGGCCAAGG - Intronic
1162357618 19:10195887-10195909 CCCAGTGCTTTGAGAGGCCCAGG + Intronic
1162409275 19:10495260-10495282 CTCAGTGCTTTGGGAGGCTGAGG - Intronic
1162455028 19:10778399-10778421 CTCAGTGCTTTGGGAGGCTGAGG + Intronic
1162524314 19:11198336-11198358 CTCAGTGCTTAGGGAGGCCAAGG + Intergenic
1162789824 19:13057080-13057102 TTCAGTGCTTAGAGAGTCTCAGG + Intronic
1162819509 19:13214063-13214085 CTCAGTGCTTTGAGAGGCCAGGG - Intronic
1162870679 19:13584222-13584244 TTCAGTGCTCAGAGAGGCTGTGG + Intronic
1162895263 19:13761628-13761650 CCCAGTGCTTTGGGAGGCTCAGG + Intronic
1162896906 19:13770049-13770071 CTCAGTGCTTTGGGAGGCTGAGG - Intronic
1163084592 19:14970319-14970341 CACAGTGCTTTGGGAGGTTGAGG - Intronic
1163181340 19:15606150-15606172 CTTAGTGCTTACATAGGTTGGGG + Intergenic
1163415208 19:17182336-17182358 CCCAGTGCTTTGAGAGGCTGAGG - Intronic
1164544808 19:29151450-29151472 CTCAGTGCTTTGTGAGGCTGAGG + Intergenic
1165417438 19:35703459-35703481 CCCAGGGCTTTGAGAGGTCCAGG - Intergenic
1166634948 19:44442944-44442966 GTCAGAGCTTGGAGAGTTTCCGG - Exonic
1166691793 19:44826099-44826121 CCCAGTGCTTTGAGAGGCTAAGG + Intergenic
1166721383 19:44998582-44998604 CCCAGCGCTTTGGGAGGTTCGGG + Intergenic
1166825431 19:45606153-45606175 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
1166912356 19:46168183-46168205 CTCAGTGCTTTGGGAGGCCCAGG - Intergenic
1167191453 19:47992778-47992800 CCCAGTGCTTTGGGAGGTTAAGG + Intergenic
1167245475 19:48370673-48370695 CCCAGTGCTTTGGGAGGTTAAGG - Intronic
1167270889 19:48505362-48505384 CTCAGTACTTTGAGAGGCCCAGG - Intronic
1167558650 19:50211729-50211751 CTCAGTACTTTGAGAGGCTGAGG + Intronic
1167820190 19:51920757-51920779 CTCAGTGATCAGAGTGCTTCAGG - Intronic
1167976692 19:53232768-53232790 CTCAGCACTTTGAGAGGCTCAGG - Intergenic
925942582 2:8835097-8835119 CTCAGTGCTTTGGGAGGCTAAGG - Intronic
926051412 2:9747137-9747159 CTCAGTGCTTTGGGAGGCTAAGG + Intergenic
926393699 2:12420115-12420137 CTCTGTGCTTTGAGGAGTTCTGG + Intergenic
926575788 2:14579480-14579502 CTCAGTACTTTGGGAGGTTGAGG + Intergenic
927101890 2:19794109-19794131 CTCAGGGATTACACAGGTTCTGG + Intergenic
927139486 2:20119982-20120004 CCCAGTGCTTTGAGAGGTTGAGG + Intergenic
927760812 2:25752020-25752042 CTCAGTGCTTTGGGAGGCTGAGG - Intronic
928305773 2:30169341-30169363 CTCAGTGCTTTGAGAGGCCAAGG - Intergenic
928984325 2:37166275-37166297 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
929159144 2:38814186-38814208 CTCAGTACTTTGAGAGGCTGAGG - Intronic
930373379 2:50533127-50533149 CTCAGTGCTTAGAGAGGTTCTGG - Intronic
930671707 2:54158454-54158476 CCCAGTGCTTTGAGAGGTCAAGG - Intronic
931410462 2:62025273-62025295 CCCAGTGCTTTGGGAGGTTGAGG + Intronic
932660790 2:73649974-73649996 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
932727739 2:74193991-74194013 CCCAGTGCTTTGAGAGGCTGAGG - Intergenic
933828296 2:86184424-86184446 CTCAGTGCTTTGAGAGGCCAAGG - Intronic
934752729 2:96804143-96804165 CCCAGTGCTTTGAGAGGCTGAGG - Intronic
934969100 2:98748781-98748803 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
935252974 2:101281772-101281794 CTCAGTGCTTTGGGAGTTTAAGG - Intronic
937007196 2:118527904-118527926 CTCATTGCATAGCCAGGTTCTGG - Intergenic
937129955 2:119502739-119502761 CCCAGTGCTTAGAGAGGCTGAGG + Intronic
937217635 2:120322757-120322779 CCCAGTGCTTCGGGAGGTTGAGG + Intergenic
937716992 2:125043563-125043585 CCCAGTGCTTTGGGAGGTTGAGG + Intergenic
