ID: 930373802

View in Genome Browser
Species Human (GRCh38)
Location 2:50538841-50538863
Sequence GTTCCATTTGAACTCGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 106}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930373802 Original CRISPR GTTCCATTTGAACTCGAGAA TGG Intronic
900487504 1:2930440-2930462 CTGCCTTTTGAACTAGAGAAGGG - Intergenic
900924588 1:5696147-5696169 GTTCCTTTTTAATTGGAGAATGG - Intergenic
905220624 1:36444498-36444520 GTTCCATCTGTCCTCTAGAAAGG - Intronic
905721801 1:40209832-40209854 GTGCCATTTGCACTCGAGCTGGG + Intronic
905840095 1:41169367-41169389 GTCCCATTTGTTCTCCAGAAGGG - Intronic
906899611 1:49819846-49819868 GTTCCATTGGAAGCAGAGAAGGG + Intronic
907147628 1:52250106-52250128 ATTCAATTTGAATTTGAGAATGG + Intronic
908291993 1:62676999-62677021 GTTCCATTTAAACTGCAGATAGG + Intronic
909558409 1:76981647-76981669 ATTGCATTTGAGCTCGAGAATGG + Intronic
911398779 1:97347985-97348007 TTTCCATTTTAACTGTAGAATGG - Intronic
915989507 1:160499554-160499576 GTTCCATATGAATTTTAGAATGG + Intronic
916594372 1:166229149-166229171 GTTCCATATGAACTTTAAAATGG + Intergenic
917665774 1:177223896-177223918 CTTCCATTTGAACCTGAGCAGGG - Intronic
918676012 1:187287073-187287095 GTTCCATATGAATTTTAGAATGG + Intergenic
918812944 1:189143503-189143525 GTTCCATATGCAGTTGAGAAGGG - Intergenic
919460964 1:197876304-197876326 ATTCCATTTGAATTTCAGAATGG + Intergenic
921834894 1:219768373-219768395 GTTCCATATGAATTTTAGAATGG - Intronic
924600121 1:245481378-245481400 GTTACATTTGAGCACGGGAATGG - Intronic
1063558285 10:7101510-7101532 GCTCCAGTTGAACTGCAGAATGG - Intergenic
1066478207 10:35768953-35768975 TTTCCTGATGAACTCGAGAAAGG - Intergenic
1067273392 10:44812050-44812072 GTTCCATTTGCACTTGGGGAGGG + Intergenic
1071738676 10:88331734-88331756 GTTCCAAATGGACTGGAGAAGGG - Intronic
1072908631 10:99479776-99479798 GTTCCATATGAATTTTAGAATGG - Intergenic
1073662948 10:105497586-105497608 TTTCCATTTAGACTAGAGAAAGG + Intergenic
1075567796 10:123517451-123517473 TTTCCACTTGGACTCCAGAAAGG - Intergenic
1085192182 11:74636762-74636784 GTTCCATTTGTTCTTCAGAAGGG + Intronic
1085906310 11:80768405-80768427 GTTCCATATGAATTTTAGAATGG + Intergenic
1095279049 12:40327862-40327884 CTTCAATTTTAACTCCAGAAGGG + Intronic
1095355536 12:41268811-41268833 GTTCAAATTAAATTCGAGAAAGG + Intronic
1099372180 12:81848647-81848669 TTTCCATCTGAACTAGATAATGG + Intergenic
1099927577 12:89036704-89036726 TTTCCTTTTGGACTCAAGAAGGG - Intergenic
1100920671 12:99482523-99482545 GTTCCATATGAATTTTAGAATGG + Intronic
1101299884 12:103468327-103468349 GTTACATTTGGAATCCAGAATGG - Intronic
1101467949 12:104967290-104967312 GTTCCTTTTCAAGTGGAGAATGG - Intergenic
1102456021 12:113071316-113071338 CTTCCAGCTGAACTGGAGAAAGG - Intronic
1102733000 12:115130974-115130996 AATCCATTTGAACTGGAGATGGG + Intergenic
