ID: 930392385

View in Genome Browser
Species Human (GRCh38)
Location 2:50778547-50778569
Sequence ATGAACAAAAGGAAGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 560
Summary {0: 1, 1: 0, 2: 4, 3: 52, 4: 503}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930392376_930392385 24 Left 930392376 2:50778500-50778522 CCAGGTAGAACCTTGGTGAGACA 0: 1
1: 0
2: 2
3: 5
4: 66
Right 930392385 2:50778547-50778569 ATGAACAAAAGGAAGGTGGCAGG 0: 1
1: 0
2: 4
3: 52
4: 503
930392378_930392385 14 Left 930392378 2:50778510-50778532 CCTTGGTGAGACAAGAGGTAGTA 0: 1
1: 0
2: 0
3: 6
4: 100
Right 930392385 2:50778547-50778569 ATGAACAAAAGGAAGGTGGCAGG 0: 1
1: 0
2: 4
3: 52
4: 503

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930392385 Original CRISPR ATGAACAAAAGGAAGGTGGC AGG Intronic
900241297 1:1618742-1618764 ATGAACAATGGGAATGGGGCAGG + Intronic
900333216 1:2147044-2147066 ATGAACGAATGGAAGATAGCTGG - Intronic
902189270 1:14750006-14750028 ATGACCAAAAAAAAGGTGGGGGG + Intronic
902620417 1:17647525-17647547 ATGAATAAAAGGAAGGAGGGAGG - Intronic
902662221 1:17913197-17913219 AGGAAAGAAAGGAAGGTGGCAGG - Intergenic
903381893 1:22902967-22902989 ATGAACAAAAGCATGGAGGCAGG + Intronic
903418932 1:23204419-23204441 ATGAAAAAAATGAGTGTGGCCGG - Intergenic
904855070 1:33491571-33491593 ATGAGCAGGAGGAAGGGGGCTGG + Exonic
905018155 1:34791563-34791585 CTGAGGAAAGGGAAGGTGGCAGG - Intronic
905112232 1:35604197-35604219 ATGAAAAAAACTAATGTGGCTGG + Intronic
905298749 1:36971813-36971835 CAGAAGAAAAGGAAGGTGTCAGG - Intronic
905383197 1:37579249-37579271 ATCAAAACAAGGAAAGTGGCCGG + Intronic
906396809 1:45473248-45473270 AAGCACAAAAAGAAGGTGCCTGG - Intronic
906794773 1:48688146-48688168 AGGAAGAGAAGGAAGGAGGCAGG + Intronic
906869010 1:49455777-49455799 ATGAGCAAAGGGAAGGTAGCAGG - Intronic
907310263 1:53535020-53535042 ATGAACAAAAGCAGGGAGGCTGG + Intronic
907775261 1:57507838-57507860 ATCAGCAAAAGGTAGGAGGCAGG - Intronic
907779955 1:57557802-57557824 AGGAACATAATGAAGGTGGTTGG + Intronic
907786340 1:57616811-57616833 ATGACCAAAAGCAAGGTGGTAGG + Intronic
909288786 1:73855696-73855718 TTAGAGAAAAGGAAGGTGGCAGG + Intergenic
909528169 1:76650649-76650671 ATGAACATTAGGAATGTTGCAGG + Intergenic
910303016 1:85728508-85728530 ATGAATAAAAAGATGCTGGCTGG - Intergenic
910416034 1:86999695-86999717 ATTAACAAAAGTAAGTTGGGGGG - Intronic
910737574 1:90477670-90477692 ATGAACAAAGGAATGGAGGCAGG - Intergenic
910774175 1:90858465-90858487 ATGAACAAAGGGAAGTTAACAGG + Intergenic
912103902 1:106246470-106246492 ATCACCTAAAGGAAGTTGGCAGG - Intergenic
912806309 1:112759482-112759504 AAGAACGAAAGGAAGAAGGCCGG + Intergenic
913221687 1:116665672-116665694 CTGAAGAAAAGGAAGCTGCCTGG - Intronic
913303458 1:117398375-117398397 AAGAACTGAAAGAAGGTGGCTGG + Intronic
913439933 1:118886534-118886556 ATGAACTAAAGGAAAGTTTCTGG + Intronic
914450792 1:147789644-147789666 ATGAAACAAAGCAAGGAGGCCGG + Intergenic
914701856 1:150141617-150141639 ATGTATAGAAGGAAGGTGGGTGG - Intronic
915075972 1:153308288-153308310 ATGAAGAAAGAGAAGGAGGCTGG - Intronic
915440270 1:155941512-155941534 TTGACCAACAGGAAGGTGGTGGG + Intergenic
915496097 1:156283713-156283735 AGGAACAGAAAGAAGGTGGGTGG - Intronic
915565150 1:156708803-156708825 GTGGCTAAAAGGAAGGTGGCTGG + Intergenic
915668050 1:157462626-157462648 AGGAACAAAATGAAGTTGGTTGG - Intergenic
916718577 1:167465298-167465320 AAAAAAAAAAGGAAGGTGGAAGG - Intronic
916915028 1:169397189-169397211 ATGAACATGAGGAAGGAGGAGGG + Intronic
917670647 1:177270480-177270502 ATGAACAAGATGATGGTGGGGGG + Intronic
919037331 1:192330691-192330713 ATGGACAAACGGAATGTTGCTGG + Intronic
919310592 1:195901864-195901886 ATAATTAATAGGAAGGTGGCAGG + Intergenic
919816230 1:201442151-201442173 ATCAACAAAAGAATGGAGGCTGG + Intergenic
920767238 1:208845215-208845237 ATGAGGAAATAGAAGGTGGCAGG - Intergenic