937979299 2:127605099-127605121 CTCAGTGCATATAGAGATGCAGG - Intronic
938439680 2:131317740-131317762 CTGAGTGCTTACTGTGGTTCAGG - Intronic
939257723 2:139765885-139765907 CTCAGTACTTTGAGAGGCTGAGG + Intergenic
939569592 2:143824923-143824945 ATCAGTGCTTAGAGAGAATCAGG - Intergenic
942207309 2:173632239-173632261 CTTACTGCTTTGAGAGTTTCTGG + Intergenic
942345655 2:175000386-175000408 CTCAGTACTTTGAGAGGCTAAGG - Intronic
942554228 2:177155180-177155202 CTCAGTGCTTAGGGAGGCTGAGG - Intergenic
942960886 2:181828861-181828883 CCCAGCACTTTGAGAGGTTCAGG + Intergenic
943675128 2:190709226-190709248 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
944195025 2:197043456-197043478 CTCAGTGCTTTGGGAGGCTGAGG - Intronic
944562935 2:200959812-200959834 CTCAGTGCTTTGGGAGGCTGAGG + Intronic
945243898 2:207700610-207700632 CCCAGTGCTTTGAGAGGCTGAGG + Intergenic
945254749 2:207794184-207794206 CCCAGTGCTTTGAGAGGCTGAGG - Intergenic
945557430 2:211297038-211297060 CTCAGTGCTTTGAGAGGTTGAGG + Intergenic
947234098 2:227921913-227921935 CTCAGTGCTTTGAGAGGCTGAGG + Intronic
947299595 2:228674287-228674309 CTCAGTGTTTAGTGAGGCTCGGG - Intergenic
947348603 2:229219769-229219791 CCCAGTGCTTTGAGAGGTCCAGG - Intronic
947568272 2:231209932-231209954 CCCAGTGCTTTGGGAGGTTGAGG - Intronic
947586079 2:231357819-231357841 CCCAGTGCTTTGGGAGGCTCAGG - Intronic
948280148 2:236740746-236740768 CTGAGTGCCTGGAGAGGTTAGGG + Intergenic
1168944084 20:1736919-1736941 CCCAGCGCTTAGGGAGGTTGAGG - Intergenic
1169051353 20:2580912-2580934 CTCAGTGCTTAGTGAGCCACAGG - Intronic
1169297467 20:4412492-4412514 CTCAGTGCTTAGAGATGGTATGG - Intergenic
1172558479 20:35864933-35864955 CTCAGTGGTTTGGGAGGTCCAGG + Intronic
1173031758 20:39367612-39367634 CTCAGTGCTTTGAGAGGCCGAGG + Intergenic
1173959284 20:47058592-47058614 CCCAGTGCTTTGAGAGGTCAAGG + Intronic
1174030452 20:47620359-47620381 CCCAGTGCTTTGGGAGGCTCAGG - Intronic
1174269151 20:49354415-49354437 CTCAGTACTTTGAGAGGCTGAGG + Intergenic
1174566614 20:51469265-51469287 CTCAGTGCTTTGAGAGGCTAAGG - Intronic
1175157360 20:56980405-56980427 CTCAGCGCTTTGAGAGGCTGAGG - Intergenic
1175914428 20:62419107-62419129 CTCAGTGCCTTGACATGTTCTGG + Intronic
1176050682 20:63117933-63117955 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
1176949623 21:15029699-15029721 CCCAGTGCTTTGAGAGGCTGAGG + Intronic
1176975962 21:15322406-15322428 CTCAGCACTTAGAGAGGCTGAGG + Intergenic
1177052170 21:16249999-16250021 CTCAGTACTTTGAGAGGCTGAGG - Intergenic
1178533895 21:33397002-33397024 CCCAGTGCTTTGAGAGGCTGAGG - Intergenic
1179436075 21:41363007-41363029 CCCAGTGCTTTGGGAGGTTGAGG - Intronic
1180688572 22:17690506-17690528 CTCAGTACTTTGGGAGGTCCAGG + Intronic
1181372176 22:22427408-22427430 CCCAGAGCTTAGAGAGGGGCTGG + Intergenic
1181472224 22:23147581-23147603 CCCAGTGCTTTGAGAGGCCCGGG - Intronic
1181848263 22:25730595-25730617 CCCAGTGCTTTGGGAGGTTGAGG + Intergenic
1181947849 22:26532230-26532252 ATCAGTGCTTAGAGACCCTCTGG + Intronic
1182080177 22:27523242-27523264 CCCAGTGCTTTGAGAGGCTAAGG - Intergenic
1182191939 22:28470093-28470115 CCCAGTGCTTTGAGAGGTCGAGG - Intronic
1182593020 22:31396943-31396965 CCCAGTGCTTTCAGAGGTTGAGG - Intergenic
1184022479 22:41830229-41830251 ATCAGTGCTTCCTGAGGTTCGGG + Intergenic
1184325897 22:43784398-43784420 CTCAGTGCTTTGAGAGGCTGAGG + Intronic
1184712426 22:46260328-46260350 CACAGTGCTTAGGGAGGTTCTGG - Exonic
1185029712 22:48435459-48435481 CCCAGTGCTTTGGGAGGTTGAGG - Intergenic
