ID: 930385533

View in Genome Browser
Species Human (GRCh38)
Location 2:50689813-50689835
Sequence GCTGATGGGAAGCCTCAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930385533 Original CRISPR GCTGATGGGAAGCCTCAAAT GGG (reversed) Intronic
902348133 1:15834515-15834537 GCTGCTGGGAGGCCTCATAAAGG - Intergenic
903471191 1:23588558-23588580 GGTGATGCTAAGACTCAAATGGG + Intronic
904232625 1:29088861-29088883 GCTAATCGGGAGCCTCAGATGGG + Intronic
905874931 1:41426593-41426615 GCTGATGGGAAGAATCAGAAAGG + Intergenic
915824018 1:159056514-159056536 TCTGCTGGGAACCCTTAAATAGG - Intergenic
916586749 1:166156033-166156055 GCTAATGGGAAGCGGTAAATCGG - Intronic
918051974 1:180981552-180981574 GCTGATGGAAAGCCAAAAAATGG - Intronic
919262218 1:195210195-195210217 GCTGATGGGAATGCAAAAATGGG - Intergenic
922599659 1:226840130-226840152 GCTGATGGGAATTGTCATATAGG + Intergenic
924118476 1:240771619-240771641 GCTGACGGGAAGCCTCGAGGAGG + Intergenic
1062836837 10:641243-641265 ACTGAGGGGAATCCCCAAATGGG + Intronic
1064095984 10:12424827-12424849 GGTGATGGGAAGTCCCTAATGGG - Intronic
1064316664 10:14263823-14263845 GCTGCTGGAATGCCTCAATTGGG - Intronic
1069957339 10:72060170-72060192 GCTGAAGGGCGGCCTCAAAGTGG - Exonic
1070837474 10:79458919-79458941 GCTGATTGCAAGCCTCAAGGTGG - Intergenic
1071883674 10:89926958-89926980 ACTGATGGGAAGCTTCCAACAGG + Intergenic
1071926531 10:90415838-90415860 TCTGCTGGGAACCCTTAAATAGG + Intergenic
1072225964 10:93369146-93369168 ACTTAAGGGAAGCCTCAGATAGG - Intronic
1078640522 11:13091376-13091398 GCTGATGGGAAGTCTTATGTTGG - Intergenic
1079790839 11:24737353-24737375 GGTGCTGGTAAGACTCAAATAGG + Intronic
1082659748 11:55895362-55895384 TCTGCTGGGAACCCTCAAATAGG + Intergenic
1083591069 11:63895234-63895256 GCTGATGAGCAGCCCCACATTGG + Exonic
1086402441 11:86471966-86471988 GTACATGGGAAGCCTCAAAGAGG + Intronic
1090806464 11:130205545-130205567 CCTGGTGGGAAGCCTCACAATGG - Intronic
1097149559 12:56966470-56966492 GCAGCTGGGAAGCTTGAAATGGG + Intergenic
1105256521 13:18746964-18746986 GCTCATGGGAAACCTCTACTAGG - Intergenic
1108277052 13:48821463-48821485 GCTGATGGAAAGCCCCTAAAAGG - Intergenic
1108701384 13:52947435-52947457 ACTGATGGGAAGCCTCCTATGGG - Intergenic
1109865806 13:68261251-68261273 TCTGCTGGGAACCCTTAAATAGG + Intergenic
1110098940 13:71571293-71571315 AATGATGGGAAGACTTAAATGGG + Intronic
1111951581 13:94712740-94712762 GCCGATGGGAAACCCCCAATCGG + Intergenic
1112542784 13:100333333-100333355 GCAGATGGGAAACCCCAAAGGGG - Intronic
1115584624 14:34798183-34798205 GCTGCTGGGAAAGCTCAAACTGG + Intronic
1116146297 14:41074036-41074058 GCTGATATGAACCCTAAAATAGG + Intergenic
1117115122 14:52503071-52503093 GCAGATGGGAAGCTCCAACTGGG + Intronic
1119736598 14:76986566-76986588 GCTGATGGGCAGCATCCAAGTGG + Intergenic
1202835512 14_GL000009v2_random:75139-75161 GCTCATGGGAAACCTCTACTAGG + Intergenic
1129347705 15:74934440-74934462 GCTGCTGGGAAGGCTGAGATAGG - Intronic
1129924227 15:79348446-79348468 GCTGATGGAAATGCTCATATAGG + Intronic
1130663604 15:85850952-85850974 GCTATTGAGAATCCTCAAATAGG + Intergenic
1130853657 15:87821971-87821993 GCACTGGGGAAGCCTCAAATAGG - Intergenic
1133966764 16:10537411-10537433 GCTGATGGGAAGCCATCAACAGG - Intronic