920841939 1:209562418-209562440 ATGAAGAAAAAGCAGGTGGGTGG + Intergenic
921266397 1:213424372-213424394 ATGAAAAAAAAGTAGATGGCAGG + Intergenic
921289275 1:213640694-213640716 ATCAATAAAAGAAAGGTAGCAGG - Intergenic
921600206 1:217098628-217098650 AGGAAGAAAAGGAGGGTGGAAGG + Intronic
922136274 1:222830376-222830398 AAAAAAAAAAGGAAGGTGGAAGG - Intergenic
923566481 1:235080216-235080238 ATAACCAAAAGGAAGATTGCTGG - Intergenic
924666217 1:246074689-246074711 AGAAACAAAAGGAAAGTGACAGG + Intronic
924841847 1:247719606-247719628 ATGAACAAAATGAAAGTAGTTGG - Intergenic
1063557577 10:7095754-7095776 ATCAATAAAAGTAACGTGGCAGG + Intergenic
1063982641 10:11467980-11468002 ATCAACAAAAGTAAAGTGTCTGG - Intronic
1064462834 10:15551461-15551483 ATCAAGAAAGGCAAGGTGGCTGG + Intronic
1065085254 10:22167474-22167496 ATCAACAAAAGGAATATGCCCGG + Intergenic
1065741137 10:28798146-28798168 ATGAACAACAGGAATGTTTCTGG + Intergenic
1066099888 10:32108300-32108322 ATGAGCAAAATGCAGGTGGGTGG + Intergenic
1067059462 10:43070528-43070550 AGGGAGGAAAGGAAGGTGGCCGG + Intergenic
1067309224 10:45096486-45096508 ATGGACAAAAGGAGAGTGGGAGG - Intergenic
1068931099 10:62591385-62591407 ATCAACAAAAGCATGGTGCCAGG + Intronic
1069618660 10:69822627-69822649 ATGAACAAATGAATGGTGGGTGG - Intronic
1069629878 10:69891021-69891043 ATTAAAAGAAGGAAGGTGGCAGG - Intronic
1070112529 10:73498881-73498903 ATGAACAATGGGAGGGTGGGAGG + Exonic
1070978773 10:80627798-80627820 AGGAAGAAAAGGAAGGAAGCGGG + Intronic
1071241602 10:83712231-83712253 AAGAAAAGAAGGAAGGAGGCAGG + Intergenic
1071571076 10:86697515-86697537 AAGAAAAAAAAGAAGTTGGCCGG - Intronic
1071747596 10:88439434-88439456 ATAAACAAAAGCATAGTGGCAGG - Intronic
1072094506 10:92163801-92163823 ATGAACAATATGAAAGTAGCAGG + Intronic
1072184140 10:93018197-93018219 ATAAAAAAAAGGGAGGGGGCAGG + Intronic
1072783054 10:98262982-98263004 AGGAACAGAAAGAGGGTGGCTGG + Exonic
1074502568 10:114040291-114040313 ATGTACAAAAGGAAGGAGTATGG + Intergenic
1075920991 10:126212845-126212867 ATACACAAAAGGCAGGTGGTAGG - Intronic
1076902700 10:133347724-133347746 CTGCCCAAAAGGAAGGGGGCTGG + Intronic
1077280562 11:1743184-1743206 ATGGACAAATGGAAGATGGATGG + Intronic
1077280567 11:1743222-1743244 ATGGACAAATGGAAGATGGATGG + Intronic
1077280582 11:1743316-1743338 ATGGACAAACGGAAGATGGATGG + Intronic
1077480965 11:2814395-2814417 CTGAATAAAAGGATGGTGGGTGG + Intronic
1078143260 11:8706831-8706853 ATGAACAAAAGGAAGGCAGATGG + Intronic
1078508568 11:11969038-11969060 ATGAATTAGAGGAGGGTGGCTGG + Intronic
1079330793 11:19531282-19531304 ATGAACCAGAGTAAGGAGGCAGG + Intronic
1080476368 11:32595529-32595551 ATGAAAGAAAGGGAGGTAGCCGG - Intronic
1080940650 11:36914053-36914075 AAAAAATAAAGGAAGGTGGCCGG + Intergenic
1081126048 11:39323365-39323387 AAAAACAAAAGGAAGTTGGAAGG + Intergenic
1081148513 11:39596638-39596660 ACAAAGAAAAGGAAGTTGGCTGG + Intergenic
1081317084 11:41643188-41643210 ATGAACAAAAAGAACATAGCTGG - Intergenic
1081469194 11:43353866-43353888 AAGAATAAAAGGAAGCTGCCAGG - Intergenic
1082196086 11:49307947-49307969 ATGACCAAAATGATGGTGACTGG - Intergenic
1082697408 11:56386688-56386710 ATTAAAAAAAGGAACTTGGCCGG + Intergenic
1083237778 11:61362569-61362591 AGGTACAAAGGGAAGGCGGCAGG + Intronic
1083584321 11:63845685-63845707 ATAACAAAAAGGAAGGGGGCGGG - Intronic
1083616918 11:64030888-64030910 AAAAAAAAAAGGAAGGTGGGTGG + Intronic
1083828864 11:65218320-65218342 ATGAAACATAGGTAGGTGGCAGG - Intergenic
1083852661 11:65377138-65377160 ATTCACAAGAGGAAGGAGGCAGG + Intronic
1084470415 11:69356178-69356200 ATGAAGAGAAGGAAGGAGGGAGG + Intronic
1084985740 11:72869480-72869502 ATGAACAAAAGAAAGGAATCAGG + Intronic
1084996393 11:72983308-72983330 ATAAATAAAAGAAAGGTGCCAGG + Intronic
1085993816 11:81886221-81886243 ATGACCAAAAGGACAGTGGAAGG + Intergenic
