ID: 930384064

View in Genome Browser
Species Human (GRCh38)
Location 2:50670087-50670109
Sequence CTAGATAAATATATGCAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 193}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930384064 Original CRISPR CTAGATAAATATATGCAGCT AGG (reversed) Intronic
902427054 1:16331753-16331775 ATAAATAAATAAATGCAGCCAGG + Intronic
905598417 1:39229368-39229390 ATAGATAAATATATTCACCTGGG + Intronic
908062124 1:60362556-60362578 CCTGATAAATATATGCTGTTAGG - Intergenic
910072266 1:83231320-83231342 TTAGATAAATGTATACATCTTGG + Intergenic
911785439 1:101940675-101940697 CTGGATATATATATATAGCTGGG - Intronic
913345168 1:117801836-117801858 CTACATAAATATATGCTAATGGG + Intergenic
913704817 1:121409554-121409576 CTATATAAATACTAGCAGCTGGG + Intergenic
915391997 1:155552168-155552190 CTAAATAAATATATGAAGGCCGG + Intronic
916436357 1:164781437-164781459 ATAGATCAATATATGCAGAAAGG + Intronic
922736542 1:227985945-227985967 CTATATATATATATGTAGCAAGG + Intergenic
1063263328 10:4415402-4415424 GTAGAAAACTATATGCAGCTAGG - Intergenic
1064869229 10:19919432-19919454 CTGTAAAAATATCTGCAGCTTGG + Intronic
1065306720 10:24376200-24376222 CTCCATAGATATATGTAGCTAGG - Intronic
1068482035 10:57603552-57603574 CTACATAAATATACTCAGTTGGG + Intergenic
1068884102 10:62080671-62080693 CTTGATAAATTTCTACAGCTTGG - Intronic
1070603421 10:77881597-77881619 CTAGATAAATATCTCCATCCTGG + Intronic
1071215505 10:83395962-83395984 CTAGATAAATAGATGCTATTGGG - Intergenic
1072762360 10:98067229-98067251 CTAGAAAAAAATATGCTGCTGGG - Intergenic
1073160620 10:101391267-101391289 CTAAATAAATATATTCAACTGGG + Intronic
1073844331 10:107536377-107536399 CTAGAGCAATATATTCAACTTGG + Intergenic
1078193133 11:9109946-9109968 ATAAATAAATAAATGAAGCTAGG + Intronic
1078821038 11:14882448-14882470 CTAGAGAAATATGTGCACATGGG + Intronic
1080583482 11:33661980-33662002 ATTTAAAAATATATGCAGCTTGG + Intronic
1081472775 11:43391872-43391894 TTAGATAAATATGTGAAGATTGG - Exonic
1083496994 11:63064184-63064206 GTAGATAAATCTATGAAGATGGG - Intergenic
1085797935 11:79560665-79560687 CTATTTACATATATGCAGCTAGG + Intergenic
1088143057 11:106641162-106641184 CTAGATTAATATATAAAGTTGGG + Intergenic
1090016060 11:123087525-123087547 ATAAATAAATATTTGCGGCTCGG + Intronic
1093941297 12:25057552-25057574 CTAAAAAAATACATGCAGCTGGG - Intronic
1094817403 12:34201635-34201657 CTAGATAAATATAGAAAGTTGGG + Intergenic
1095099716 12:38167690-38167712 CTAGGTAAATATAGAAAGCTGGG - Intergenic
1098663812 12:73134356-73134378 CCAGATATAGATATGAAGCTGGG + Intergenic
1098865927 12:75763535-75763557 TTAGATAAATGTATGTAGCTGGG + Intergenic
1098867553 12:75780250-75780272 CCAGAGAAATGTAGGCAGCTGGG - Intergenic
1099117490 12:78645968-78645990 CTAGATAAAAATAGGCAGTTAGG - Intergenic
1099305170 12:80945142-80945164 CTAAATAAAAATATTCAGGTTGG - Intronic
1100289036 12:93196334-93196356 CTAGAAAAAGACATGCAGATTGG + Intergenic
1100400328 12:94223787-94223809 TTAGGTAAATATTTGCAGCGTGG + Intronic
1100545414 12:95597471-95597493 TTATATATATATATGTAGCTGGG + Intergenic
1102968089 12:117144095-117144117 CTAGATACATATGTACAGCTGGG + Intronic
1105073846 12:133257377-133257399 CTAGATAAATATAGAAAGTTAGG + Intergenic