1185185277 22:49395598-49395620 CTAAGTGCTTAGGAAGGTTGGGG - Intergenic
949995250 3:9611570-9611592 ACCAGTGCTTTGAGAGGTTGAGG - Intergenic
950384545 3:12647348-12647370 CTCAGCACTTTGAGAGGTTGAGG + Intronic
950440724 3:13008701-13008723 CTCACTGCTTTGAGCGGTGCTGG + Intronic
950971906 3:17197620-17197642 CCCAGTGCTTTGAGAGGCTGAGG - Intronic
951216150 3:20027126-20027148 CTCAGCACTTTGAGAGGTTGAGG - Intergenic
952761338 3:36917064-36917086 CTCAGTGCTTTGGGAGGCTGAGG - Intronic
954813526 3:53262824-53262846 CTCAGTGCTTTGGGAGGCCCAGG - Intergenic
955542178 3:59989058-59989080 CTCAGGCTTTAAAGAGGTTCTGG + Intronic
955866886 3:63393759-63393781 CCCAGTGCTTTGAGAGGCTGAGG - Intronic
955941985 3:64154896-64154918 CCCAGTGCTTTGAGAGGCTGAGG + Intronic
956155070 3:66287044-66287066 CCCAGTGCTTTGAGAGGCTGAGG + Intronic
956285816 3:67608925-67608947 CTCAGTACTTTGAGAGGCTGAGG - Intronic
957325516 3:78687879-78687901 CTCAGTACTTTGGGAGGCTCAGG - Intronic
958862830 3:99466044-99466066 CTCAGTGCTTTGAGAGGCTGAGG - Intergenic
958924267 3:100140600-100140622 CCCAGTGCTTAGGGAGGCTGAGG - Intronic
959067069 3:101668383-101668405 ATCAGTGCTTTGAGAGGGTGAGG + Intronic
959102346 3:102025461-102025483 CCCAGTGCTTTGGGAGGTTGAGG + Intergenic
959565657 3:107830233-107830255 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
959842495 3:110994400-110994422 ATCAGGGCTTAGAGGGATTCTGG + Intergenic
960462386 3:117952263-117952285 CTCAGTGCTTTGAGAGGCTGAGG - Intergenic
960667855 3:120128129-120128151 CTCAGAGCTTTGAGAAGTTAAGG - Intergenic
961225409 3:125240511-125240533 CCCAGCACTTCGAGAGGTTCAGG + Intronic
961447597 3:126988138-126988160 CCCAGTGCATAGGGAGGCTCTGG + Intergenic
962278816 3:134035134-134035156 CCCAGTGCTTTGAGAGGTCGAGG - Intronic
962294637 3:134171614-134171636 CCCAGTGCTTTGAGAGGTCAAGG + Intronic
962972184 3:140412263-140412285 CCCAGTGCTTTGGGAGGTTGAGG - Intronic
965456954 3:168913043-168913065 CTCAGTGCTTTGGAAGGTTGAGG - Intergenic
965584754 3:170307688-170307710 CCCAGTGCTTTGAGAGGCTCAGG - Intergenic
965687386 3:171318912-171318934 CCCAGTGCTTTGAGAGGCTAAGG + Intronic
966161597 3:176974631-176974653 CCCAGTGCTTTGAGAGGTTGAGG + Intergenic
966389240 3:179434468-179434490 CTCAGAGCTTTGAGAGGCTGAGG + Intronic
967797741 3:193616256-193616278 CTCAGTGCTTTGAGAGGCTGAGG - Intronic
968016905 3:195343955-195343977 CCCAGTGCTTTGGGAGGTTAAGG + Intronic
968072836 3:195797853-195797875 CCCAGTGCTTTGAGAGGCTGAGG + Intronic
968088741 3:195886565-195886587 CCCAGAGATTAGAGAGGGTCAGG + Intronic
968095696 3:195928856-195928878 CTCAGCACTTTGGGAGGTTCAGG + Intergenic
968100325 3:195960307-195960329 CTCAGCTCTTAGGGAGGTTGAGG + Intergenic
968390318 4:187473-187495 CCCAGTGCTTTGAGAGGCTAAGG - Intergenic
968595988 4:1485283-1485305 CTCAGTGCTTTGAGAGGCTAAGG - Intergenic
969889265 4:10244467-10244489 CTCAGTGCTTACATAGGTTGGGG + Intergenic
970163354 4:13210960-13210982 CCCAGTGCTTAGGGAGGCTGAGG + Intergenic
970245993 4:14064214-14064236 CTCAGCGCTTTGGGAGGTTGAGG + Intergenic
971919413 4:32917523-32917545 CCCAGTGCTTTGAGAGGCTGAGG - Intergenic
972315529 4:37922339-37922361 ATCACTGTTTAGAGGGGTTCTGG + Intronic
972435912 4:39035270-39035292 CTCAGCGCTTTGGGAGGTTGAGG - Intergenic
972454720 4:39242370-39242392 CGCAGTGCTTAGGGAGGCTAAGG - Intronic
972684284 4:41336549-41336571 CCCAGTGCTTTGAGAGGCTAAGG + Intergenic
972722844 4:41718009-41718031 CACAGTGCTTTGGGAGGTTGAGG - Intergenic