1134767603 16:16774505-16774527 GCTGCTGGGAAGCTTGAACTGGG - Intergenic
1135771499 16:25221496-25221518 GCTGATCGGAGGCCTCAACCTGG + Exonic
1136727584 16:32373342-32373364 GCAGCTGGGAAGCCTGAACTAGG - Intergenic
1137037738 16:35580556-35580578 GCTGATGAGCAGCCTGATATTGG + Intergenic
1137317963 16:47347538-47347560 GCAGCTGGGAAGCCCGAAATGGG + Intronic
1141666354 16:85467531-85467553 TGTGCTGGGAAGACTCAAATGGG + Intergenic
1141875960 16:86824745-86824767 GCTGCTGGGAAGCCTAAACAAGG + Intergenic
1202998848 16_KI270728v1_random:144408-144430 GCAGCTGGGAAGCCTGAACTAGG + Intergenic
1203130447 16_KI270728v1_random:1680816-1680838 GCAGCTGGGAAGCCTGAACTAGG + Intergenic
1143754921 17:9059855-9059877 GCAGATGGGAAGACTCAAGAGGG + Intronic
1144373331 17:14614217-14614239 GATGATGGGATGGCTGAAATAGG + Intergenic
1149331418 17:55586761-55586783 GCTGCTGGGAAGCCTGAGAAAGG - Intergenic
1149526923 17:57363826-57363848 GCTGATGGGAAGCCTTATGTGGG + Intronic
1150315616 17:64166421-64166443 GCTCATGGGCAGCCTCTGATGGG + Intronic
1150320102 17:64206428-64206450 GCTGATGAGAAGCAGCAAATAGG - Intronic
1155784485 18:29880008-29880030 TCTGCTGGGAAGGCTTAAATAGG - Intergenic
1158261341 18:55609301-55609323 GCTGCTGGGAAGACTCATACGGG + Intronic
1163934330 19:20428380-20428402 GATCATGGGAAGCTTAAAATGGG + Intergenic
1164321601 19:24153204-24153226 GCAGATGGGAAGCTCCAACTGGG - Intergenic
1168402819 19:56095733-56095755 GCTGGTGGGAAGGCCCAAAAGGG - Intronic
1168561401 19:57386833-57386855 GCTGTTGGGAAACCAAAAATGGG - Intronic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
930385533 2:50689813-50689835 GCTGATGGGAAGCCTCAAATGGG - Intronic
934318388 2:91947735-91947757 GCAGCTGGGAAGCCTGAACTGGG + Intergenic
934492601 2:94771877-94771899 GCTCATGGAAAGCCTCTACTAGG - Intergenic
935687094 2:105693960-105693982 GCTGGGGAGAAGCCTCACATGGG - Intergenic
936840128 2:116758522-116758544 TCTGCTGGGAACCCTTAAATAGG + Intergenic
938009195 2:127814964-127814986 GCTATTTGGAAGGCTCAAATGGG - Intergenic
943840874 2:192578928-192578950 GCTCATGGGAAGCCTCAAACAGG - Intergenic
945929395 2:215840016-215840038 GCTGATGGGCAGCCACAACTTGG - Intergenic
1170031897 20:11952954-11952976 GCTGACGGGAACACCCAAATTGG - Intergenic
1171176531 20:23054258-23054280 GCAGATGGGAAGCCTAAGACAGG - Intergenic
1171883276 20:30633233-30633255 GCTCATGGGAAACCTCTACTAGG - Intergenic
1173511005 20:43628379-43628401 GCTGCTGGGAAGTCTGAACTGGG - Intronic
1174592185 20:51654786-51654808 GCTGTTGTGAAGCCCCAAGTAGG - Intronic
1176842517 21:13851992-13852014 GCTCATGGGAAACCTCTACTAGG - Intergenic
1177889170 21:26784316-26784338 GGTAATGGGAAGCCCCGAATAGG + Intergenic
1178171536 21:30046456-30046478 GCTGCTAGGAAAACTCAAATGGG - Intergenic
1179295951 21:40062607-40062629 GCTAATGGGAAGCCTTCTATTGG + Intronic
1179956873 21:44745730-44745752 TCTGCTGGGAACCCTTAAATAGG + Intergenic
1180306572 22:11131418-11131440 GCAGCTGGGAAGCCTGAACTGGG + Intergenic
1180545090 22:16493601-16493623 GCAGCTGGGAAGCCTGAACTGGG + Intergenic
949645818 3:6092749-6092771 GCTAATGGGAAAGATCAAATCGG - Intergenic
952189524 3:31007972-31007994 GCTGATGTGAAGCCTCAAAAGGG + Intergenic
953000591 3:38929387-38929409 GCTGAGGGGAAGATTGAAATGGG + Intronic
