ID: 930377809

View in Genome Browser
Species Human (GRCh38)
Location 2:50589639-50589661
Sequence CCACCATGCCTGGCCAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3052
Summary {0: 6, 1: 28, 2: 174, 3: 703, 4: 2141}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930377806_930377809 4 Left 930377806 2:50589612-50589634 CCAAAGAGTTGGGATTACAGGTG 0: 47
1: 6055
2: 92127
3: 261405
4: 340893
Right 930377809 2:50589639-50589661 CCACCATGCCTGGCCAAAACAGG 0: 6
1: 28
2: 174
3: 703
4: 2141
930377805_930377809 5 Left 930377805 2:50589611-50589633 CCCAAAGAGTTGGGATTACAGGT 0: 47
1: 6363
2: 102483
3: 351576
4: 357259
Right 930377809 2:50589639-50589661 CCACCATGCCTGGCCAAAACAGG 0: 6
1: 28
2: 174
3: 703
4: 2141
930377801_930377809 17 Left 930377801 2:50589599-50589621 CCACATCAGACTCCCAAAGAGTT 0: 1
1: 5
2: 191
3: 7597
4: 87183
Right 930377809 2:50589639-50589661 CCACCATGCCTGGCCAAAACAGG 0: 6
1: 28
2: 174
3: 703
4: 2141
930377800_930377809 18 Left 930377800 2:50589598-50589620 CCCACATCAGACTCCCAAAGAGT 0: 1
1: 2
2: 127
3: 4895
4: 56576
Right 930377809 2:50589639-50589661 CCACCATGCCTGGCCAAAACAGG 0: 6
1: 28
2: 174
3: 703
4: 2141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930377809 Original CRISPR CCACCATGCCTGGCCAAAAC AGG Intronic
Too many off-targets to display for this crispr