1107112944 13:36717132-36717154 CTAGTTGAATGTCTGCAGCTGGG + Intergenic
1108738610 13:53311411-53311433 TTAAAAAAATATATACAGCTAGG - Intergenic
1110929810 13:81200645-81200667 ATATATAAATATATGTAGCCTGG - Intergenic
1111891924 13:94093310-94093332 CTAGATATCCATATGCAGTTTGG - Intronic
1111895751 13:94139442-94139464 CTAAATAAATATCTCCAGATTGG + Intronic
1113498005 13:110748581-110748603 CTGAATTAATATATGCAACTGGG - Intergenic
1114291742 14:21294114-21294136 CTAGATAAAAATATCCAATTAGG - Intronic
1115103843 14:29736231-29736253 CTGGATAAAAATATGCATATTGG + Intronic
1115274797 14:31595591-31595613 ATAAATAAATGTATGCAGCTGGG - Intronic
1117979900 14:61332325-61332347 CTTGATAAATATCTCCAGATAGG - Intronic
1118589659 14:67392020-67392042 CAAGACAAATATGTGAAGCTGGG + Intronic
1120511287 14:85418278-85418300 TTATATAAATAGATGCAGATAGG + Intergenic
1121349132 14:93159804-93159826 ATATATAAATATATTTAGCTGGG + Intergenic
1125212531 15:37234024-37234046 ATAGTGAAATATATGCAGGTAGG + Intergenic
1129645469 15:77426829-77426851 AGAGAGAAATATAAGCAGCTAGG + Intronic
1130536864 15:84791991-84792013 CTACAGAAATATTTGCAGCAGGG + Intronic
1131243615 15:90770474-90770496 CTAGATAAATATGTGGGGATTGG - Intronic
1131678164 15:94692885-94692907 CTAGATAAATATCTGCCCCCTGG + Intergenic
1133581893 16:7152545-7152567 CTTGATAAAGATAGGCAGTTAGG + Intronic
1133633588 16:7645043-7645065 TTAGATCAATATATTCAGCTTGG + Intronic
1134618854 16:15672507-15672529 TAAGAGAAATATATTCAGCTGGG + Intronic
1134854600 16:17507747-17507769 CTAGAAAAATAAATGCAGCTGGG + Intergenic
1138181800 16:54945475-54945497 CTAGCTGAATATATACAGGTTGG + Intergenic
1140754295 16:78053694-78053716 TTATATAAATATTTGCAGATGGG + Intronic
1148708630 17:49659506-49659528 CTAGAAAAATATAAGTAGGTTGG - Intronic
1150040554 17:61855723-61855745 CTAGATAAATATTTGTTGTTAGG - Intronic
1151159484 17:72152879-72152901 TTAGAGAATTATATGCACCTTGG - Intergenic
1153068391 18:1075692-1075714 CCAGATAACAATATGCAGCCAGG + Intergenic
1153472099 18:5458056-5458078 CAAGCTAAATAAATGCATCTGGG + Intronic
1156417167 18:36908704-36908726 CTAGATAAATATATTCACACTGG - Intronic
1157105648 18:44771987-44772009 CTAGACAAATAAATGCTGCCGGG - Intronic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1159388240 18:67755140-67755162 CTAGCTAAAAATATGCATCTGGG - Intergenic
1159982172 18:74796448-74796470 CTATATAGAAAAATGCAGCTTGG - Intronic
1161540797 19:4850237-4850259 TTAAATAAATACATGCAGCTGGG - Intronic
1163082182 19:14952142-14952164 TTAAATATATATTTGCAGCTGGG + Intronic
1163962139 19:20706776-20706798 CTAGAGAAATATATACAGCCAGG + Intronic
1168333253 19:55581440-55581462 GTAGACAAATATATGCAGGCTGG - Intergenic
925381218 2:3427585-3427607 CCAGGTAAAAATATCCAGCTTGG + Intronic
925474230 2:4194516-4194538 CCAGATAAATATATACTGCATGG + Intergenic
927600721 2:24437899-24437921 CAAGAAAAATATCTCCAGCTGGG - Intergenic
928303815 2:30148648-30148670 TTAGTAAAATATATGTAGCTTGG + Intronic
929173108 2:38950911-38950933 CTACAAAAATACATGCAGCAGGG - Intronic
930187801 2:48427673-48427695 CTATATAAATAAATGCACTTTGG + Intergenic
930384064 2:50670087-50670109 CTAGATAAATATATGCAGCTAGG - Intronic
937191246 2:120101438-120101460 CCAAATAAATATATGTGGCTTGG + Intronic
