ID: 930379286

View in Genome Browser
Species Human (GRCh38)
Location 2:50607192-50607214
Sequence GTCTGAAGTGAGCTGGCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930379286_930379289 29 Left 930379286 2:50607192-50607214 CCTGCCGCCAGCTCACTTCAGAC 0: 1
1: 0
2: 1
3: 12
4: 126
Right 930379289 2:50607244-50607266 GCATACACTCACAAGCTCTCTGG 0: 1
1: 0
2: 1
3: 14
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930379286 Original CRISPR GTCTGAAGTGAGCTGGCGGC AGG (reversed) Intronic
900117678 1:1035419-1035441 GTCTGGAGTGAGGAGGAGGCTGG + Intronic
900163959 1:1237323-1237345 GGCTGAAGGGAGGTGGAGGCGGG + Intergenic
901772524 1:11537500-11537522 TTCTGCCGTGAGCAGGCGGCCGG - Exonic
901776943 1:11566602-11566624 GTCTGCACTGTGCTGGCGGAGGG - Intergenic
903387492 1:22936970-22936992 GACTGGAGTGAGGTGGAGGCAGG - Intergenic
904755843 1:32768124-32768146 GTCAGGACTGAGCTGGAGGCAGG - Intronic
907012758 1:50978304-50978326 CGCGGAGGTGAGCTGGCGGCGGG + Intergenic
908395875 1:63725281-63725303 GTCTGAAGTCACCTGGGGGATGG - Intergenic
915022099 1:152789137-152789159 CTCTGAAGTGAGCTAGAGCCTGG - Intronic
915217704 1:154350917-154350939 GGCTGCAGTGAGGTGGGGGCGGG + Exonic
915511382 1:156388682-156388704 GCCTGAAAAGGGCTGGCGGCCGG + Intergenic
918533581 1:185550047-185550069 GTCTGGAGTGAGGGGGCTGCAGG - Intergenic
923106027 1:230854612-230854634 GGGTGAAGTGAGCTGGCCTCAGG - Intronic
1063651749 10:7945134-7945156 GTCTGAAGTGCACTGGCCTCTGG + Intronic
1070773067 10:79093809-79093831 GTCTGCAGAGTGCTTGCGGCAGG - Intronic
1070986701 10:80695797-80695819 GACTGAAATGAGATGGGGGCAGG - Intergenic
1072326269 10:94301655-94301677 GTCTGAAGTGATCTGGAACCAGG + Intronic
1075256076 10:120926814-120926836 GGCAGAAGTGAGCAGGCGGGAGG + Intergenic
1076905875 10:133360745-133360767 GTCTGCACTGAGCTGGGGGCAGG + Intergenic
1077228442 11:1448337-1448359 GGCTGCAGTGTGCTGGCTGCCGG + Intronic
1081866889 11:46365094-46365116 GGCTGAGGTGAGCTGGCAGAGGG + Intronic
1083014275 11:59436699-59436721 GTTTGGAGAGAGCTTGCGGCTGG - Intergenic
1086351421 11:85945695-85945717 GTCTGAGGGGAGCTGGTGGATGG - Intergenic
1087265959 11:96061386-96061408 GTTTGAAATGAGCTGGAGGCAGG + Intronic
1087779929 11:102291066-102291088 GCCTGCACTGAGCTAGCGGCTGG - Intergenic
1088828185 11:113513400-113513422 TTGTGAAGTGACCTGGAGGCTGG + Intergenic
1089349699 11:117815419-117815441 GTCTGCACTGAGCTGCAGGCAGG + Intronic
1091323417 11:134667212-134667234 GTCAGAAGGGAGCTGTCTGCAGG + Intergenic
1091763164 12:3101063-3101085 GTCTGAAGTCATCTGGAGGAGGG + Intronic
1091885699 12:4015588-4015610 GCCTGCCCTGAGCTGGCGGCTGG - Intergenic
