ID: 930380048

View in Genome Browser
Species Human (GRCh38)
Location 2:50616600-50616622
Sequence TAGAATACAGAACCCTATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930380048_930380056 24 Left 930380048 2:50616600-50616622 CCTTGATAGGGTTCTGTATTCTA 0: 1
1: 0
2: 1
3: 9
4: 127
Right 930380056 2:50616647-50616669 CTTGGTCAAGTAACTTCTCTAGG 0: 1
1: 0
2: 7
3: 33
4: 249
930380048_930380051 6 Left 930380048 2:50616600-50616622 CCTTGATAGGGTTCTGTATTCTA 0: 1
1: 0
2: 1
3: 9
4: 127
Right 930380051 2:50616629-50616651 CTGGACCCCCTTATTACTCTTGG 0: 1
1: 0
2: 1
3: 9
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930380048 Original CRISPR TAGAATACAGAACCCTATCA AGG (reversed) Intronic
904984887 1:34537235-34537257 CAGAATACATAACCCTAGCATGG - Intergenic
906339342 1:44964849-44964871 TAGGCTACAGAACTCTATTATGG + Intronic
909884068 1:80918435-80918457 TAGTATACTGACCCATATCAGGG - Intergenic
911650946 1:100387778-100387800 TAGAATACAGAGACTTATCCTGG - Intronic
915866953 1:159511963-159511985 CAGAATAAAGAACATTATCATGG - Intergenic
916862945 1:168825618-168825640 TATACCACAGAACCCTATAAAGG - Intergenic
918130122 1:181620113-181620135 TATAATAGAAAACCCTATCTTGG - Intronic
920271419 1:204767450-204767472 TAGAATACATAAGCCCATCAGGG - Intergenic
1064934651 10:20666265-20666287 TACAATACACAACCATCTCAAGG - Intergenic
1068839813 10:61598554-61598576 TAGAATACAGAAAACTCACAAGG - Intergenic
1069155782 10:65029445-65029467 TTTAATAGAGAACCATATCAAGG + Intergenic
1074932235 10:118140050-118140072 TAGAATAGACAATCCTATCCTGG + Intergenic
1080460447 11:32450327-32450349 TAAAAGACAGAACTCCATCAAGG + Intergenic
1081270021 11:41071792-41071814 TAGAATAGAGAATCCTTTCCAGG - Intronic
1085210459 11:74772317-74772339 CAGAAAACAGAAACCTCTCAAGG - Intronic
1087729222 11:101759579-101759601 CAGAATCCAGAAATCTATCAAGG - Intronic
1089636361 11:119815761-119815783 TCCAATACAGAATCCTATCTAGG + Intergenic
1100955806 12:99906764-99906786 TAGAATAAAGAAGCATATGAAGG - Intronic
1101763533 12:107678370-107678392 TAGAATACAGAGCCCTCAGAGGG + Intergenic
1104676964 12:130717600-130717622 TATAATTCAGAAGCCTATCCGGG - Intergenic
1105308227 13:19183874-19183896 CAGGATGCAGCACCCTATCATGG + Intronic
1107456738 13:40562483-40562505 TAAATTACAGAGCCTTATCAGGG + Intronic
1108324331 13:49315197-49315219 AGGAATACAGAACCCTCTCTGGG + Intronic
1112744007 13:102507253-102507275 TAGGAACCAGAACCCTATGAAGG - Intergenic
1113774072 13:112932703-112932725 TAAAATACAGATACCTATGAGGG - Intronic
1118919255 14:70134796-70134818 TAGAATAAAGTTCCCTACCATGG + Intronic
1120026999 14:79597735-79597757 TAGAAGACATAGCCCTTTCATGG + Intronic
1120782679 14:88499884-88499906 TAGAACACAGAATACTATAAAGG + Intronic
1122763398 14:104047335-104047357 TAGAATACAGAAGTTTAACAAGG - Intronic
1127015874 15:54687219-54687241 TAGATTTCAGAAGCCTGTCAAGG + Intergenic
1129260972 15:74367151-74367173 TACAATACAGAAATATATCAGGG - Intronic
1130548151 15:84871373-84871395 TAGAATGATGAACCCTATCAAGG - Exonic
1130882592 15:88068122-88068144 GAGGATACAGAACACTATTAAGG + Intronic
1131039298 15:89247381-89247403 TAGAATACAGATTCCTAATAAGG + Intronic
1133249394 16:4470518-4470540 TAGAATACAAAACCATATTCAGG + Intronic
1136153215 16:28365552-28365574 TAGAAATCAGAACCCTAGGAAGG + Intergenic
1136209871 16:28749721-28749743 TAGAAATCAGAACCCTAGGAAGG - Intergenic
1137266132 16:46870504-46870526 GAGTATCCAGAACCCTATTATGG - Intergenic
1140097409 16:71886590-71886612 TGGAATATAGAGCCCTAACAAGG - Intronic
