ID: 930384410

View in Genome Browser
Species Human (GRCh38)
Location 2:50675534-50675556
Sequence CTAGTTTATCATCACTCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 92}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930384410_930384412 -8 Left 930384410 2:50675534-50675556 CCAGTGGAGTGATGATAAACTAG 0: 1
1: 0
2: 0
3: 10
4: 92
Right 930384412 2:50675549-50675571 TAAACTAGAAGATTCCTTTTGGG 0: 1
1: 0
2: 2
3: 19
4: 298
930384410_930384411 -9 Left 930384410 2:50675534-50675556 CCAGTGGAGTGATGATAAACTAG 0: 1
1: 0
2: 0
3: 10
4: 92
Right 930384411 2:50675548-50675570 ATAAACTAGAAGATTCCTTTTGG 0: 1
1: 0
2: 1
3: 29
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930384410 Original CRISPR CTAGTTTATCATCACTCCAC TGG (reversed) Intronic
902187184 1:14734158-14734180 CTACTTTATCCTCATTCCACGGG - Intronic
903920127 1:26794091-26794113 CTGGTTTTTCTTTACTCCACAGG + Exonic
906648417 1:47492667-47492689 CTAGTTTATCATCATTCTTCAGG + Intergenic
907388161 1:54139297-54139319 CTTGTTTTTCCTCACTCAACAGG - Exonic
908917346 1:69144594-69144616 CTAAATAATCATCACTCCATTGG - Intergenic
909761288 1:79290585-79290607 CAAGTTTAGAATCACTCCATTGG - Intergenic
911439193 1:97904132-97904154 CTAGTTTACCATCATATCACTGG + Intronic
915078847 1:153337453-153337475 CTAGTTTACCAGCACTCCATTGG - Intronic
915320570 1:155053888-155053910 CTTCTTTTTCTTCACTCCACAGG + Exonic
915717690 1:157960146-157960168 CTATTTTATCAAGATTCCACAGG + Intergenic
916673452 1:167045707-167045729 CTACTTTAGCATTATTCCACTGG - Intergenic
917435328 1:175015431-175015453 CTATTTGATCATCATTCCAGAGG - Intronic
917512842 1:175682505-175682527 CTACTTTATATTCAGTCCACTGG + Intronic
920597126 1:207283350-207283372 CCAGTTTCTCCTGACTCCACAGG + Intergenic
922108083 1:222529895-222529917 TTATTTTATTATCAGTCCACTGG - Intronic
923607157 1:235454383-235454405 CTCCTTTATCATCACTACAAAGG + Intronic
1063908376 10:10803869-10803891 CTACTTTATACTCACTCCATGGG + Intergenic
1064585787 10:16838083-16838105 CTAGATTATCGTCATTCCATTGG - Intronic
1078460724 11:11513416-11513438 CTGGTTTTTCAACCCTCCACTGG + Intronic
1081034554 11:38126497-38126519 ATAGTTTATCTTAACTGCACAGG + Intergenic
1081120655 11:39261482-39261504 ATAATTTATCATCACTAGACTGG + Intergenic
1081345497 11:41980875-41980897 CTAGTTCAGCACCACTCCAAAGG - Intergenic
1087590373 11:100179677-100179699 CTAGTATATCATCACCTCTCAGG - Intronic
1090212108 11:124928399-124928421 CTATTTGATCATCACCCCAGTGG - Intronic
1093561606 12:20548384-20548406 CTAGTTTATGATTACTCCTCTGG - Intronic
1094524762 12:31224107-31224129 CTGGTTTATGACCACTGCACGGG - Intergenic
1095868492 12:46999928-46999950 ATAGATTATCATTTCTCCACTGG - Intergenic
1095928587 12:47604169-47604191 CTGGTTTACCAGCACACCACTGG - Intergenic
1098029735 12:66241431-66241453 TTAGTTTATTTTCACCCCACAGG + Intronic
1100880809 12:99014910-99014932 CTAGTTTATACTCACACCAACGG - Intronic
1105741931 13:23335169-23335191 CTCCATTATCATCACGCCACAGG + Exonic
1106797602 13:33222950-33222972 TTAATTTATCAGCACTTCACAGG - Intronic
1107571671 13:41666653-41666675 CTAGTTTACTAGCACGCCACCGG + Intronic
1108809747 13:54207328-54207350 CTAGTTTGTCCTCACTGCCCTGG - Intergenic
1116923555 14:50608496-50608518 CCAGTTTATCAGCACATCACTGG + Intronic
1125360020 15:38855254-38855276 CTACTGTACCATCACTCCACTGG + Intergenic
1126539721 15:49808474-49808496 CTGGTTTACCAGCACACCACTGG + Intergenic
1126672233 15:51126862-51126884 CTAGTTTATCATCTCTCACCTGG - Intergenic
1134374810 16:13662040-13662062 CTAGTCAACCAGCACTCCACAGG + Intergenic
1134540374 16:15059208-15059230 TTAGTTTCTCAGCACTCCAAGGG + Intronic
1137908689 16:52353342-52353364 CTTTTTTATTATTACTCCACAGG + Intergenic
1139028694 16:62852408-62852430 CCAGTTTATTAGCACACCACTGG - Intergenic
1140093481 16:71855668-71855690 CTAGGTTATCTTTACTCCAATGG - Exonic
1152160560 17:78665978-78666000 ATAGGTTATCAGCACGCCACAGG - Intergenic
1153358234 18:4162330-4162352 CTATCTTATCATCTCTCCATTGG - Intronic
1158821558 18:61165141-61165163 CTACTTTATCATCCCTCCCAGGG + Intergenic
