ID: 930377565

View in Genome Browser
Species Human (GRCh38)
Location 2:50587195-50587217
Sequence CCACCATGCCTGGCCAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3052
Summary {0: 6, 1: 28, 2: 174, 3: 703, 4: 2141}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930377565_930377575 18 Left 930377565 2:50587195-50587217 CCTGTTTTGGCCAGGCATGGTGG 0: 6
1: 28
2: 174
3: 703
4: 2141
Right 930377575 2:50587236-50587258 ACTCTTTGGGAGGCTGATGTGGG 0: 1
1: 57
2: 4019
3: 51860
4: 190605
930377565_930377574 17 Left 930377565 2:50587195-50587217 CCTGTTTTGGCCAGGCATGGTGG 0: 6
1: 28
2: 174
3: 703
4: 2141
Right 930377574 2:50587235-50587257 AACTCTTTGGGAGGCTGATGTGG 0: 3
1: 94
2: 6289
3: 81527
4: 185866
930377565_930377568 4 Left 930377565 2:50587195-50587217 CCTGTTTTGGCCAGGCATGGTGG 0: 6
1: 28
2: 174
3: 703
4: 2141
Right 930377568 2:50587222-50587244 CACCTGTAATCCCAACTCTTTGG 0: 47
1: 6055
2: 92127
3: 261405
4: 340893
930377565_930377571 8 Left 930377565 2:50587195-50587217 CCTGTTTTGGCCAGGCATGGTGG 0: 6
1: 28
2: 174
3: 703
4: 2141
Right 930377571 2:50587226-50587248 TGTAATCCCAACTCTTTGGGAGG 0: 148
1: 23351
2: 327020
3: 327342
4: 296136
930377565_930377569 5 Left 930377565 2:50587195-50587217 CCTGTTTTGGCCAGGCATGGTGG 0: 6
1: 28
2: 174
3: 703
4: 2141
Right 930377569 2:50587223-50587245 ACCTGTAATCCCAACTCTTTGGG 0: 47
1: 6363
2: 102483
3: 351576
4: 357259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930377565 Original CRISPR CCACCATGCCTGGCCAAAAC AGG (reversed) Intronic
Too many off-targets to display for this crispr