1144453292 17:15398807-15398829 TAGACCACAGAACCCTCTAATGG - Intergenic
1145945315 17:28769657-28769679 TAAAATACAAAATCCTAACATGG + Intronic
1153680039 18:7491799-7491821 TTGAAGAGAGAACTCTATCAAGG + Intergenic
1153824070 18:8858606-8858628 TACAACACAAACCCCTATCAAGG - Intergenic
1154055750 18:11012433-11012455 TAGAATCCAGAAAACTATAATGG - Intronic
1154505343 18:15033602-15033624 CACAAGAAAGAACCCTATCAGGG - Intergenic
1156586151 18:38433520-38433542 GAGAAGACAGACCTCTATCAGGG + Intergenic
1158350422 18:56559658-56559680 TAGAATACAGAAACCTGCTAAGG + Intergenic
1162175292 19:8825812-8825834 TAGAACACAGACCCCTTTCTTGG - Intronic
1164858157 19:31541323-31541345 TAAAATGCAGAACCCTTTCCGGG + Intergenic
930380048 2:50616600-50616622 TAGAATACAGAACCCTATCAAGG - Intronic
931706683 2:64952076-64952098 TAGAAAACAAAGCCCTATGAGGG + Intergenic
934510419 2:94935241-94935263 TATAAAACAGAATCCTCTCATGG + Intergenic
938212827 2:129482939-129482961 TAGAGGACAGAACCCTAGAAGGG - Intergenic
938673588 2:133608097-133608119 TAGAATAAACAACTCTATCTTGG - Intergenic
939617924 2:144381061-144381083 TAGAAAACAGAACCATTTTATGG - Intergenic
940721653 2:157289087-157289109 TAGAATACAGAACCAAATATGGG + Intronic
941081856 2:161070946-161070968 CAGGAAATAGAACCCTATCATGG - Intergenic
941525489 2:166601611-166601633 TAGAATACATAATCACATCAGGG - Intergenic
944464645 2:199988456-199988478 TACAATACAGAGCCCTCCCAAGG - Intronic
944555731 2:200886364-200886386 TGGAATACAGTATCATATCAAGG - Intronic
948490302 2:238308505-238308527 GGGAATACAGAACCATTTCAAGG - Intergenic
1169951165 20:11045049-11045071 TAGAATACAAAACCAAAACAAGG - Intergenic
1170905967 20:20515529-20515551 CAGAATACACATCCCTATGAGGG + Intronic
1171755671 20:29105922-29105944 TAGAATACTTAACCCTAACCTGG - Intergenic
1171787003 20:29476968-29476990 TAGAATACTTAACCCTAACATGG + Intergenic
1171860964 20:30402410-30402432 TAGAATACTTAACCCTAACCTGG - Intergenic
1174950271 20:55034833-55034855 TAGCATAAAGAACCCTGTCAAGG + Intergenic
1177054820 21:16288522-16288544 GAGAATACATAACCAAATCATGG + Intergenic
1177928526 21:27249908-27249930 TGGATGACAGAACCCAATCAAGG + Intergenic
1177984559 21:27958050-27958072 TAGAATATAGAAGCCAATGATGG + Intergenic
1180295957 22:10936215-10936237 TAGAATACTTAACCCTAACCTGG + Intergenic
1180412711 22:12629790-12629812 TAGAATACTTAACCCTAACCTGG - Intergenic
1180955981 22:19741546-19741568 TAGAGAAAAAAACCCTATCATGG - Intergenic
1181840160 22:25650499-25650521 TAGAAAATAGAACCAGATCAGGG + Intronic
1182443695 22:30378305-30378327 TATAAGACAGAACCCAACCATGG + Intronic
1184540319 22:45118861-45118883 CAGAATACAGAAACCTATAGAGG - Intergenic
950231203 3:11277374-11277396 TGCCATACAGAACTCTATCAGGG + Intronic
951660212 3:25055169-25055191 TAAAATACACAACCATGTCACGG + Intergenic
954767911 3:52937285-52937307 TAGAATATATAACCCTAACTGGG + Intronic
958159432 3:89798668-89798690 TAGAATACAGATCTCATTCAGGG + Intergenic
959449508 3:106481416-106481438 TAGAACACAGAAGCCTAGTATGG - Intergenic
959611944 3:108305179-108305201 TAGAAAACAGAACCTGAGCAAGG + Intronic
960471683 3:118074427-118074449 AGGAATTCAGAATCCTATCAGGG - Intergenic
961177666 3:124849121-124849143 GAGAAGACAGAACACTACCAAGG - Intronic
962884592 3:139612383-139612405 ATGAATACAGAACCTTATCCAGG + Intronic
962941409 3:140128011-140128033 TAGAACAAAGAATCCTATCATGG - Intronic
963189033 3:142448225-142448247 TAGAAAGCACAACTCTATCATGG - Intergenic
967959222 3:194907102-194907124 TAGAAGACAGAGGCCTTTCATGG - Intergenic
968693754 4:2009921-2009943 TATAATACAGAAGCCAAGCAAGG - Exonic