1094174118 12:27524261-27524283 GTGTGCTGCGAGCTGGCGGCCGG + Exonic
1097965010 12:65569862-65569884 GTCTGCAGTGACCTGACAGCAGG + Intergenic
1098255509 12:68611352-68611374 GGCTGAAGAGAGCGGGCGGGTGG - Intronic
1100992545 12:100266850-100266872 AGCTGAAGGGAGCAGGCGGCTGG - Intronic
1101592204 12:106134536-106134558 GTGTGGTGTGAGCTGGAGGCAGG - Intronic
1102952343 12:117039244-117039266 GTCAGGTGTGAGGTGGCGGCGGG - Intronic
1104163718 12:126205786-126205808 GTTTGAAGTGAGCTTGTGGATGG - Intergenic
1106004206 13:25753331-25753353 GTCAGCACTGAGCTGGGGGCTGG - Intronic
1108418971 13:50229249-50229271 GTCTAAAGTCACATGGCGGCTGG - Intronic
1119290463 14:73491345-73491367 GTCTGCAGGGAGCGCGCGGCGGG - Exonic
1119425694 14:74533503-74533525 GTCTGCAGTGAGCTGGAGGAGGG + Intronic
1121243886 14:92449138-92449160 GTCAACAGTGAGCTGGAGGCTGG + Exonic
1122798493 14:104218196-104218218 CCCTGAAGTGAAGTGGCGGCTGG + Intergenic
1126413455 15:48395151-48395173 GTCTGAAGGGATCTGGCTCCTGG + Intergenic
1131862991 15:96674657-96674679 CTCTGAAGTGGGCTGTCAGCAGG - Intergenic
1132221906 15:100111289-100111311 GTCTGATGGGAGCTGTCGGAGGG + Intronic
1132689161 16:1174859-1174881 GTCTGCAGCCAGCTGGCGGTGGG + Intronic
1132974268 16:2703637-2703659 GGCTGCCGTGAGCTGGCCGCAGG - Intronic
1138310874 16:56022818-56022840 GTCATAAGTGAGCAGGTGGCTGG - Intergenic
1138424531 16:56921972-56921994 GTCTGAAGTCAGCTTGGGGAAGG + Intergenic
1149449056 17:56735225-56735247 TTCTGTATTGAGCTGGGGGCTGG - Intergenic
1152371078 17:79888984-79889006 GACAGAAGTGAGCTGGCTTCGGG - Intergenic
1155172480 18:23277099-23277121 GTCTGCAGTCAGCTGAAGGCTGG + Intronic
1160082382 18:75740744-75740766 GACTGAACTGAGCTGGCTGGTGG + Intergenic
1163270970 19:16253748-16253770 GTCAGGAGTGAGCTGGAGCCAGG + Intergenic
1168607376 19:57770648-57770670 GTCTGAAGTCATCTGGCTGCAGG + Intronic
927489849 2:23513924-23513946 ATCTGACGTCAGCTGGCTGCCGG + Intronic
928025930 2:27738485-27738507 GTCAGACCAGAGCTGGCGGCCGG - Intergenic
930379286 2:50607192-50607214 GTCTGAAGTGAGCTGGCGGCAGG - Intronic
931146913 2:59529298-59529320 GGCTGAAGAGAGCTGAGGGCTGG + Intergenic
932404738 2:71505520-71505542 GTCTGCAGTCAGCCTGCGGCAGG - Intronic
936987726 2:118327470-118327492 GCATGGAGTGATCTGGCGGCTGG + Intergenic
946362850 2:219229444-219229466 GCCCTAAGTGAGCTCGCGGCGGG - Intronic
946414148 2:219531050-219531072 TTCAGAAGTGGGCTGGAGGCTGG + Intronic
947086981 2:226464609-226464631 GCCTGAAGTGAGGTGGCTTCTGG - Intergenic
948134742 2:235628180-235628202 GCCTGACGTGTGCTGGGGGCTGG - Intronic