973603390 4:52563324-52563346 CCCAGTGCTTTGGGAGGTTGAGG + Intergenic
973914133 4:55615997-55616019 CCCAGTGCTTTGAGAGGCCCAGG - Intronic
974492487 4:62585169-62585191 CTCAGCGCTTTGAGAGGCTGAGG + Intergenic
975387364 4:73773370-73773392 CCCAGTGCTTTGGGAGGCTCAGG - Intergenic
975508088 4:75161518-75161540 CCCAGTGCTTTGGGAGGTTGAGG - Intergenic
975635503 4:76444163-76444185 CTCAGCACTTAGGGAGGTTGAGG - Intronic
975885649 4:78961396-78961418 CCCAGTGCTTAGGGAGGCTGAGG - Intergenic
976284362 4:83356709-83356731 CTCAGCGCTTTGGGAGGTTGAGG + Intergenic
976729430 4:88246961-88246983 CCCAGTGCTTTGGGAGGTTGAGG - Intergenic
976744875 4:88392438-88392460 CCCAGTGCTTTGGGAGGTTGAGG - Intronic
978242443 4:106533091-106533113 CTTAGTGCTTATATAGGTTGGGG + Intergenic
978343490 4:107741361-107741383 CTTAGTGCTTATATAGGTTGGGG - Intergenic
978513462 4:109546708-109546730 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
979167312 4:117551729-117551751 CTCAATTCTTAGAGCAGTTCTGG + Intergenic
979269515 4:118743612-118743634 CCCAGTGCTTTGAGAGGTTGAGG - Intronic
980186250 4:129464449-129464471 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
980902868 4:138921695-138921717 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
980945435 4:139315267-139315289 CTCAGTGCTTTGAGAGGCAGAGG + Intronic
981492463 4:145354258-145354280 CTCAGTACTTTGGGAGGTTGAGG + Intergenic
981508911 4:145533433-145533455 CCCAGTGCTTTGAGAGGCTGAGG + Intronic
981583725 4:146276697-146276719 CCCAGTGCTTTGAGAGGCTGAGG + Intronic
981742374 4:148016251-148016273 CCCAGTGCTTTGAGAGGCTGGGG + Intronic
982090751 4:151878118-151878140 CCCAGTGCTTTGAGAGGCTGAGG - Intergenic
982711244 4:158760476-158760498 CTCAGTACTTTGGGAGGTCCGGG + Intergenic
983229354 4:165113435-165113457 CTCAGTACTTTGAGAGGCTGAGG - Intronic
983284218 4:165718852-165718874 CTCAGTACTTCGTGAGGTTGAGG - Intergenic
983703696 4:170631291-170631313 TTCAGTGCCAAGAGAGATTCTGG - Intergenic
984012726 4:174389996-174390018 CCCAGTGCTTTGAGAGGTCAAGG + Intergenic
984495639 4:180493988-180494010 CCCAGTGCTTTGGGAGGTTGAGG + Intergenic
985344344 4:188987267-188987289 CTCAATGCTTGGAGAGTCTCAGG - Intergenic
985883598 5:2658903-2658925 CCCAGTTATTAGAGAGGGTCGGG - Intergenic
987119347 5:14752055-14752077 CTCAGTGCTTTGGGAGGCTGAGG + Intronic
987836559 5:23170246-23170268 CCCAGTGCTTTGAGAGGCTGAGG - Intergenic
988804279 5:34726123-34726145 CCCAGTGCTTTGGGAGGTTGAGG + Intronic
990227063 5:53666683-53666705 CCCAGTGCTTTGGGAGGTTGAGG + Intronic
990762399 5:59144250-59144272 CTCAGTACTCAGAGAGGTCATGG - Intronic
991061714 5:62383175-62383197 CTCAGCACTTTGAGAGGTTGAGG - Intronic
991549985 5:67825371-67825393 CTCACTTCTTAGAGTGGTTGGGG + Intergenic
991907784 5:71529439-71529461 CCCAGTGCTTTGGGAGGTTGAGG + Intronic
992061754 5:73057174-73057196 CACAGTACTTTGAGAGGCTCAGG - Intronic
992164678 5:74037947-74037969 CACAGAGAGTAGAGAGGTTCAGG + Intergenic
992611076 5:78509227-78509249 CTCTGTGTTTAGTGATGTTCTGG - Intronic
992706121 5:79394818-79394840 CCCAGTGCTTTGGGAGGTTGAGG - Intronic
993966166 5:94363633-94363655 CCCAGTGCTTAGGGAGGCTGAGG + Intronic
994519501 5:100813676-100813698 CTCAGAGCCCAGAGAGCTTCAGG - Intronic
995132286 5:108643197-108643219 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
996338852 5:122414157-122414179 CTCAGTGCTTTGGGGGGTTGAGG - Intronic
996367231 5:122716014-122716036 CCCAGTACTTTGAGAGGTTGAGG - Intergenic