939514180 2:143145641-143145663 CTAGGTAAATATTGGCAACTGGG - Intronic
941095277 2:161233233-161233255 TTATATAGATATATGTAGCTGGG + Intronic
942240296 2:173957513-173957535 CTAAATAATAATATGCAGTTTGG + Intronic
942409767 2:175696666-175696688 CTAGATAAATAAATTCAGGCAGG + Intergenic
943477202 2:188372223-188372245 CTGGAGAACTAGATGCAGCTGGG - Intronic
946373209 2:219293157-219293179 ATAAATAAATAAATGCAGTTTGG - Intronic
1169183329 20:3590490-3590512 CTAGAAAGGTATATGAAGCTTGG - Intronic
1170398216 20:15951284-15951306 CTAGATAAATATATCCTCCTAGG - Intronic
1171569033 20:26228623-26228645 CTAAATGATGATATGCAGCTTGG + Intergenic
1171779227 20:29403967-29403989 CTAGATAAATATAGAAAGTTGGG + Intergenic
1172159315 20:32854770-32854792 TTATATATATATATGCAGTTTGG + Intergenic
1173351075 20:42246146-42246168 ATTGATATATATATGCAGCTGGG + Intronic
1173493200 20:43500192-43500214 CTGGAGAAATATTAGCAGCTGGG - Intergenic
1175744618 20:61446831-61446853 CTTAATAAATATATTCAGTTTGG + Intronic
1177361143 21:20073524-20073546 CTAGATTAATATATGTAACTGGG - Intergenic
1177931234 21:27286434-27286456 CTGAATAAATAAATGCATCTGGG + Intergenic
1178216209 21:30601561-30601583 CTAGATAAATAAATATAGGTAGG - Intergenic
1178810638 21:35878243-35878265 CCAGATAAATAAATGCCGGTTGG + Intronic
1178984243 21:37289402-37289424 TTAAATAAATATAGGCAGCTGGG - Intergenic
1180281896 22:10707023-10707045 CTAAATGATGATATGCAGCTTGG - Intergenic
1182982817 22:34687564-34687586 GTAAATAAATAAATGCTGCTAGG + Intergenic
1183563825 22:38598331-38598353 GTAGATAAAGATATTGAGCTTGG + Intronic
1184529659 22:45046937-45046959 CCAGTTAAAGATATGCAGCAAGG + Intergenic
1203239138 22_KI270732v1_random:38184-38206 CTAAATGATGATATGCAGCTTGG - Intergenic
949927246 3:9051309-9051331 GTTGTTAAAAATATGCAGCTAGG - Intronic
950604878 3:14069757-14069779 CTACATCAATATATTCAACTTGG + Intronic
950954864 3:17041584-17041606 GTAACTAAATATATGCAGGTTGG - Intronic
951415018 3:22413678-22413700 GTAGATAAATCTATGAAGATGGG - Intergenic
951726336 3:25765162-25765184 CAAGATAAAAAGTTGCAGCTGGG + Intronic
951963819 3:28359523-28359545 CTAGAGAAAAATATGTATCTTGG + Intronic
952043538 3:29289297-29289319 GTAAATAAAAATATGCAGTTGGG - Intronic
952551375 3:34482299-34482321 CTCAATAGATATATCCAGCTGGG + Intergenic
953096415 3:39781050-39781072 CTAGATTATTATATGGAACTAGG - Intergenic
953938310 3:47066642-47066664 CAAGATATTTATATGCAGCTGGG - Intronic
957085917 3:75676688-75676710 CTAGATAAATATAGAAAGTTGGG - Intergenic
957109812 3:75939706-75939728 CTAAATGATGATATGCAGCTTGG - Intronic
957685231 3:83495452-83495474 CTAGATATATATATCTAGATAGG - Intergenic
958953529 3:100441964-100441986 CTATATAAAAATATAAAGCTAGG - Intronic
959240971 3:103793210-103793232 GTAGATAAATAGATGCAACGGGG - Intergenic
960816799 3:121682022-121682044 GTAGTGAAATACATGCAGCTAGG + Intronic
962201909 3:133407084-133407106 ATAAATAAATAAATGCTGCTGGG + Intronic
962307740 3:134303796-134303818 CTAAATAAATAAATGCACTTGGG - Intergenic
963812669 3:149794583-149794605 TTAGAAAAATATCTGCAGCTGGG + Intronic
964216167 3:154285641-154285663 ATAGATAAAAATTTGAAGCTTGG - Intronic
966031543 3:175354811-175354833 CAAGAGTAATATATGCAACTGGG - Intronic