1171191602 20:23163063-23163085 GTCTGAGGAGAGCAGGAGGCAGG + Intergenic
1171283926 20:23922484-23922506 GACTGAAGTGAGCTGGGGATTGG - Intergenic
1176295038 21:5067282-5067304 GTCTGAGCTGAGCTGGTGGGGGG - Intergenic
1179088079 21:38238101-38238123 GGCTGAAGTCACCTGGTGGCAGG + Intronic
1179807469 21:43848929-43848951 GTCTGAAGTCAGCTGGAGGCCGG + Intergenic
1179862011 21:44194846-44194868 GTCTGAGCTGAGCTGGTGGGGGG + Intergenic
1181861011 22:25818163-25818185 CTCTGGAGTGGGCTGGGGGCAGG + Intronic
1182091144 22:27595739-27595761 GTCTGAGGGGAGGTGGTGGCGGG - Intergenic
1183526768 22:38327699-38327721 GGCAGAGGTGAGCTGGAGGCCGG - Intronic
1185099157 22:48828366-48828388 GTATGAGGTGAGCTGTTGGCTGG + Intronic
1185233195 22:49694922-49694944 GGCTGGAGGGAGCTGGCAGCTGG - Intergenic
1185247297 22:49779961-49779983 GTCTGGAGTGTGCTGGGGGCCGG - Intronic
1185269508 22:49922667-49922689 GTGTGAAGTGGGCTGGGTGCTGG + Exonic
950492386 3:13313921-13313943 GGATGAAGTGAGCTGGTGACTGG + Intergenic
950723990 3:14904126-14904148 GGCTGAAGTCACCTGGTGGCAGG + Intronic
951048939 3:18072706-18072728 TTCTGAAGTGCACTGTCGGCTGG - Intronic
955039181 3:55298282-55298304 GGCTGTAGTGAGCTGGCAGCTGG - Intergenic
958026722 3:88058624-88058646 GTCTCAAGGGAGGCGGCGGCAGG + Intronic
960163790 3:114379030-114379052 GAGGGAAATGAGCTGGCGGCAGG - Intronic
960247027 3:115411239-115411261 GACTGAAGTGAGCTGGAGTTTGG + Intergenic
962344590 3:134610034-134610056 CTCTGAAGTGGGCTGGCTCCAGG - Intronic
962422552 3:135241191-135241213 GGCTGAAGTGAACTTGCGGTAGG - Exonic
962755551 3:138463096-138463118 GTGTGAAGGGAGGTGGTGGCGGG + Intronic
966916080 3:184584695-184584717 GTAGGAAGTGCGCTGGGGGCGGG - Intronic
967035534 3:185646108-185646130 GTCTGCAGGGAGCTGCCTGCAGG - Intronic
967981100 3:195065910-195065932 CTCTGCAGTGATCTGTCGGCAGG + Intergenic
968176261 3:196551881-196551903 GCCTGAAGGGAACTGGTGGCAGG - Intergenic
968620116 4:1600180-1600202 GTGTGAGGTGAGCTGAGGGCTGG + Intergenic
968818424 4:2833459-2833481 GTCTGAAGTGCTCTGGGTGCAGG + Intronic
968915676 4:3496165-3496187 GTCTGAAGGGCGCTTGCGGGAGG - Intronic
969606089 4:8202949-8202971 GTATGAGGTGAGCTGGGGCCTGG + Intronic
971341161 4:25770258-25770280 GTCTAAAGTGATCTGGTGGTGGG + Intronic
980625183 4:135365645-135365667 GTCTCAAGTGATCTGTCTGCTGG - Intergenic
981731985 4:147909232-147909254 GTCTGAAGTGAGGTTGAGGTGGG + Intronic
983090292 4:163494518-163494540 GGCGGAAGGGAGCTTGCGGCGGG - Exonic
989011232 5:36875861-36875883 GTTTGAAATCAGCTGGCCGCAGG + Intergenic
996353376 5:122570486-122570508 GTCTTAAGTGAGATAGCTGCAGG - Intergenic