997534805 5:134611112-134611134 CCCAGTGCTTTGAGAGGCTGAGG - Intronic
997545528 5:134703626-134703648 CACAGTACTTAGTGAGGTTAAGG - Intronic
997903470 5:137790524-137790546 CTTAGTGCTTTGGGAGGTTGAGG - Intergenic
998123876 5:139602424-139602446 CTCAGTGCTTTGGGAGGCTGAGG + Intronic
998421710 5:141993613-141993635 CCCAGTGCTTTGAGAGGCTGAGG + Intronic
999413480 5:151373848-151373870 CCCAGTGCTTTGAGAGGCCCAGG - Intergenic
999872254 5:155765026-155765048 CTCAGTGCTTTGGGAGGTTGAGG + Intergenic
1000768950 5:165326851-165326873 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
1001125541 5:169015678-169015700 CTCAGTGCTTTGGGAGGCTGAGG + Intronic
1001199897 5:169706613-169706635 CTCAGTGCCTCGGGAAGTTCTGG + Intronic
1001206764 5:169770548-169770570 CTCAGTGCTTTGAGAGGCCAAGG - Intronic
1001265337 5:170270127-170270149 CTCAGTGCTTAGAAATGATCAGG - Intronic
1001453578 5:171844506-171844528 CCCAGTGCTTTGAGAGGCTGAGG - Intergenic
1002930657 6:1632624-1632646 CCCAGTGCTTTGAGAGGCTGAGG + Intronic
1003002346 6:2347885-2347907 CTCAGCACTTAGGGAGGTTGAGG + Intergenic
1003190645 6:3871400-3871422 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
1003512124 6:6790391-6790413 CTCCCTGATGAGAGAGGTTCAGG + Intergenic
1004610406 6:17234277-17234299 CTCAGTGCTTTGAGAGGCTGAGG - Intergenic
1004656156 6:17663512-17663534 CCCAGTGCTTTGAGAGGCTCAGG - Intronic
1005080219 6:21949579-21949601 CTGATTGCTTAGAGAGGTTATGG - Intergenic
1005568036 6:27115939-27115961 CCCAGTGCTTTGAGAGGCTGAGG - Intergenic
1005668964 6:28085661-28085683 CTCAGTGCCTCGCGAGGTCCAGG - Exonic
1006470869 6:34227808-34227830 CTCAGCCCTGAGAAAGGTTCGGG + Intergenic
1006648758 6:35534137-35534159 CCCAGTGCTTTGGGAGGTTGAGG - Intergenic
1006936105 6:37719661-37719683 CTCAGTGCTTTCAGAGGTCAAGG - Intergenic
1008780413 6:55096518-55096540 CTCAGTGCTTTGAGAGGCCAAGG - Intergenic
1008876776 6:56338212-56338234 CCCAGTGCTTTGGGAGGCTCAGG - Intronic
1008937546 6:57007983-57008005 CTTAGTGCTTATATAGGTTGGGG + Intronic
1009472898 6:64050002-64050024 CTCACTGCCTACACAGGTTCAGG - Intronic
1010008073 6:71017603-71017625 CTCAGTGCTTTGAGAGGCCAAGG + Intergenic
1010138598 6:72585908-72585930 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
1010842298 6:80660564-80660586 CTCAGTGCTTTGAGAAGTTGAGG - Intergenic
1011003689 6:82620284-82620306 GTAAGTGCTTAGAAAAGTTCTGG + Intergenic
1011622803 6:89258453-89258475 CTCAGTGCTTTGGGAGGTCAAGG + Intronic
1012145964 6:95682015-95682037 CTTAGTGCTTATATAGGTTGGGG + Intergenic
1012325277 6:97908704-97908726 CCCAGTGCTTTGGGAAGTTCAGG + Intergenic
1013420783 6:109964692-109964714 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
1013594542 6:111648844-111648866 CTCAGTGCCTTGGGAGGTTCAGG + Intergenic
1014161460 6:118173919-118173941 CTGAGTGCTGGGTGAGGTTCCGG - Intronic
1014179191 6:118366117-118366139 CTCAGTGCTTTGGAAGGCTCCGG - Intergenic
1014248171 6:119089551-119089573 CCCAGTGCTTTGGGAGGTTGAGG - Intronic
1014575003 6:123058906-123058928 CCCAGTGCTTTGAGAGGCTGAGG - Intronic
1014826124 6:126050450-126050472 CTCAGAGCTTTGAGAGGCTGAGG + Intergenic
1015115331 6:129642544-129642566 CTCAGTGCTTTGGGAGGTTGAGG - Intronic
1015157794 6:130116500-130116522 CTCAATGCTTTGAGAGGGTGAGG + Intronic
1015423535 6:133038512-133038534 CTCAGTACTTTGGGAGGTCCAGG - Intergenic
1015519534 6:134116267-134116289 CTCAGTACTTTGAGAGGCTGGGG - Intergenic
1016063106 6:139650706-139650728 CTCAGCCCTTAGACAGTTTCTGG + Intergenic