1103003272 12:117402373-117402395 AGTCCATTTGACCTCGAGGAGGG + Intronic
1112840943 13:103577183-103577205 GTTCCATTTAACCTTGAAAATGG + Intergenic
1114275972 14:21144789-21144811 GTTCCATATGAACTTTAAAATGG + Intergenic
1114358205 14:21938603-21938625 GTTCCATATGAATTCTAGAATGG + Intergenic
1114359415 14:21954553-21954575 GTTCCATTTGAATTTTAGAATGG + Intergenic
1114400691 14:22407510-22407532 GTTGAATTTGAAATCCAGAAAGG + Intergenic
1115880144 14:37906855-37906877 GTTCCATTTGTAATGGATAATGG - Intronic
1118162681 14:63306343-63306365 GTTCCATATGAATTTTAGAATGG - Intergenic
1118697846 14:68402347-68402369 CATCCATTTGAACTGGGGAAGGG - Intronic
1120601456 14:86515368-86515390 GTTCTATGTGAACTCAAGGAAGG + Intergenic
1130193566 15:81758916-81758938 GTTCCCTTTGATCTACAGAAAGG + Intergenic
1130901267 15:88208314-88208336 GTCCCATTTTAGCTGGAGAAAGG + Intronic
1131366296 15:91844926-91844948 GTTCCATCTGTACTCAAGACGGG - Intergenic
1138286528 16:55814694-55814716 GTTCCATCTGATATCCAGAAGGG - Intronic
1147876520 17:43625207-43625229 ATTCCATATGAATTTGAGAATGG - Intergenic
1149654019 17:58300837-58300859 GTTCCATTTGAAAGCAAGAAAGG - Intergenic
1151841931 17:76625201-76625223 GTTCCCTTGGAACTCCTGAAGGG + Exonic
1153309956 18:3668136-3668158 GTGCCATCTGAACAAGAGAAGGG - Intronic
1153353931 18:4114114-4114136 GTTCCATATGAATTTTAGAATGG + Intronic
1155054298 18:22171002-22171024 ATCCCATTTGAACTAGAAAAAGG + Intronic
1155102861 18:22630397-22630419 TTTCCATTTGAATTCTAGATTGG - Intergenic
1155681293 18:28490132-28490154 GTTCCATATGAACTCTAAAGTGG - Intergenic
1156795633 18:41042703-41042725 GTTCAATTATAACTCGATAAGGG + Intergenic
1158795700 18:60843655-60843677 GTTCCATATGAATTTGAAAATGG - Intergenic
1160303456 18:77707443-77707465 GTTCCATATGAATTCTAGGAAGG - Intergenic
1164414751 19:28037746-28037768 CTTCCTTTTGAACTCAGGAAAGG - Intergenic
1167781918 19:51603944-51603966 CTTCCATTAGAACTCAAGAAGGG + Intergenic
926534160 2:14089818-14089840 GTTCCATGTGCTCTTGAGAAAGG - Intergenic
929975304 2:46628082-46628104 GTTCCATATGAATTTTAGAATGG + Intergenic
930373802 2:50538841-50538863 GTTCCATTTGAACTCGAGAATGG + Intronic
931534103 2:63252910-63252932 GTTCCATATGAATTTTAGAATGG - Intronic
939254179 2:139721301-139721323 GTTCCTGTTTAGCTCGAGAATGG + Intergenic
941107175 2:161367798-161367820 CTTCCATTGGAACTCCAGCACGG - Exonic
943876652 2:193074539-193074561 CTTCCATTTTATCTCCAGAAGGG - Intergenic
944092571 2:195929371-195929393 GTTCCATGTGAATTTTAGAATGG - Intronic
1169987173 20:11458228-11458250 ATTCCATTTGAAGTTGTGAAAGG + Intergenic
952089214 3:29864538-29864560 GTTCCATTTTAACTCCATAGAGG - Intronic
953807236 3:46081109-46081131 GTTTCATCTGAGCTCCAGAACGG + Intergenic
956089992 3:65656334-65656356 GTTCCATTTGGCCTCCCGAAGGG + Intronic
