ID: 930375670 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:50563499-50563521 |
| Sequence | ACCAGATAACTCCTATATAC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 69 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 8, 4: 60} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 930375670_930375671 | 14 | Left | 930375670 | 2:50563499-50563521 | CCAGTATATAGGAGTTATCTGGT | 0: 1 1: 0 2: 0 3: 8 4: 60 |
||
| Right | 930375671 | 2:50563536-50563558 | ATTCTCAGTGAAGAAGAAAGTGG | 0: 1 1: 0 2: 1 3: 49 4: 478 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 930375670 | Original CRISPR | ACCAGATAACTCCTATATAC TGG (reversed) | Intronic | ||