1088098982 11:106132914-106132936 ATGTGGAAAAGGAAGGTGGAAGG + Intergenic
1089028605 11:115298376-115298398 AAGAAGAAAGGGAAGGAGGCAGG + Intronic
1089141128 11:116285213-116285235 GTGAATAAACGGAAAGTGGCTGG - Intergenic
1089596222 11:119582400-119582422 ATGAACCTAAGAAAGGTGGAAGG - Intergenic
1089910000 11:122088505-122088527 ATTAAGAAAAGGCAGGTGGATGG + Intergenic
1090452627 11:126820132-126820154 ATGAACAAAATGAATGGGGCAGG - Intronic
1090749661 11:129734491-129734513 TTGAACAAAAGGAGGGTGCCAGG - Intergenic
1091150285 11:133322267-133322289 ATGAATTAAAGGTAGGTGTCTGG + Intronic
1091369781 11:135048246-135048268 GTGAATAGAAGAAAGGTGGCCGG - Intergenic
1091427339 12:402517-402539 ATGAACAAAGGTATGGAGGCAGG + Intronic
1091539147 12:1443345-1443367 AAGAAATAAAGGAACGTGGCAGG + Intronic
1092166529 12:6346123-6346145 ATGAATAAGACTAAGGTGGCAGG + Intergenic
1092776215 12:11947030-11947052 ATGAACCAATGGCAGGTGGAAGG - Intergenic
1093157015 12:15698500-15698522 AGGAAAATAAGGAAGTTGGCTGG - Intronic
1094120959 12:26973753-26973775 ATGACCAAAAGGTTGGTGGTAGG - Exonic
1094140212 12:27172994-27173016 AAGAACAAAAAGAAGGTTGAAGG - Intergenic
1094140640 12:27178303-27178325 ATGAACAAAAAGAAGGTTGGAGG - Intergenic
1094314740 12:29127156-29127178 ATGAATAATAGAAAGGTAGCTGG - Intergenic
1094589655 12:31808623-31808645 ATGAATAAAACCAAGCTGGCCGG + Intergenic
1095383447 12:41621891-41621913 ATGAATAAAACGTAGGTGGCTGG + Intergenic
1095658844 12:44704720-44704742 ATGTAAAGAAAGAAGGTGGCTGG + Intronic
1095851406 12:46811381-46811403 AAGAACAAATAGAAGTTGGCAGG + Intronic
1095966976 12:47874724-47874746 ATGAAGAGAATGAAGGTGGATGG - Intronic
1096214680 12:49792595-49792617 AGGAACAAAGGGAAGGTGGATGG + Intronic
1096306164 12:50479078-50479100 AAGAACAAAAAGAATGTTGCTGG + Exonic
1096542359 12:52314869-52314891 ACAGACCAAAGGAAGGTGGCTGG - Intronic
1096740732 12:53692216-53692238 ATGACTAAAAGGAAGGGGGTGGG + Intergenic
1097333437 12:58356647-58356669 ATGAAAAAAATGAATGAGGCTGG + Intergenic
1099676277 12:85764783-85764805 AAGAATAAAAGGAAGGAGGAAGG + Intergenic
1100165344 12:91911487-91911509 ATGAACAAAAGGAAGATGGTAGG + Intergenic
1100284781 12:93154897-93154919 ATGAACTAAAGGGATGTGGAGGG - Intergenic
1100574087 12:95873146-95873168 ATGCAAAAAAGGAGGGGGGCTGG - Intronic
1101863087 12:108498809-108498831 AGGAACAAAAGATAGGTGCCTGG - Intergenic
1102249839 12:111379229-111379251 ATTAAAAAAAGGAAAGAGGCTGG + Intergenic
1103139169 12:118533869-118533891 ATGAAAGAAAGGGAGGTGGATGG - Intergenic
1103417831 12:120756230-120756252 TTTAAGAAAAGGAAGGCGGCCGG + Intergenic
1103464221 12:121129005-121129027 AGGAAAGAAAGGAAGATGGCGGG - Intergenic
1104184189 12:126413266-126413288 AAGAAGAAAAGGAAAGTGGAAGG + Intergenic
1106399937 13:29419856-29419878 ATGAACATAATGATGTTGGCTGG - Intronic
1106771118 13:32961442-32961464 ATGAACACAAGGCTGATGGCAGG + Intergenic
1108003232 13:45923714-45923736 ATGAAGAAAATGGAGGTGGTGGG - Intergenic
1109045757 13:57409027-57409049 ATTAACAAAAGGAATGTGAAAGG + Intergenic
1109371147 13:61421054-61421076 ATCATCAAAAGAAAGGTGGTGGG + Intronic
1109451175 13:62516287-62516309 ATGAATAGAAGGTAGGTGGTTGG + Intergenic
1109713878 13:66195140-66195162 TTGAACAAAAAGAAGAAGGCTGG - Intergenic
1109914454 13:68962730-68962752 ATCAAAATAAGGAAGATGGCTGG + Intergenic
1111016340 13:82387058-82387080 ATGAACAAAGTGGGGGTGGCAGG - Intergenic
1111186260 13:84740224-84740246 ACAAACAAAAGCAAGGTGGCTGG - Intergenic
1111555748 13:89879351-89879373 AAGAACAAAAGGAAGGTTAGAGG - Intergenic
1111576129 13:90155752-90155774 ATGAACATAATGAAGTTGGTTGG - Intergenic
1111791249 13:92858312-92858334 AAGAGCAAAGGGATGGTGGCAGG - Intronic
1113042889 13:106123804-106123826 AAACACACAAGGAAGGTGGCTGG + Intergenic
1114932828 14:27495132-27495154 TTGAGCAAAAGGAACGTGGCTGG + Intergenic