1016434427 6:144020999-144021021 CACAGTGTTTAGGGAGGTTAGGG + Intronic
1016637360 6:146309146-146309168 CTCAGTGCTTTGGGAGGCTAAGG + Intronic
1017173974 6:151484518-151484540 CTCAGTGCTTTAAGAGGCTCAGG - Intergenic
1017438398 6:154439639-154439661 CTCAGTGCTTTGGGAGGTAGAGG + Intronic
1017448855 6:154534660-154534682 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
1017687370 6:156926928-156926950 CTCAGTGCTTTGAGAGGCCAAGG - Intronic
1017716550 6:157217454-157217476 CTCAGCGCCTTCAGAGGTTCTGG - Intergenic
1018007340 6:159634840-159634862 CTCAGTACTTTGAGAGGCTAAGG + Intergenic
1018032283 6:159850966-159850988 CCCAGTGCTTTGAGAGGCTGAGG - Intergenic
1018253119 6:161892181-161892203 CCCAGTGCTTTGGGAGGTTGAGG + Intronic
1018779820 6:167053130-167053152 CCCAGTGCTTCGGGAGGTTGAGG - Intergenic
1019354035 7:569769-569791 CTCGGTGCTTAGAGGGACTCCGG - Intronic
1020012462 7:4814028-4814050 CCCAGTGCTTTGAGAGGCTGAGG - Intronic
1020516417 7:9126279-9126301 CTCAGTACTTAGGGAGGCTGAGG - Intergenic
1021098352 7:16559141-16559163 CTCAGTGCTTAGGCAGGCTGAGG + Intronic
1021113833 7:16726065-16726087 CTATGTGCTTAGAGAGGTAAGGG + Intergenic
1021652676 7:22846968-22846990 CCCAGTGCTTTGAGAGGCTGAGG - Intergenic
1022296118 7:29055499-29055521 CTCAGTGCTTTGGGAGGCTGAGG - Intronic
1023371709 7:39518520-39518542 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
1023849671 7:44143270-44143292 CTCAGTGCTTTGAGAGGCTGAGG - Intergenic
1023910262 7:44549824-44549846 CTCAGTGCTTTGGAAGGTTGAGG - Intergenic
1024007672 7:45239301-45239323 CTTAGTGCTTATACAGGTTAGGG - Intergenic
1024741558 7:52360439-52360461 CTCAGTGACTAGAGAGGCTGAGG - Intergenic
1025083232 7:56002451-56002473 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
1025992007 7:66503839-66503861 CTCAGTGCCTAAAGGGGTCCCGG + Intergenic
1026331318 7:69354920-69354942 CCCAGTACTTTGAGAGGTTGAGG - Intergenic
1026354619 7:69546746-69546768 CCCAGTGCTTTGAGAGGTTGAGG + Intergenic
1026505168 7:70976455-70976477 CCCAGTGCTTTGAGAGGCTGAGG + Intergenic
1026961759 7:74412821-74412843 CTCAGTGCTTTGAGAGGACAAGG + Intergenic
1027162418 7:75812335-75812357 CTCAGTGCTTTGGGAGGCTGAGG - Intronic
1027183940 7:75958727-75958749 CCCAGTGCTTAGGGAGGCTGAGG + Intronic
1027381470 7:77614133-77614155 CTCAGTGCTTTGGGAGGCTGAGG - Intronic
1027408876 7:77891834-77891856 CTCAGTACTTTGGGAGGTTGAGG - Intronic
1029153670 7:98499629-98499651 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
1029477367 7:100792859-100792881 CCCAGTGCTTTGGGAGGTTGAGG + Intronic
1030912594 7:115270370-115270392 CCCAGTGCTTTGAGAGGGTAAGG - Intergenic
1031039783 7:116827239-116827261 CTCAGTGCTTTGGGAGGGTGAGG - Intronic
1031640701 7:124160879-124160901 CCCAGTGCTTAGAGTAGTACTGG + Intergenic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1032318912 7:130867077-130867099 CTCAGTGCCTAGAGAGTACCTGG + Intergenic
1032532785 7:132636015-132636037 CTCAGAGGGTAGAGAGCTTCAGG + Intronic
1033019898 7:137713887-137713909 CTCAGTGCTTTGGGAGGCTGAGG - Intronic
1033667512 7:143456332-143456354 CTCAGTACTTTGAGAGATTGAGG - Intergenic
1033798066 7:144871064-144871086 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
1034127170 7:148683968-148683990 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
1036027327 8:4924470-4924492 CTCAGTACTTTGAGAGGCTGGGG + Intronic
1037096862 8:14996151-14996173 CCCAGTGCTTTGGGAGGTTGAGG - Intronic
1037509818 8:19571218-19571240 CCCAGTGCTTTGGGAGGTTGTGG - Intronic