1158963660 18:62606033-62606055 CAAGTGTATCATCAATCCAACGG + Intergenic
1168486166 19:56764107-56764129 CAAGTTTATCAACATACCACTGG - Intergenic
925289839 2:2740170-2740192 CTACCTTTTCCTCACTCCACAGG - Intergenic
926201373 2:10801339-10801361 CTAGTTAATCATTATTACACTGG - Intronic
927805003 2:26139303-26139325 CGAGTTTACCATGACTCCCCAGG - Intergenic
928111474 2:28513354-28513376 CTAGTTTATCCCTACTCCAAAGG + Intronic
929299685 2:40288732-40288754 CTAGTTTACCAGCACACCAGTGG + Intronic
930384410 2:50675534-50675556 CTAGTTTATCATCACTCCACTGG - Intronic
933004232 2:76970066-76970088 CTTGTTCATCGTCACTCAACAGG + Intronic
935242024 2:101187150-101187172 CTAGTATAGCATCACATCACAGG - Intronic
935492548 2:103738037-103738059 CTAGTTTCACTTCACTACACGGG - Intergenic
940118578 2:150237949-150237971 CTTGTTTATCATCATTCCCATGG - Intergenic
942943974 2:181653301-181653323 CTAGTTTACAATCATACCACCGG - Intronic
944279020 2:197873063-197873085 CTATGTTATAGTCACTCCACTGG + Intronic
946286087 2:218703946-218703968 CTACTTTTTTATCACTCCATAGG - Intergenic
946987859 2:225293052-225293074 CTAGTTTAAGATCACACCATGGG - Intergenic
1172145046 20:32751565-32751587 CTAGTTTTTCATCCTTACACAGG + Intergenic
1178219860 21:30644092-30644114 CTAGTTTCTCTTCACTGCCCAGG - Intergenic
1179103224 21:38375391-38375413 CTAGATTATAATCTCTCCAAGGG + Intergenic
954785346 3:53088523-53088545 CTAGTTTCACATCAGTCCCCTGG - Exonic
955849001 3:63199294-63199316 CTAGTTTTTCTTTACTCCACTGG - Intergenic
961073298 3:123958137-123958159 CTTGTATAACATCACACCACTGG + Intronic
961084092 3:124051768-124051790 CTAGTTTCTCCTCCCTTCACAGG - Intergenic
961310391 3:125994945-125994967 CTTGTGTAACATCACTCCACTGG - Intergenic
964880038 3:161413162-161413184 CTAGTTTATCATGTATCCAAAGG + Intergenic
966926180 3:184646034-184646056 CTATCTCATCATCCCTCCACTGG - Intronic
976493956 4:85704593-85704615 ATAGTTTTTAATCCCTCCACAGG - Intronic
978903157 4:113977574-113977596 CTAGTTTATCTTCGTTCCACAGG + Intronic
979645927 4:123068773-123068795 AGAGATTATGATCACTCCACTGG + Intronic
980138587 4:128887614-128887636 CTAGTCTATAATCACTGAACTGG + Intronic
981354230 4:143768695-143768717 TGAGTTTATCAGCACACCACCGG - Intergenic
985184630 4:187302570-187302592 CCAGCTCATCTTCACTCCACTGG + Intergenic
986820730 5:11464004-11464026 CTAGTTCATCATCAATTAACAGG - Intronic
995517837 5:112972037-112972059 CACGTTTATCTTCATTCCACTGG + Intergenic
995794076 5:115923671-115923693 CTAGTTTATATTGAGTCCACTGG + Intergenic
1000933321 5:167279396-167279418 GTATTTTATCATCACCCTACAGG + Intergenic
1001460988 5:171914182-171914204 CTAATTTATCTTCATTCCATAGG - Intronic
1002794703 6:463192-463214 CTACTTCATCATCACTGCCCTGG - Intergenic
1004820681 6:19364977-19364999 TTTGTTTATGATCACTCCCCAGG - Intergenic
1006381944 6:33704057-33704079 CTCATTTATCCTCACACCACCGG - Intronic
1008644763 6:53502808-53502830 CTATTGTTTCATCACTCCCCTGG + Intronic
1009688092 6:66989621-66989643 GGATTTTATCATCTCTCCACAGG + Intergenic
1009897627 6:69772989-69773011 CTACTTTATCACCATTTCACAGG + Intronic
1014859874 6:126452634-126452656 ATATTTTATCATTGCTCCACAGG - Intergenic
1019831774 7:3337390-3337412 CTCTTTTATCATCACTCCAGAGG - Intronic
1022043672 7:26604779-26604801 CTAGTTGATAATTACTCTACAGG + Intergenic
1033554453 7:142476572-142476594 CCAGTTTATCAGCACATCACTGG + Intergenic
1038070487 8:24007695-24007717 TTAGTTTATCCTCACTTCTCGGG + Intergenic
1039324349 8:36468124-36468146 CTATTTTATTATCACACCAAGGG - Intergenic
1042463764 8:69102270-69102292 CTAGTTTCTGATCACACCAGTGG - Intergenic
1050005036 9:1120568-1120590 GTAGTTTTTCATTACTTCACAGG + Intergenic
1051842625 9:21415351-21415373 CTAGCAAGTCATCACTCCACAGG + Intronic
1059985482 9:119816461-119816483 TTACTTTATCATGAATCCACAGG + Intergenic
1060504642 9:124188657-124188679 CTGGTCTACCAGCACTCCACTGG + Intergenic
1186691431 X:11980375-11980397 CTATTTTATAATCTCTCCAAAGG + Intergenic
1188061168 X:25603711-25603733 CTAGTATAGCATCACTTGACAGG + Intergenic
1198515430 X:137401769-137401791 CCAGTTTACCAGTACTCCACTGG - Intergenic