1115472871 14:33786291-33786313 ATGAACAAATGGAATTTGTCTGG + Intronic
1116109421 14:40558249-40558271 GTGAAGAAAAGGAGGGTGGAAGG - Intergenic
1116470953 14:45285073-45285095 AGAAAGAAAAGGAAGCTGGCAGG - Intergenic
1116525543 14:45899864-45899886 ATGGACAAAATGAAGGTGGGAGG + Intergenic
1116645796 14:47527379-47527401 AGGAACAAAAGAAAGGAGGATGG + Intronic
1117002988 14:51390597-51390619 ATGACCAAAAGAAAGGGGGATGG - Intergenic
1118832725 14:69449889-69449911 ATGCAAGAAAGGAAGGGGGCTGG + Intronic
1118935228 14:70282098-70282120 CTTAACAAGAGGAAGCTGGCTGG - Intergenic
1120662660 14:87269238-87269260 ATAAAGAAATGGAAGGTGGATGG + Intergenic
1121051362 14:90820886-90820908 ATGAGCTGAAGGAAGGTGGAGGG + Intergenic
1123010629 14:105348003-105348025 ATGAACAGAAGGAAGGTTGGGGG + Intronic
1123983757 15:25625912-25625934 CTGAAGACAAGGAGGGTGGCTGG + Intergenic
1124990498 15:34668943-34668965 ATGGACAGAAGAAAGGTAGCAGG + Intergenic
1125447734 15:39776111-39776133 AGGAAAAAAAGGAAGGTGGGAGG + Intronic
1125840687 15:42798596-42798618 ATGAACACAAAGAAGTTGGAAGG + Intronic
1126028209 15:44469799-44469821 AGAAACAAAAGAATGGTGGCCGG + Intronic
1126216886 15:46165710-46165732 ATGGACAAAGGGAAGATGGATGG + Intergenic
1126259824 15:46676260-46676282 ATGAACAAAGGGAAAGTGAGAGG - Intergenic
1127080530 15:55374239-55374261 ATTCACAAAAGAAAGGTGGTGGG - Intronic
1127983162 15:64048786-64048808 ACGAACAAAAGCATGGAGGCAGG - Intronic
1128206013 15:65852651-65852673 ATTAACAAAAGGAAGGAGGTTGG + Intronic
1128408595 15:67369551-67369573 AGGAAGAAAAGGAAGGAGGGAGG + Intronic
1128485555 15:68083321-68083343 ATGAAATAAAAGAAGGGGGCGGG - Intronic
1130763846 15:86850384-86850406 GTGAAAAACAGGAAGGGGGCAGG - Intronic
1130846750 15:87754876-87754898 ATGCACAGAGGGAAGGTGGAAGG - Intergenic
1130871237 15:87973849-87973871 AAGAGCAAAATGAAGGTGGCAGG - Intronic
1130958245 15:88642223-88642245 TTGAAAAAGAGGAAGTTGGCTGG - Intronic
1131038500 15:89241764-89241786 ATGATCTAAAGGAAGGTGGGTGG - Intergenic
1131401657 15:92130335-92130357 CTGAATAAAAGGCAGGTGTCTGG - Intronic
1131621852 15:94076692-94076714 AAGAACAAAAAGAATGTTGCTGG + Intergenic
1132069495 15:98763313-98763335 ATTAACAAAAGGAAAGTGGAAGG - Intronic
1132789383 16:1677144-1677166 AAGAAAACAAGGAAGGAGGCCGG + Exonic
1133571460 16:7044634-7044656 ATGAAAAAAAGTAAAGTGGAAGG - Intronic
1134849397 16:17468680-17468702 ATGAAGAGAAGGAAGGAGGCAGG - Intronic
1135547646 16:23376870-23376892 ATGAACAAAGGGTGGGTGACTGG - Intronic
1135548139 16:23379231-23379253 ATGAATAAACGGAGGATGGCTGG - Intronic
1135878721 16:26231020-26231042 ATCAACAAAAGGAACATGGAAGG + Intergenic
1136946096 16:34652819-34652841 AGGAAGAAAAGGAAGGCGGGAGG + Intergenic
1136968354 16:34942115-34942137 AGGAAGAAAAGGAGGGTGGGAGG + Intergenic
1137219794 16:46437374-46437396 AGGAAGAAAAGGAGGGTGGGAGG - Intergenic
1139119983 16:64003972-64003994 ATGAACAAAAGGAACGGGCGGGG + Intergenic
1139600891 16:67986343-67986365 ATGAAAAAAAGAAAGCTGGCCGG + Intergenic
1139834118 16:69824524-69824546 AGGAACAAAGGGAAGGGGGAGGG - Intronic
1140120599 16:72080127-72080149 AAAAAAAAAAGGAAGGTGGCGGG - Intronic
1140271157 16:73467457-73467479 ATGAACAAGATGTAGGTAGCAGG + Intergenic
1141012242 16:80413460-80413482 ATGATCAAAAACAAGGTTGCTGG - Intergenic
1141854932 16:86674278-86674300 ATGAACAAATGAATGGTGGGAGG - Intergenic
1143951876 17:10639119-10639141 AGGAACAAAAGGAAATTGGAAGG - Exonic
1144529339 17:16021089-16021111 ATAAATAAAAGAAAGTTGGCTGG + Intronic
1144741413 17:17584604-17584626 GTAAAGAAAAGGAAGATGGCTGG - Intronic
1144751091 17:17648515-17648537 ATTGACAATAAGAAGGTGGCTGG + Intergenic
1145064292 17:19751694-19751716 ATAAAAAAAAGGAAGGAGGCTGG + Intergenic
1146980918 17:37160817-37160839 AAGAACAGAAGAAAGGTGGGAGG + Intronic
1147589116 17:41669929-41669951 ATGAACAATGGGAAGGTTGTGGG + Intergenic
1147888632 17:43701514-43701536 CTGACAAACAGGAAGGTGGCAGG - Intergenic