1037780544 8:21865469-21865491 CCCAGTGCTTTGGGAGGTTGAGG + Intergenic
1037781963 8:21875623-21875645 CTCAGTGCTTTGAGAAGCTGAGG - Intergenic
1037839823 8:22236436-22236458 CTCAGGACTTAGGGAGGTTGAGG + Intergenic
1037849206 8:22312514-22312536 CTCACTGCTTTGGGAGGTTGAGG - Intronic
1038457394 8:27686188-27686210 CCCAGTGCTTTGAGAGGCTGAGG + Intergenic
1038567611 8:28633086-28633108 CCCAGTGCTTTGAGAGGCTGAGG + Intronic
1038711856 8:29954459-29954481 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
1039060716 8:33570152-33570174 CTCAGCACTTTGAGAGGTTGAGG + Intergenic
1039317224 8:36387053-36387075 CTCAATGCTTTGAGAGGTCGAGG - Intergenic
1039331882 8:36546760-36546782 CACTGACCTTAGAGAGGTTCTGG - Intergenic
1039709561 8:40042164-40042186 CTGGGTGCTGAAAGAGGTTCAGG + Intergenic
1039892775 8:41696138-41696160 CTCAGTGCTTTGGGAGGCTGAGG - Intronic
1039966139 8:42285293-42285315 CCCAGTGCTTAGAGAGGCTGAGG + Intronic
1040991293 8:53352922-53352944 CTTAGTGCTTATATAGGTTGGGG + Intergenic
1041067917 8:54100231-54100253 CTCTGTGCTTTGAGAGGCTGAGG + Intronic
1041080865 8:54213860-54213882 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
1041082066 8:54223532-54223554 CTCAGTACTTTGAGAGGCTGAGG + Intergenic
1041585797 8:59517302-59517324 CCTAGTGCTTAGAATGGTTCTGG + Intergenic
1041709493 8:60880400-60880422 CCCAGTGCTTTGGGAGGCTCAGG - Intergenic
1042141205 8:65680413-65680435 CTCAGTGCTTTGGGAGGCTGAGG - Intronic
1042401534 8:68354455-68354477 CCCAGTGCTTTGAGAGGCTGAGG - Intronic
1042594191 8:70428201-70428223 CCCAGTGCTTTGAGAAGTTGAGG + Intergenic
1042911166 8:73827793-73827815 CTCAATGCTTTGAGAGGCTGAGG - Intronic
1044675793 8:94727482-94727504 CTCAGCACTTTGAGAGGTTGTGG - Intronic
1044998910 8:97863194-97863216 CTCAGTGCTTTGGAAGGTTGAGG - Intergenic
1045000476 8:97873876-97873898 CTCAGTACTTTGAGAGGCTGAGG - Intronic
1045193396 8:99905691-99905713 CTCAGCACTTTGAGAGGCTCAGG + Intergenic
1048014912 8:130488752-130488774 CTCAGTGCTTTGGGAGGCCCAGG + Intergenic
1049110507 8:140639531-140639553 CTCAGTGCTTTGGGAGGTCAAGG + Intergenic
1049562817 8:143320515-143320537 CTCAGTGCTTCGGGAGGCTGAGG - Intronic
1049943187 9:568730-568752 CCCAGTGCTTTGGGAGGTTAAGG - Intronic
1049965271 9:773802-773824 CTCAGCACTTAGGGAGGTTGAGG - Intergenic
1050104210 9:2148757-2148779 CTCAGTGCTTTGGGAGGCTGAGG - Intronic
1050193759 9:3058000-3058022 CCCAGTACTTTGAGAGGTTGGGG - Intergenic
1050427518 9:5526686-5526708 CTCAGTGCTTTGGGAGGCTGGGG - Intronic
1050481387 9:6090786-6090808 CTCAGAGCCTAGAGTGGTTGAGG + Intergenic
1050523933 9:6529371-6529393 CTCAGTACTTTGAGAGGCTGAGG - Intergenic
1050544499 9:6698315-6698337 CTCAGTGCTCTGAGAGGCTGAGG - Intergenic
1050714874 9:8511319-8511341 CTCAGTGCTTTGAGTGGTCGAGG - Intronic
1051081520 9:13299819-13299841 CCCAGTGCTTTGGGAGGCTCAGG - Intergenic
1051248006 9:15131217-15131239 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
1051251302 9:15161566-15161588 CCCAGTGCTTTGGGAGGTTGAGG - Intergenic
1051302380 9:15665528-15665550 CTCAGTGCTTTGGGAGGCTAAGG + Intronic
1051397407 9:16639664-16639686 CCCAGTGCTTTGAGAGGCTGAGG + Intronic
1051644465 9:19253888-19253910 CCCAGTGCTTAGGGAGGCTGAGG + Intronic
1052844592 9:33323989-33324011 CTCAGTGCTTTGAGAGATGGAGG + Intronic
1052980838 9:34448119-34448141 CCCAGTGCTTAGAGAGGCCAAGG - Intronic
1055085409 9:72308612-72308634 CCCAGTGCTTTGGGAGGTTGAGG + Intergenic
1055759046 9:79587271-79587293 CTGAGTGCTTAGGGAGGGCCTGG + Intronic