953676070 3:45003423-45003445 TCTGATGGGAAGGCTCCAAATGG + Intronic
953745887 3:45573740-45573762 GGTCATGGGAACCCTCAAATTGG + Intronic
955065650 3:55531686-55531708 GCTGATGGGAACCCTCAGCCAGG + Intronic
963867689 3:150379831-150379853 GTTGCTGGGAAGCCTCAGTTTGG + Intergenic
964253377 3:154746598-154746620 GCTGATGGAAAGGATCTAATTGG - Intergenic
964424218 3:156534471-156534493 GGTGATGGGAAGCCTCAGAAGGG - Intronic
964761076 3:160135635-160135657 GCTGACAGGAAACCTCAATTTGG + Intergenic
965657507 3:171004170-171004192 GCTGTTGGGCAGCCTAAAAATGG - Intronic
966217260 3:177516742-177516764 GCTGCTGGGTAGCCTCAGATCGG + Intergenic
966840481 3:184083478-184083500 GCTGAAGGGTGGCCTCGAATGGG - Intergenic
968350521 3:198048537-198048559 GCTCATGGGAAACCTCTACTAGG - Intergenic
968627178 4:1631218-1631240 GCTGCTGGGAAGCCCCAAGCAGG - Intronic
968884000 4:3317622-3317644 TCTGATGAGCGGCCTCAAATGGG - Exonic
969079776 4:4609473-4609495 GCCTATGGGAAGACTCCAATAGG - Intergenic
970655373 4:18224978-18225000 GCTGCTGGAAAGCTTGAAATGGG - Intergenic
972316011 4:37926524-37926546 GAGGAAGGGAAGCCTCAAAAAGG - Intronic
973366934 4:49215550-49215572 GCTCATGGGAAACCTCTACTAGG - Intergenic
973393686 4:49576855-49576877 GCTCATGGGAAACCTCTACTAGG + Intergenic
976778976 4:88737722-88737744 GCTGAAGGGAAGCAGCAACTTGG - Intronic
984967362 4:185151432-185151454 GCTGATGGGAAGCCATACATGGG - Intergenic
1202764435 4_GL000008v2_random:138067-138089 GCTCATGGGAAACCTCTACTAGG - Intergenic
986808998 5:11336070-11336092 GCTGATGGGAAACCTCTAGAGGG + Intronic
987227421 5:15857411-15857433 GCTGATGGGAAACGTCATTTAGG - Intronic
991555442 5:67890083-67890105 GCTGCTGGGAAGCTCCAACTGGG + Intergenic
992780861 5:80125686-80125708 GATGATGGGAAGACTCAGCTGGG + Intronic
994039690 5:95244676-95244698 GCTGCTGGGAAGCATGAACTGGG + Intronic
995299956 5:110567906-110567928 GCTGTTGGTAAGATTCAAATAGG - Intronic
997675932 5:135713418-135713440 GCTGCTGGGAGGCCTCAGAAGGG - Intergenic
998536728 5:142939717-142939739 GCTTATTGGCAGTCTCAAATTGG + Intronic
998875657 5:146596564-146596586 GCTGCTGGGGAGCCTTAACTAGG - Intronic
1005487033 6:26310461-26310483 GCAGATGGGACGCTTTAAATAGG + Intergenic
1007305625 6:40901834-40901856 GCTGATTGGAAGCCAGAACTTGG - Intergenic
1007675741 6:43593108-43593130 GCTACTTGGAAGCCTCAAGTGGG - Intronic
1009919161 6:70035474-70035496 GCAGCTGGGAAGCATGAAATGGG + Intronic
1010453690 6:76030691-76030713 TCTGCTGGGAATCCTTAAATAGG + Intronic
1010669782 6:78674234-78674256 TCTGCTGGGAACCCTTAAATAGG - Intergenic
1010957022 6:82101777-82101799 GCAGCTGGGAAGCTCCAAATGGG + Intergenic
1011645229 6:89451195-89451217 GCTGCTCGGAAGGCTGAAATGGG + Intronic
1017257609 6:152351661-152351683 GATGAAGGGAAGCCTCAATATGG + Intronic
1017592438 6:155992024-155992046 GCCTATGGGAAGCATCAGATAGG + Intergenic
1018064725 6:160117030-160117052 GCTGATGGAAGGCATCAAAGTGG - Intergenic
1018359661 6:163054735-163054757 GCTGGTGGGAAGCCCCAAAATGG - Intronic
1018457554 6:163965396-163965418 TCTGAAGAGAAGCCTCAATTTGG - Intergenic
1020839116 7:13193035-13193057 CCTGATGGGTAGCATCAAATTGG - Intergenic
1023645116 7:42303734-42303756 GATTATGGGAAGCCTCTAGTAGG - Intergenic