1148273883 17:46285535-46285557 ATGAAAGACAGAAAGGTGGCTGG - Intronic
1148398988 17:47337147-47337169 AGGAAGAAAAGGAAGGTCGTGGG + Intronic
1148398994 17:47337175-47337197 AGGAAGAAAAGGAAGGTCGTGGG + Intronic
1148534505 17:48428441-48428463 CTAAGCTAAAGGAAGGTGGCAGG + Intronic
1148731157 17:49837467-49837489 ATGTTTAAAAGGAAGGGGGCGGG - Intergenic
1149717714 17:58809677-58809699 ATGAAAAAAATGAGGGGGGCTGG - Intronic
1149728822 17:58924277-58924299 AGGAACAAAGGGAAGGAGGGAGG + Intronic
1149787964 17:59452454-59452476 ATGAAAAAAAGGAAACAGGCAGG - Intergenic
1150473305 17:65455915-65455937 ATGAAGGAAAGGATGGAGGCTGG + Intergenic
1150515198 17:65801352-65801374 ATCAAGAAAATGAAGATGGCTGG - Intronic
1151413208 17:73944647-73944669 ATGTAAAAAAGGAAGGTGCAAGG - Intergenic
1151430497 17:74059325-74059347 ATAAAGAAAGGGAAGGGGGCTGG + Intergenic
1153362593 18:4214220-4214242 CTGAGGAACAGGAAGGTGGCAGG + Intronic
1153851741 18:9101836-9101858 ATGGGCAAAAGGAAGGGGGTGGG + Intergenic
1153973698 18:10248258-10248280 CTGAAGAAAAAGAAGTTGGCTGG + Intergenic
1154505808 18:15039876-15039898 AGGAACAAAATGAAGTTGGTTGG + Intergenic
1154980859 18:21501099-21501121 ATGAAAAAAAAGAATGTGCCCGG + Intronic
1156074875 18:33262369-33262391 ATGAAAAAAAGGAAGGTTGGAGG - Intronic
1156303485 18:35855774-35855796 AGGAACATAATGAAGCTGGCTGG + Intergenic
1156773818 18:40763154-40763176 ATGAACAAAAGAAAGGTAGCAGG - Intergenic
1156819992 18:41360724-41360746 ATGATCAAAAGCAAGCTGACAGG + Intergenic
1158414172 18:57234660-57234682 ATGAGGAAAAGAAAGGTGGGAGG + Intergenic
1159010822 18:63057590-63057612 TTGGAAAGAAGGAAGGTGGCAGG - Intergenic
1159128176 18:64249226-64249248 ATGAACAAAAGTAAGGGTGATGG - Intergenic
1159790318 18:72771174-72771196 GTGAACAAAAGGCAGATGGCAGG + Intronic
1161656334 19:5517799-5517821 CTGTACAAAGGAAAGGTGGCCGG + Intergenic
1162259673 19:9522159-9522181 AGAAACAAAAGGAACGTGGCAGG - Intergenic
1162331073 19:10030217-10030239 AGGAACATAAGGAAGATGGGAGG + Intergenic
1162807791 19:13147467-13147489 AAAAAAAAAAGGAAGCTGGCCGG + Intronic
1164147481 19:22520852-22520874 AGGAACAGAAGGAAGATTGCTGG - Intronic
1165610390 19:37146584-37146606 AGGAGCAAGAGGAATGTGGCAGG - Intronic
1165613626 19:37179131-37179153 GGGAACAAGAGGAATGTGGCAGG - Intronic
1166948093 19:46409284-46409306 AAAAACAAAAGGAGGGTGGTGGG + Intergenic
1167098960 19:47392249-47392271 ATGACCAAAGGCAAGGTGGGTGG - Intergenic
1167323923 19:48812651-48812673 CTGTAGAATAGGAAGGTGGCTGG - Intergenic
1167448291 19:49552143-49552165 ATTAAAAACAGGAAGATGGCTGG - Intergenic
1168376518 19:55884451-55884473 ATGAACATAATTAAGGTAGCTGG - Intergenic
1168433870 19:56302556-56302578 AGGAAGAAAAGGAAGGGGGGAGG - Intronic
925083294 2:1087060-1087082 AGGAGCAGAAGGAGGGTGGCAGG + Intronic
925232002 2:2241531-2241553 ATAAATAAAAGCAACGTGGCTGG - Intronic
925836520 2:7951996-7952018 ATGGGCAACAGGAAGGAGGCTGG - Intergenic
926055600 2:9772185-9772207 AAGCACAAAGGGAAGGTGGGAGG + Intergenic
926715865 2:15922990-15923012 AAGAAAAAAAAGAAGGTGTCAGG - Intergenic
926725054 2:15991206-15991228 AAGAAGAAGAAGAAGGTGGCCGG - Intergenic
926810790 2:16753670-16753692 AGGAACAAAATGAAGCTGGTTGG - Intergenic
927841002 2:26444043-26444065 ATCAACAAAAGGAAGGCAACAGG - Intronic
927876055 2:26655849-26655871 AACAGCAAAAGGAAGGGGGCAGG - Intergenic
927880067 2:26684050-26684072 GAGAAGAAAAGGAAGGAGGCAGG - Intergenic
928102622 2:28448305-28448327 TTCAACAAGAGGAAGGAGGCTGG - Intergenic
928291026 2:30037495-30037517 ATGAAGAAAAAGAAGATGCCAGG + Intergenic
929490518 2:42392190-42392212 ATGCATTAGAGGAAGGTGGCAGG - Intronic
929676598 2:43938974-43938996 AACAACAAAAGAAAGATGGCCGG + Intronic
929802982 2:45120257-45120279 AGGAGCCAAAGGAAGGAGGCAGG + Intergenic
929832741 2:45360643-45360665 ATGAAAGAAAGGAAGGGGGTAGG - Intergenic
