ID: 930379286

View in Genome Browser
Species Human (GRCh38)
Location 2:50607192-50607214
Sequence GTCTGAAGTGAGCTGGCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930379286_930379289 29 Left 930379286 2:50607192-50607214 CCTGCCGCCAGCTCACTTCAGAC 0: 1
1: 0
2: 1
3: 12
4: 126
Right 930379289 2:50607244-50607266 GCATACACTCACAAGCTCTCTGG 0: 1
1: 0
2: 1
3: 14
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930379286 Original CRISPR GTCTGAAGTGAGCTGGCGGC AGG (reversed) Intronic