966391398 3:179456300-179456322 CTAGATAAGTCTATCCAGCCTGG - Intergenic
967427775 3:189347235-189347257 CTAGGTAAAAATATGGAGTTGGG + Intergenic
967626896 3:191697190-191697212 ATAGAGAAATATCTGCAGCCAGG + Intergenic
970243806 4:14037363-14037385 ATAAATAAATATAGGGAGCTGGG + Intergenic
971901598 4:32666317-32666339 CTATATACATATATGCATATAGG + Intergenic
973912502 4:55595535-55595557 ATATATATATATATACAGCTGGG - Intronic
974936150 4:68411837-68411859 GTAGATAATGATGTGCAGCTGGG + Intergenic
976164473 4:82239853-82239875 ATAAATAAATATAAGCATCTTGG + Intergenic
980098160 4:128514479-128514501 CTAGAAAACTAAATACAGCTGGG + Intergenic
980657580 4:135810188-135810210 CTAGACAAATTTATGAAGTTTGG + Intergenic
981901391 4:149869326-149869348 GTAGAGAGATATATGCAGATTGG + Intergenic
983042298 4:162944109-162944131 TTAGCCAAATATCTGCAGCTAGG + Intergenic
984996171 4:185432565-185432587 ATAGATAAAAATATGAGGCTGGG + Intronic
985026263 4:185742278-185742300 CTAAATAAACATATGCACCCAGG + Intronic
985444094 4:190010839-190010861 CTAGATAAATATAGAAAGTTGGG + Intergenic
986054015 5:4118183-4118205 AGAGAAAAAAATATGCAGCTTGG - Intergenic
986072369 5:4297771-4297793 ATATAAAAATATATGCAGATTGG - Intergenic
986868116 5:12014049-12014071 CTAGAGAAATATATCTGGCTTGG - Intergenic
989111309 5:37908776-37908798 CTACATAAATATCTGAAGCTGGG - Intergenic
989479806 5:41917406-41917428 CTGCATAAAGATATCCAGCTTGG + Exonic
989973924 5:50559124-50559146 CTATATAAATACTAGCAGCTGGG - Intergenic
990711603 5:58587336-58587358 CTCGCTAAATACAAGCAGCTGGG + Intronic
992505954 5:77388199-77388221 GTAGATAAATACATGAAGATGGG - Intronic
993756317 5:91734605-91734627 TTTGATAAATATATACAGTTTGG + Intergenic
993872566 5:93269367-93269389 CTTGAGAAATTTATGCAGTTAGG - Intergenic
994380533 5:99065410-99065432 CTAATTAAAAATATGCAGATTGG + Intergenic
995059587 5:107798812-107798834 ATAGATAAATAGATTCATCTGGG + Intergenic
995077898 5:108009219-108009241 ATATATATATATATACAGCTTGG + Intronic
996718137 5:126603996-126604018 CTAGATGAATATATGCATGGTGG + Exonic
997596560 5:135111078-135111100 CTAGATAAACACATGCTGATTGG - Intronic
997934073 5:138095626-138095648 CTAGATAAAGATGTTCAGATTGG + Intergenic
999938380 5:156513788-156513810 CTTTATAAATATTTGCATCTGGG + Intronic
1000200124 5:159001014-159001036 CTATATATATTTATGAAGCTGGG + Intronic
1000810943 5:165860271-165860293 GTGGATGAATATATGCAGCAGGG + Intergenic
1002207563 5:177574114-177574136 CTAGATAAATCTCTCCACCTGGG + Intergenic
1002394651 5:178943158-178943180 CTAAATAAATATCTGAGGCTGGG + Intronic
1005108030 6:22246520-22246542 ATATAAAAATATATCCAGCTTGG - Intergenic
1009274941 6:61663513-61663535 ATATATATATATATGCAGCTGGG + Intergenic
1010005275 6:70988948-70988970 TTACATAAATATAGGCACCTAGG + Intergenic
1010782765 6:79964528-79964550 TTAGATAGATATTAGCAGCTGGG + Intergenic
1011538618 6:88406422-88406444 CTAGACAACTATATGCAAATAGG + Intergenic
1012278321 6:97299675-97299697 CTAGATAGAGATATGCAGTTGGG + Intergenic
1014551910 6:122798818-122798840 TTATATTAATATATACAGCTAGG + Intronic
1015705595 6:136084377-136084399 CCAGAAATATATATTCAGCTTGG + Intronic
1016201310 6:141412895-141412917 CTAGATAGTTATATGCACATAGG + Intergenic
1022061677 7:26802877-26802899 ATAAATAAATAAATGCTGCTTGG + Intronic