997694548 5:135850905-135850927 GTCTAAAGTGACCTGGGCGCAGG - Intronic
997758417 5:136421955-136421977 GTCTGTGGTGAGCAGGCTGCTGG + Intergenic
998201970 5:140132134-140132156 GTCTGAAGGAAGCTGGCAGATGG + Intergenic
1001039201 5:168320732-168320754 GGCTGAAATGAGATGGTGGCTGG + Intronic
1004537599 6:16518139-16518161 GGCTTGAGTGAGCTGGGGGCGGG + Intronic
1006658878 6:35622055-35622077 ATTTGAAGTGAGCTGGTGGTAGG + Intronic
1006672754 6:35739751-35739773 TCCTGAAGTGAGCTTGTGGCAGG - Intronic
1018511944 6:164533750-164533772 CCCTGAAGTGAGCTGGCAGCTGG - Intergenic
1018901919 6:168055956-168055978 GTCTCCAGTGAGCTGGAGGGTGG + Exonic
1019481576 7:1269499-1269521 GTCTGAGCTGAACTTGCGGCAGG - Intergenic
1019908136 7:4080187-4080209 GTCTGGGGAGAGCTGGGGGCGGG + Intronic
1021027456 7:15686717-15686739 GTGTAACGTGAGCTGGGGGCTGG + Exonic
1024465681 7:49709628-49709650 GTCTGGAGTGAGATGGTGACTGG - Intergenic
1024962416 7:54991510-54991532 TCCTGATGTGAGCTGGCGGCAGG - Intergenic
1026823795 7:73568472-73568494 GACAGAAGTGAGCTGGAGGGCGG - Intergenic
1029476160 7:100786091-100786113 GTCGGAAGTGAGCTGGCAGTGGG - Exonic
1029610796 7:101625553-101625575 GACAGCAGTGAGCTGGGGGCAGG - Intronic
1033328487 7:140398492-140398514 GCCAGGGGTGAGCTGGCGGCGGG - Exonic
1034891928 7:154847821-154847843 GGCTGAAGTGAGGGGGCGGCAGG - Intronic
1035257704 7:157642303-157642325 TTCAGAAATGAGCTGGCGTCAGG - Intronic
1035551713 8:533066-533088 CTCTGAAGTGGTCTGGAGGCAGG - Intronic
1040014540 8:42689884-42689906 GGCTGAAGTGTGCAGGCGCCCGG + Intergenic
1041689892 8:60678672-60678694 GCCCGGAGGGAGCTGGCGGCGGG + Intergenic
1045245395 8:100437784-100437806 GTCTGAAGTTAGGTGTCAGCAGG - Intergenic
1047137602 8:122098088-122098110 GTCTGAAGATAGCTAGCTGCTGG + Intergenic
1049389319 8:142359985-142360007 CTCAGAAGTGAGCTGGGTGCAGG + Intronic
1053168949 9:35864796-35864818 GTCTGTAGGGAGCTGGAGCCAGG + Intergenic
1055045573 9:71920669-71920691 GGTTGAAGTGAGCTGGCAGCTGG - Intronic
1055808953 9:80128745-80128767 GTCAGAAGTGAGCAGGAAGCAGG + Intergenic
1057788229 9:98104659-98104681 CTTTGAAGAGAGCTGGTGGCTGG + Intronic
1060795220 9:126508431-126508453 GGCTGCAGGGAGCTGCCGGCGGG - Intergenic
1062369121 9:136227914-136227936 GGCTGCAGTGAGCCGGCGACAGG + Intronic
1188543826 X:31279679-31279701 ATCTGTAGTCAGCTGGCAGCTGG - Intronic
1188897445 X:35686501-35686523 GTCTGAAATGCGCTGGCTTCAGG + Intergenic
1193270977 X:79530318-79530340 GTCTGAAGTCCGCTGGAGACAGG - Intergenic
1197443203 X:126515011-126515033 GTCTGAAGTAAGGTGGCCCCTGG - Intergenic
1200232730 X:154452253-154452275 GTCAAAAGTGAGCTGGAGGCCGG + Intergenic