1055868600 9:80845974-80845996 CCCAGTACTTAGAGAGGCTGAGG - Intergenic
1058878094 9:109261443-109261465 CTCAGTGCTTTGGGAGGCTGAGG + Intronic
1059945206 9:119402544-119402566 CTCAGTGCCTGGAGAGGAGCTGG - Intergenic
1060153792 9:121304967-121304989 CTCAGCTCTGAGAGGGGTTCAGG + Intronic
1060577954 9:124715270-124715292 CTCAGTGCTTTGGGAGGCTGAGG + Intronic
1060587906 9:124798005-124798027 CTCAGTGCTGGGAGAGGAGCCGG + Intronic
1060854232 9:126902068-126902090 CTTAGTGCTTATACAGGTTGGGG + Intergenic
1061443203 9:130621231-130621253 CCCAGTGCTTTGAGAGGCTTAGG + Intronic
1061747633 9:132752090-132752112 CTCAGTGCTTTGGGAGGTCGAGG - Intronic
1061817011 9:133203657-133203679 CTCAGTGATTGGAGAGTTTGTGG + Intergenic
1061997036 9:134191454-134191476 CCCAGTGCTTTGAGAGGCTGAGG - Intergenic
1062737660 9:138147095-138147117 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
1187186095 X:16987183-16987205 CCCAGTGCTTTGAGAGGCTAAGG - Intronic
1187647241 X:21361566-21361588 CTCAGTGCTTTGTGAGGCTGAGG + Intergenic
1189608133 X:42701930-42701952 CTCAGTGCTTTGAGGGGTCTGGG - Intergenic
1189689457 X:43600806-43600828 CCCAGTACTTTGAGAGGTTGAGG + Intergenic
1189997502 X:46653142-46653164 CCCAGTGCTTTGAGAGGCTGAGG + Intronic
1190719893 X:53138962-53138984 CTCAGCGCTTTGGGAGGTTGTGG + Intergenic
1190896001 X:54618644-54618666 CCCAGTGCTTTGAGAGGCTGAGG + Intergenic
1192386205 X:70673371-70673393 CCCAGTGCTTTGAGAGGCTGAGG - Intronic
1192814582 X:74577456-74577478 CCCAGTGCTTTGGGAGGCTCAGG + Intergenic
1193089497 X:77478941-77478963 CCCAGTGCTTTGGGAGGTTGAGG + Intergenic
1193155446 X:78167815-78167837 CTCAGTGCTTTGGGAGGATGAGG + Intergenic
1193311698 X:80017412-80017434 CTCAGTGCTTTGGGAGGCTGAGG - Intronic
1193519778 X:82514218-82514240 CTCAGTGCTTTGAGAGGCCAAGG - Intergenic
1193982644 X:88202638-88202660 CTGAGGGCTTAGAGAAGATCTGG + Intergenic
1194029513 X:88794768-88794790 CTCAGTGCTTTGGGAGGTGAAGG + Intergenic
1194502434 X:94698213-94698235 CTTAGTGCTTATATAGGTTGGGG - Intergenic
1194819522 X:98488727-98488749 CTCAGGGGGTTGAGAGGTTCAGG + Intergenic
1196066351 X:111468745-111468767 CCCAGTGCTTTGAGAGGCTAAGG + Intergenic
1196397920 X:115285906-115285928 CTCAGCACTTTGAGAGGTTGAGG - Intergenic
1196855968 X:119984594-119984616 CTTAGTGCTTACATAGGTTGGGG + Intergenic
1197004875 X:121483255-121483277 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
1197921975 X:131604515-131604537 CTCAGTGCTTTGGGAGGCTGAGG + Intergenic
1197931766 X:131703696-131703718 CTTAGTGCTTATATAGGTTGGGG - Intergenic
1197967766 X:132083204-132083226 CCCAGTGCTTTAAGAGGTTGAGG - Intronic
1198089420 X:133312919-133312941 CTCAATGCTTAGAAAGGATTGGG + Intronic
1198142915 X:133823727-133823749 CTCAGTGCTTTGGGAGGATGAGG + Intronic
1198457341 X:136829389-136829411 CCCAGTGCTTTGAGAGGCTGAGG + Intergenic
1198760690 X:140029369-140029391 CCCAGTACTTTGTGAGGTTCAGG - Intergenic
1199711885 X:150475317-150475339 CTCAGTGCTTTGGGAGGCTGAGG - Intronic
1200138851 X:153887339-153887361 ATCTGTGCTCAGAGAGGGTCTGG + Intronic
1200175378 X:154111452-154111474 CTCAGTGCTTTGGGAGGCTGAGG - Intergenic
1200669059 Y:6064940-6064962 CTCAGCACTTTGAGAGGTTGAGG + Intergenic
1201381587 Y:13385799-13385821 CCCAGTGCTTTGAGAGGCTGAGG - Intronic
1201417413 Y:13761194-13761216 CCCAGTGCTTTGAGAGGCTGAGG + Intergenic
1201575506 Y:15457404-15457426 CCCAGTACTTAGAGAGGTGGAGG + Intergenic
1201687644 Y:16725108-16725130 CTCAGTACTTTGAGAGGCTAAGG - Intergenic