1023734840 7:43225584-43225606 CTACATTAATATAGGCATCTCGG - Intronic
1024980258 7:55152287-55152309 CTAAATAATTAGATGCATCTTGG - Intronic
1030659222 7:112202571-112202593 CACCATAAATATATACAGCTGGG + Intronic
1031027403 7:116695240-116695262 TTAGATACATATTTGCAGTTTGG + Intronic
1037075042 8:14704677-14704699 TTATACAAGTATATGCAGCTGGG - Intronic
1038974270 8:32675214-32675236 CAAGAAAAAAATATACAGCTTGG - Intronic
1039517140 8:38143598-38143620 TTAAAAAAATCTATGCAGCTGGG - Intronic
1039634213 8:39145458-39145480 CAAGATAAATCTATACAGGTGGG + Intronic
1040379539 8:46858893-46858915 TTTGATAAAAATATGCAACTTGG - Intergenic
1040764528 8:50891375-50891397 CTATAAAAATATATTCAGCTGGG + Intergenic
1042114269 8:65414248-65414270 CTAGAAACATATTTGCAGGTAGG + Intergenic
1042990205 8:74630929-74630951 CTCAATAAATATATGAAGCTGGG - Intronic
1042998459 8:74727646-74727668 CTAGAAAAAAATATGCAAGTAGG - Intronic
1045913410 8:107437117-107437139 TTAGAAAAATATATGCACTTCGG - Intronic
1046299261 8:112265287-112265309 CTAGAAAAATAAATGCAACCTGG + Intronic
1046547556 8:115669765-115669787 CAAGATTAATACATGCAGTTTGG + Intronic
1047676642 8:127209736-127209758 CTAGATAAATATGTTCTGATAGG - Intergenic
1050823832 9:9918179-9918201 CTTGATAAATAAATTCAGCAAGG + Intronic
1052166452 9:25336173-25336195 CTAGTTAAATAGATCCAACTTGG + Intergenic
1052678987 9:31663946-31663968 ATATATATATATATGCACCTAGG + Intergenic
1052678989 9:31663987-31664009 ATATATATATATATGCACCTAGG + Intergenic
1054758558 9:68983634-68983656 CTCAATAACTATTTGCAGCTGGG + Intronic
1054889249 9:70233519-70233541 GTAGATAAATCTATGAAGATGGG + Intergenic
1055694801 9:78872334-78872356 ATATAAAAATATATGCAGGTTGG + Intergenic
1055899082 9:81213728-81213750 CTATATGAATCTATGCAGTTTGG - Intergenic
1055959929 9:81810633-81810655 GTAAATAAATAGATGGAGCTGGG + Intergenic
1057522807 9:95773184-95773206 CTAGAAAAATGTAGGCAGCTTGG + Intergenic
1058049305 9:100390779-100390801 ATAGATAAATATATTGTGCTAGG - Intergenic
1058634019 9:107019102-107019124 CTAAGTAAAAATATGCAGCTTGG + Intergenic
1060481009 9:124016898-124016920 CTTGATAAATAGAAGCGGCTTGG - Intronic
1187199930 X:17125235-17125257 ATAGATAAATATTTGCAGCTGGG - Intronic
1187766643 X:22649792-22649814 GTAGCTAAATATTTGCAGTTGGG - Intergenic
1188359413 X:29234064-29234086 CTCCATAAATAAATGCAGCGTGG + Intronic
1190175842 X:48148714-48148736 CTAGATATCTATATACAGCCAGG - Intergenic
1190196186 X:48320619-48320641 CTAGATATCTATATACAGCCAGG - Intergenic
1190201479 X:48365304-48365326 CTAGATATCTATATACAGCCAGG + Intergenic
1190662892 X:52670966-52670988 CTAGATATCTATATACAGCCAGG - Intronic
1190676531 X:52787516-52787538 CTAGATATCTATATACAGCCAGG + Intronic
1195873225 X:109508677-109508699 CCAGATAAACATATTCATCTTGG + Intergenic
1195961355 X:110390213-110390235 GTACATAAATATATGCAACATGG + Intronic
1196284394 X:113863190-113863212 CTAGATAAACTTATGAAGATGGG - Intergenic
1197713168 X:129686800-129686822 CTAGATAACTTCAGGCAGCTTGG - Intergenic
1199085611 X:143626924-143626946 CTATATATATATATGCAGGCAGG + Exonic
1199494316 X:148436391-148436413 CTAGAGAAATTTATGCAACCAGG + Intergenic
1200834004 Y:7715105-7715127 ATATATAAATATATTAAGCTTGG - Intergenic