930152381 2:48071713-48071735 AAGAACAAAAACAAAGTGGCTGG + Intergenic
930392385 2:50778547-50778569 ATGAACAAAAGGAAGGTGGCAGG + Intronic
930826374 2:55700413-55700435 AGGAAGAAAGGGAAGGTGGGAGG - Intergenic
931221306 2:60290617-60290639 GGGAACTAAAGGAAGGTGGGTGG + Intergenic
931947337 2:67324797-67324819 AAGAAGAAAAGGAAGGGGGAAGG + Intergenic
932070213 2:68612477-68612499 AGGAATAAAAGAATGGTGGCTGG + Intronic
932870870 2:75396392-75396414 AGGAACATAATGAAGTTGGCTGG - Intergenic
933706729 2:85296650-85296672 ATGAACAGAAGGAACGATGCAGG - Intronic
933792093 2:85890941-85890963 ATGAAGAAAAGGAAGTTTGCAGG - Intergenic
934134891 2:88985779-88985801 ATCAAGAAAAGGAAGGAGACTGG + Intergenic
934235419 2:90227974-90227996 ATCAAGAAAAGGAAGGAGACTGG - Intergenic
934649139 2:96079381-96079403 ATCAATAAAAGGAAGATAGCTGG - Intergenic
935316851 2:101843270-101843292 GTGAACAAAGGGAGGGTGGAAGG + Intronic
935334410 2:102001944-102001966 AAGAACAAAAACACGGTGGCAGG - Intronic
936928382 2:117761350-117761372 TTGGCCAAAAGGAAGGTGGAAGG - Intergenic
936991688 2:118373424-118373446 ATGAATGAAAGGGAGGTGCCGGG + Intergenic
938444590 2:131367155-131367177 ATGCACACAAGGAATGTGTCCGG + Intergenic
938751342 2:134333595-134333617 ATAAAAAAAAAGAAGGTGGTGGG + Intronic
938816838 2:134913197-134913219 ATCAACAAAGGGAAGAGGGCTGG - Intergenic
939213437 2:139208918-139208940 AGGAACATAATGAAGGTGGTTGG + Intergenic
940337907 2:152547690-152547712 AAGAAGAAAAGGAAGGAGGATGG - Intronic
940345333 2:152622875-152622897 AAGAACAAAAAAAAGGTGCCAGG + Intronic
941661211 2:168197178-168197200 AAGAAGAAAAGTAAAGTGGCTGG + Intronic
941932651 2:170957570-170957592 ATGAAGAAAAGGAAGGAGGCTGG - Intronic
942196571 2:173526656-173526678 CTGAGCAAAAAGAAGGAGGCTGG - Intergenic
942363125 2:175193739-175193761 ATGAAAAAAACAAAGTTGGCTGG - Intergenic
943254347 2:185574821-185574843 ATAAACAAATAGAAGGTGACTGG - Intergenic
943860621 2:192857738-192857760 AGGAACAAAAGGAAGGAAGGAGG + Intergenic
944112044 2:196143081-196143103 ATAAACAAAAATGAGGTGGCCGG + Intronic
944349135 2:198706071-198706093 AAGAAAAAAAGAAAGGTGGGAGG + Intergenic
945022877 2:205591791-205591813 CTGAAGAAAAGGAAGCTGTCCGG + Intronic
945135053 2:206618174-206618196 ATGAACACAAAGAAGCTGCCTGG + Exonic
945856665 2:215077026-215077048 AGGAACAGAAGGAAGGAGGCAGG + Intronic
945974475 2:216259552-216259574 AGGATCAAAAGGCAGGAGGCAGG - Exonic
946100205 2:217314119-217314141 CAGAACAAGAGGAAGGGGGCTGG - Intronic
947036129 2:225858597-225858619 ATGAATAACAGAAAGGTAGCTGG + Intergenic
947206779 2:227667986-227668008 ATGGAGAAAGGGCAGGTGGCAGG - Intergenic
947674969 2:231970242-231970264 ATTAACAAATGAAAAGTGGCTGG - Intronic
948169255 2:235888066-235888088 ATAAGCAAATGGAAGGAGGCTGG - Intronic
948791952 2:240383730-240383752 AAGAACAAAAGGAAGATGGGTGG - Intergenic
948882662 2:240868370-240868392 ATTTACAAAAAGCAGGTGGCAGG - Intergenic
948954511 2:241277305-241277327 ATAAACAAAAGAAAGGTAGAAGG + Intronic
1169451341 20:5714312-5714334 AAGGTCAAAAGGAAGGTTGCAGG - Intergenic
1170005700 20:11666815-11666837 ATGAACAAAAAGGAGTTGCCAGG - Intergenic
1170217679 20:13908873-13908895 ATGTACAAAGGGAAGCTGGATGG - Intronic
1170353616 20:15469259-15469281 ATGAGCAAAAGAAAGGAGGTGGG + Intronic
1171197647 20:23212846-23212868 AGGAACAAAAAGATGGTGGGTGG - Intergenic
1171382882 20:24746499-24746521 CTGAACAAAAGGAACCTGGGAGG - Intergenic
1172187138 20:33038000-33038022 TTGGACAAAAGGAAGGTGGATGG - Intronic
1173021173 20:39269175-39269197 ATGCTCAAAAGGATGGTGGGAGG + Intergenic
1173210369 20:41027805-41027827 ATGAGGGAAAGGAAGGTGTCAGG + Intergenic
1173582612 20:44158277-44158299 ATGAACAAAAGCTCTGTGGCAGG + Intronic
1174534577 20:51241020-51241042 GTGACCAAGAGGCAGGTGGCAGG - Intergenic
1174706353 20:52660274-52660296 AAGAACAAAATGAAGGAGGGTGG + Intergenic
1174735585 20:52962730-52962752 GTAAAGAAAGGGAAGGTGGCTGG - Intergenic