970474611 4:16409673-16409695 TGGAGTAGAGAACCCCATCATGG + Intergenic
973174229 4:47184633-47184655 TAGACTACAGAAGCCAATCCAGG + Intronic
978084251 4:104631291-104631313 CAGAATAGAGAAACCTATGATGG - Intergenic
978727235 4:111983680-111983702 TTGAATATAGAACCCTAACATGG - Intergenic
980505325 4:133711847-133711869 TAGAATACAGAATCCCAGTATGG + Intergenic
981094122 4:140760940-140760962 AAGCAGTCAGAACCCTATCAGGG - Intergenic
981865590 4:149414629-149414651 TAAAATACAGAAAATTATCATGG - Intergenic
983218363 4:165021576-165021598 TAGAATAGAGAACCCCAGCCAGG + Intergenic
985770748 5:1808939-1808961 TAGAATACCGACCCCATTCATGG - Intronic
985806829 5:2051650-2051672 TAGAATTCAGTTCCCTTTCATGG - Intergenic
988262841 5:28911224-28911246 TAGAATTCAGAAAACTCTCATGG + Intergenic
988341037 5:29972313-29972335 TAGAACACAGAAGATTATCAAGG - Intergenic
988707015 5:33736462-33736484 CAGAATACAAAACCCTCTGATGG - Intronic
988977790 5:36531994-36532016 TAGAGTAAAGAACACTGTCATGG + Intergenic
995173335 5:109143402-109143424 GAGAAAACAGAACCCTAACTAGG + Intronic
1000012064 5:157242461-157242483 TAGACTCCAGGACCCTATCAAGG - Intronic
1001300388 5:170529363-170529385 CATAACACAGAACCCTATCTAGG - Intronic
1001451565 5:171829058-171829080 TAGAACACATAACCCAATCCTGG + Intergenic
1010800776 6:80173238-80173260 TTGAATACTGAACCTCATCAGGG - Intronic
1011001691 6:82596217-82596239 TAGGATACAGAACTCAATAAAGG - Intergenic
1011213382 6:84978233-84978255 TAGAATACAAAATCCTCTCTGGG - Intergenic
1011947483 6:92924494-92924516 AAGAATCAAGAACCATATCAAGG - Intergenic
1012701486 6:102462225-102462247 TAGAATTTAGAACTCTATCTAGG - Intergenic
1013979719 6:116115251-116115273 TAGAATACAGTACTCTAGGAGGG + Intronic
1013995736 6:116305524-116305546 TAGTATACAGATCACTATTAAGG + Intronic
1015275760 6:131381996-131382018 TACAATAGAGAATCCTAACAAGG - Intergenic
1016990605 6:149925585-149925607 GAGCACACAGAACCATATCAAGG - Intergenic
1020724810 7:11798799-11798821 TAGAAAACAGTACTCTATAAAGG + Intronic
1020782453 7:12534047-12534069 TAGCACACAGATCCCTATGAAGG + Intergenic
1023553692 7:41397857-41397879 AAGAATACAGAACTCTAACTTGG + Intergenic
1024336361 7:48210770-48210792 TAGAATATGGAACACTCTCAAGG - Intronic
1028883621 7:95908245-95908267 TTGTTTATAGAACCCTATCATGG + Intronic
1030837756 7:114310361-114310383 TTGACTACAGAAGCCTATCAAGG + Intronic
1032287767 7:130555464-130555486 AAGAATAGAGAAAGCTATCAAGG + Intronic
1034001185 7:147415005-147415027 TAGAAAACAGAACCCAAAGAGGG + Intronic
1037404793 8:18530383-18530405 TAGGATACAGTACCCAATCCTGG + Exonic
1045358321 8:101409384-101409406 TAGAATACAGAACCCTCTCCTGG + Intergenic
1045555971 8:103214879-103214901 GACAATACAGAACTCTATTAAGG - Intronic
1046860346 8:119084591-119084613 AAGATCACAGAACTCTATCAAGG + Intronic
1055859588 9:80731496-80731518 TAGAATACAGAAACCCAGGATGG - Intergenic
1059798363 9:117724730-117724752 TAAAATAAAGAACACTCTCAAGG - Intergenic
1202802815 9_KI270720v1_random:17234-17256 TAGAATACTTAACCCTAACCTGG + Intergenic
1203447602 Un_GL000219v1:74452-74474 TAGAATACTTAACCCTAACCTGG + Intergenic
1196259872 X:113566070-113566092 AAGATTACAGAAACCTATAAAGG + Intergenic
1198233663 X:134716455-134716477 AAGCATACAGAGCCCTGTCAGGG + Intronic
1198285597 X:135187540-135187562 TAAAATACAGAACTCAATCTGGG + Intergenic
1198666424 X:139028935-139028957 TAGAATAAAGAACCCAATACTGG + Intronic
1198668465 X:139051344-139051366 TAGGATACACAACCTGATCAAGG - Intronic
1199006522 X:142704904-142704926 TAAAATCCAGAATCCAATCAAGG + Intergenic