1023718773 7:43071915-43071937 TCTGCTGGGAACCCTTAAATAGG - Intergenic
1031086219 7:117304233-117304255 GCAGATGGGAAGTCTGATATGGG + Intronic
1035447400 7:158952214-158952236 GGGGATGGGAATCCTCAAAGTGG + Intronic
1037111566 8:15169112-15169134 CCTGCTGGGAACCCTTAAATAGG + Intronic
1038777380 8:30543234-30543256 GCTGTGGGGAAGCCTCACACAGG + Intronic
1044803974 8:95985969-95985991 GATGCTGTGCAGCCTCAAATAGG - Intergenic
1045201724 8:99990317-99990339 GCCGATGGGAAGCCTCTAGCAGG + Intronic
1046543145 8:115612581-115612603 GCTGATGGGAAGCTCCACCTTGG - Intronic
1048941775 8:139406161-139406183 GCTGATGGGAAGCCCCTGAGTGG + Intergenic
1049476017 8:142797372-142797394 GCTGATGGGATGCTTCAGAGGGG - Intergenic
1050508605 9:6371581-6371603 TCTGCTGGGAACCCTTAAATAGG - Intergenic
1053663664 9:40302062-40302084 GCTCATGGGAAACCTCTACTAGG + Intronic
1053914177 9:42932604-42932626 GCTCATGGGAAACCTCTACTAGG + Intergenic
1054375788 9:64448295-64448317 GCTCATGGGAAACCTCTACTAGG + Intergenic
1054520951 9:66074223-66074245 GCTCATGGGAAACCTCTACTAGG - Intergenic
1056135926 9:83629394-83629416 GTTGGTGGGAAGCCTCTAAAGGG - Intronic
1060021060 9:120131673-120131695 GCAGAAGGGAAGCCTCTGATAGG + Intergenic
1061652619 9:132063204-132063226 GCTTATGGGAGGCCTATAATAGG + Intronic
1062638568 9:137504887-137504909 GCTGATGGAAAGCTTTAAATAGG - Intronic
1203545183 Un_KI270743v1:122954-122976 GCTCATGGGAAACCTCTACTAGG - Intergenic
1186576893 X:10776364-10776386 TCTGATGAGAAGCCTGACATTGG - Intronic
1186804848 X:13130192-13130214 ACTGAAGGGTAACCTCAAATAGG + Intergenic
1190044164 X:47099167-47099189 GATGATCCGAAGCCTAAAATAGG + Intergenic
1195899525 X:109782832-109782854 GTTGGTGGGAAGCCTCACCTGGG - Intergenic
1196683745 X:118494394-118494416 ACTGATGGGATGGCTGAAATAGG + Intergenic
1197730292 X:129804062-129804084 TCTGATGGGAAGGGTCAAAGTGG - Exonic
1198224939 X:134636476-134636498 GCTGAAGGGCAGCTTCAAAATGG + Intronic
1200697520 Y:6374085-6374107 GGTGATGGTAAGCCTGAAAATGG + Intergenic
1200703234 Y:6419970-6419992 GGTGATGGTAAGCCTGAAAATGG + Intergenic
1200708999 Y:6467098-6467120 GGTGATGGCAAGCCTGAAAAGGG + Intergenic
1200709630 Y:6471851-6471873 GGTGATGGCAAGCCTGAAAAGGG + Intergenic
1200916175 Y:8573193-8573215 GGTGATTGGAAGCCTCAAAAAGG - Intergenic
1200927589 Y:8668546-8668568 GGAGATGGGAAGCCTGAAAAGGG - Intergenic
1200937620 Y:8752017-8752039 GGTGATGGCAAGCCTAAAAACGG + Intergenic
1200938179 Y:8756573-8756595 GGTGATGGCAAGCCTGAAAAGGG + Intergenic
1200938493 Y:8759036-8759058 GCTGATGGCAAGCCTGAAAATGG + Intergenic
1200938796 Y:8761438-8761460 GGTGATGGCAAGCCTGAAATGGG + Intergenic
1200961868 Y:9003343-9003365 GGTGATGGCAAGCCTAAAAAGGG - Intergenic
1201024482 Y:9692857-9692879 GGTGATGGCAAGCCTGAAAAGGG - Intergenic
1201025113 Y:9697611-9697633 GGTGATGGCAAGCCTGAAAAGGG - Intergenic
1201030876 Y:9744737-9744759 GGTGATGGTAAGCCTGAAAATGG - Intergenic
1201036593 Y:9790614-9790636 GGTGATGGTAAGCCTGAAAATGG - Intergenic
1202178851 Y:22122128-22122150 GGTGATGGCAAGCCTGAAACTGG + Intergenic
1202182796 Y:22153802-22153824 GGTGATGGCAAGCCTAAAAAGGG + Intergenic
1202208563 Y:22432599-22432621 GGTGATGGCAAGCCTAAAAAGGG - Intergenic
1202212510 Y:22464266-22464288 GGTGATGGCAAGCCTGAAACTGG - Intergenic