1174785276 20:53426763-53426785 AAAAATAAAAGGAAGGTGGAGGG + Intronic
1175414352 20:58792077-58792099 GGGAACAAAAGGAAGGTAGGAGG - Intergenic
1175895442 20:62333806-62333828 ATGAGCCAGAGGAAGGTGGCGGG + Intronic
1176047385 20:63099928-63099950 AGGAAAAAAAGGAAGGAGGGAGG + Intergenic
1177698326 21:24603012-24603034 AAGGACAAAAGGAAGGTTGGAGG - Intergenic
1177920844 21:27150428-27150450 ATGAAAAAAAGGAAATTTGCAGG - Intergenic
1177991449 21:28040158-28040180 AGGAACAAAATGAAGTTGGTTGG - Intergenic
1178085208 21:29105347-29105369 ATGAGCAACAGGAAGAAGGCAGG - Intronic
1178206706 21:30475833-30475855 AGGGACTAAAGAAAGGTGGCAGG + Intergenic
1178264575 21:31131075-31131097 ATGAATGAATGGAAGGTGGGTGG - Intronic
1178796672 21:35751366-35751388 ATTTACAAAAAGCAGGTGGCTGG - Intronic
1179348670 21:40585832-40585854 ATGAGCACAGGGAAGGTGCCAGG - Intronic
1180038780 21:45265130-45265152 ATGAAGACATGAAAGGTGGCTGG + Exonic
1181002419 22:19994121-19994143 ATGAATGAATGGAGGGTGGCTGG + Intronic
1181134938 22:20758616-20758638 ATGGACAAATGCAAGGTGGACGG + Intronic
1181824873 22:25507028-25507050 ATGAATAAAAGGATGGGGGATGG - Intergenic
1181824894 22:25507149-25507171 ATGAATAAAAGGATGGAGGATGG - Intergenic
1181959853 22:26615351-26615373 AAGAAGAAAAGGAAGTGGGCTGG - Intronic
1181989982 22:26829988-26830010 ATGGACATAAAGCAGGTGGCAGG + Intergenic
1181996652 22:26888151-26888173 CTGAATAAAAAGAAGCTGGCTGG + Intergenic
1182236017 22:28877273-28877295 ATAAATAAAAATAAGGTGGCTGG - Intergenic
1182664775 22:31949644-31949666 ATGTACACATGGAAGGTGGCGGG - Intronic
1182753242 22:32658232-32658254 AGAAACCAAAGGAAGGTGGTCGG + Intronic
1184149228 22:42628845-42628867 ATGGAGAAGGGGAAGGTGGCTGG + Intronic
1185177876 22:49340354-49340376 AAGAAGAAAAAGAAGGAGGCTGG - Intergenic
949560894 3:5201444-5201466 ATTAAGAAAAGGGAGTTGGCTGG - Intronic
950575797 3:13831456-13831478 CCGAACAGAAGGAAGGTGGGTGG + Intronic
951430316 3:22598526-22598548 ATTAACAAAAAGAAAGTGGAGGG + Intergenic
954939546 3:54358908-54358930 AGGAAGTAAAGGAAGGTGGGAGG - Intronic
957090980 3:75729785-75729807 AGGAACCAAAAGAAGGAGGCAGG + Intronic
957522794 3:81342333-81342355 ATTAAGAAAAGAAATGTGGCCGG + Intergenic
958026592 3:88058097-88058119 TTGAACAAACGGAAAGTGCCAGG - Intronic
960243300 3:115371180-115371202 AAGAAGAAAAGGAAGGAGGTAGG - Intergenic
960570665 3:119182256-119182278 GTGAACAGAGGGAAGGTGGAAGG + Intronic
961062514 3:123843489-123843511 AGGAATAAAGGTAAGGTGGCTGG + Intronic
962782093 3:138728978-138729000 AAGAACAAAATCAAGATGGCAGG + Intronic
963156289 3:142100671-142100693 GTGAAGAAAGGGAAGGAGGCAGG - Intronic
963209780 3:142675975-142675997 AAGAAAAGAAGAAAGGTGGCTGG - Intronic
963349285 3:144132987-144133009 ATGAACAAAGAAAAGGAGGCTGG - Intergenic
963542271 3:146607760-146607782 ATGAACAAAAGGGAGATCTCAGG - Intergenic
963774981 3:149429471-149429493 TTGACCAAAAGGAGGGTGGAGGG + Intergenic
963834003 3:150037831-150037853 AAGAAAGAAAGGAAGGAGGCAGG + Intronic
963914446 3:150845190-150845212 ATGGACAAAACAAAGGTGGCAGG - Intergenic
964086090 3:152820389-152820411 TTGAACTAAAGCAAGGTTGCAGG - Intergenic
964404265 3:156332020-156332042 ATGAACTGAAGGAAGGCTGCAGG - Intronic
964934998 3:162073229-162073251 TTGCACAAAAGGAAGATGGATGG - Intergenic
965503750 3:169487772-169487794 ATGCAAAAAAGGGAGGGGGCGGG + Intronic
968933517 4:3597247-3597269 CCGGACAAGAGGAAGGTGGCAGG + Intergenic
970596924 4:17609115-17609137 AAAAACAAAAAGCAGGTGGCGGG + Intergenic
970747147 4:19312754-19312776 ATAAAAAAAAGAAAAGTGGCCGG + Intergenic
971288304 4:25311402-25311424 ATGTACAAAAAGAATCTGGCTGG + Intergenic
971505777 4:27365225-27365247 ATGAAGACAATGAAGGTGGGGGG - Intergenic
971786813 4:31114698-31114720 AGGAAGCAAAGGAAAGTGGCAGG + Intronic
971921929 4:32951641-32951663 AAGATCAAAAGGTAGGTGGGGGG + Intergenic
