ID: 930375670

View in Genome Browser
Species Human (GRCh38)
Location 2:50563499-50563521
Sequence ACCAGATAACTCCTATATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 60}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930375670_930375671 14 Left 930375670 2:50563499-50563521 CCAGTATATAGGAGTTATCTGGT 0: 1
1: 0
2: 0
3: 8
4: 60
Right 930375671 2:50563536-50563558 ATTCTCAGTGAAGAAGAAAGTGG 0: 1
1: 0
2: 1
3: 49
4: 478

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930375670 Original CRISPR ACCAGATAACTCCTATATAC TGG (reversed) Intronic