956773473 3:72546569-72546591 GTGCCATTTGCACTCCAGACTGG - Intergenic
958687832 3:97423648-97423670 GTTCCATATGAATTTTAGAAAGG - Intronic
959245688 3:103864268-103864290 GTTCCATATGAATTTTAGAAGGG - Intergenic
959282182 3:104358261-104358283 GTTGCATTTGAACACGTTAATGG + Intergenic
959700408 3:109293338-109293360 GTCACATCTGAACTCGAAAAAGG - Intergenic
959825228 3:110786397-110786419 GTTCCATATGAATTTTAGAATGG + Intergenic
960954578 3:123022955-123022977 GATCCATCTGAAATAGAGAATGG + Intronic
962510055 3:136089577-136089599 GTTCCATATGAATTTTAGAATGG + Intronic
963871732 3:150423076-150423098 GTTCCATTTGAACACGTTAAAGG + Exonic
970361022 4:15308943-15308965 GTAGAATTTGAACTTGAGAAAGG - Intergenic
974500875 4:62700670-62700692 ATTCCATTTGTAATCAAGAAGGG - Intergenic
978807762 4:112818398-112818420 GCTGCCTTTGAACTCCAGAATGG - Intronic
984967680 4:185154730-185154752 GTTCCATATGAATTTTAGAACGG - Intergenic
988580809 5:32467262-32467284 GTTCCAATTGCACAAGAGAAAGG + Intergenic
991156998 5:63449834-63449856 GTTCCAATTGAACTCAGGGAAGG - Intergenic
992032458 5:72735774-72735796 GTTCCATATGAATTTTAGAACGG + Intergenic
992099577 5:73394151-73394173 TTTCCATTTGAAATGGAGTAGGG - Intergenic
992182993 5:74215995-74216017 ATTCCAGTTGAAATAGAGAAGGG - Intergenic
994643926 5:102446063-102446085 GTTCCAAATGAATTCTAGAATGG + Intronic
998922854 5:147088942-147088964 GTTCCATATGAATTTTAGAATGG + Intergenic
1002572542 5:180151213-180151235 GTTCCATATGAACTTTAGAGTGG - Intronic
1005453529 6:25997166-25997188 GTTCTATTTGTACTACAGAATGG - Intergenic
1007379097 6:41475261-41475283 GTTCCAATTGGAATGGAGAAAGG - Intergenic
1009055563 6:58330530-58330552 GTCCCATTTGGAATAGAGAAGGG + Intergenic
1010660435 6:78564291-78564313 GTTCCATTTAAAAACAAGAAAGG - Intergenic
1012665445 6:101962469-101962491 GTACCATGTGTACTTGAGAAGGG + Intronic
1020237910 7:6370670-6370692 ATTCCACTAGAACTCCAGAAAGG - Intergenic
1022432107 7:30334481-30334503 GTTCCATATGAATTTGAGAATGG + Intronic
1022432153 7:30335288-30335310 TTTCCTTTTAAACTCAAGAAAGG - Intronic
1027453620 7:78360828-78360850 GGACCATGAGAACTCGAGAATGG - Intronic
1038712136 8:29957334-29957356 TTTCCATCTTAACTCCAGAAAGG + Intergenic
1047855404 8:128904220-128904242 GTTATCTTTGAACTAGAGAATGG + Intergenic
1050716863 9:8538839-8538861 GTTTCCTTTCAACTGGAGAATGG - Intronic
1054949839 9:70837478-70837500 TTTCCATTTTAACTTGAGGATGG - Intronic
1055238445 9:74153702-74153724 GTTCCATATGAATTCTAGAATGG + Intergenic
1058173161 9:101706927-101706949 GTTTCATTTGAAAGTGAGAAGGG - Intronic
1058571821 9:106354532-106354554 GTTCCATATGAATTTTAGAATGG + Intergenic
1186941661 X:14515057-14515079 CTACCATTAGAACTCGAGGAAGG - Intergenic
1188612152 X:32113693-32113715 GTTGCTTGTGAAATCGAGAAAGG - Intronic
1199211563 X:145217552-145217574 ATTCCATTTGAAATCTGGAATGG - Intergenic