972706687 4:41551593-41551615 ATGAACAAAAGGAAGCAGGCTGG - Intronic
972874621 4:43343445-43343467 ATGAAGGAAAGGAAGGAGGAAGG - Intergenic
973633449 4:52840773-52840795 ATGAAGGAAAGGAAGGGGGAAGG - Intergenic
973916614 4:55640327-55640349 ATGAAATAATAGAAGGTGGCTGG + Intergenic
973951095 4:56015229-56015251 ATGAAAAGAAGGAAGGTTGTTGG + Intronic
974188386 4:58469754-58469776 AGGAACCAAAAGAAGGAGGCAGG + Intergenic
974592546 4:63972577-63972599 ATGAAGAAAGCAAAGGTGGCTGG - Intergenic
975704570 4:77099135-77099157 ATAAAAAAATGGAATGTGGCTGG - Intergenic
976335822 4:83884980-83885002 ATAATCAAAAGGAGGGTGGCAGG - Intergenic
976382672 4:84418121-84418143 GAGAACAACAGGCAGGTGGCAGG + Intergenic
976774608 4:88694110-88694132 ATAAACAAAAGAAAGATTGCTGG + Intronic
976882304 4:89942381-89942403 AACATGAAAAGGAAGGTGGCAGG + Intronic
977271828 4:94926124-94926146 AGGAAGAAAAGGAGGGAGGCAGG - Intronic
977569784 4:98617129-98617151 ATGAACAAAAGAAAGGGTGTAGG + Intronic
978368761 4:108009249-108009271 AAGGAGAAAAGGATGGTGGCTGG + Intronic
978529715 4:109701724-109701746 ATCAACAAATGGTAGCTGGCAGG - Intronic
978622005 4:110641862-110641884 ATAAGCAAAAGGAAGGAGGTCGG - Intronic
978833771 4:113121867-113121889 ATGAACAAGAAGAATGTGGTGGG - Intronic
979211680 4:118112310-118112332 ATGAATAAAGGGAAGATGACAGG + Intronic
979426901 4:120578884-120578906 AGGAAGAGAAGGGAGGTGGCAGG + Intergenic
979848052 4:125542171-125542193 ATGAAAAAAAGTAAAGGGGCTGG + Intergenic
980501729 4:133664404-133664426 AAGCCCAAAATGAAGGTGGCAGG + Intergenic
981019218 4:140007604-140007626 TGGAACAAAAGGGAGGTGGTCGG + Intronic
982303459 4:153903802-153903824 ATGGGAAAAGGGAAGGTGGCTGG + Intergenic
984103306 4:175513924-175513946 AGGGAAAAAAGGAAGGTGGTGGG - Intergenic
984819337 4:183866510-183866532 ATGAAGAAGAGGATGGTGGAGGG + Intronic
985949199 5:3210558-3210580 ATGAAGAAAAGGACTGCGGCAGG + Intergenic
986170773 5:5312752-5312774 GAAAACAAAAGGAAGGGGGCTGG - Intronic
986225854 5:5811722-5811744 ACTGACATAAGGAAGGTGGCTGG - Intergenic
986798619 5:11236824-11236846 CTGAACAAAAGGAAAGAAGCGGG + Intronic
986824866 5:11509489-11509511 ATGAAAAAAAGGAAAGTAGGAGG + Intronic
987002671 5:13675973-13675995 ATGAACAGGAGGCAGGTGGCAGG + Intergenic
987657491 5:20824632-20824654 AGGAACATAATGAAGGTGGTTGG - Intergenic
988766053 5:34379309-34379331 AGGAACATAATGAAGGTGGTTGG + Intergenic
988867981 5:35356331-35356353 GTGTAGAAAAGGAAGGTGACTGG - Intergenic
989181329 5:38580389-38580411 ATAAGGGAAAGGAAGGTGGCAGG - Intronic
989325190 5:40184909-40184931 AAGAAAAAAAGGAAGGAGGGAGG + Intergenic
990460126 5:56023816-56023838 AAGTACAGAAGGAAGGTGGAGGG + Intergenic
990797197 5:59556888-59556910 AGGAAGAAAGGGAGGGTGGCAGG + Intronic
991138152 5:63207520-63207542 ATGAACAAAGGGAACCTGGCTGG - Intergenic
991450157 5:66743072-66743094 AAGACCAAAAGGAAGGAAGCTGG - Intronic
991962203 5:72056448-72056470 CTGAACAAAAGAAAGGGTGCTGG - Intergenic
992956778 5:81918024-81918046 ATGAAAGAAAGGAAGTTGGTCGG - Intergenic
993247618 5:85470915-85470937 GTGAAAAAAAAGAAGGCGGCTGG + Intergenic
993552893 5:89296693-89296715 ATGAGCAAAGGAAAGGTGTCAGG + Intergenic
994041539 5:95264870-95264892 AGGAAAGAAAGAAAGGTGGCAGG + Intronic
994065530 5:95536015-95536037 CTGACCAAAAGGAAAGAGGCTGG + Intronic
995217750 5:109614610-109614632 TTGGAGAAAAGGAAGCTGGCAGG + Intergenic
996825078 5:127673766-127673788 ATGAGTAAGAGGAAGGTGACTGG + Intergenic
997581192 5:135018507-135018529 ATGCACAAAGGAAAGATGGCAGG + Intergenic
997694031 5:135847380-135847402 ATGAACAAAACGAGGGGGCCAGG + Intronic
998397454 5:141827867-141827889 CTCAACAAGAGGAGGGTGGCTGG - Intergenic
998475135 5:142414069-142414091 ATGAGCAAAGGGCAGGTGACAGG - Intergenic
999544178 5:152608670-152608692 GAGAACAAATGGAACGTGGCAGG + Intergenic
999633469 5:153596308-153596330 ATGAACAAAAATAAAGTGGCTGG - Intronic
999961880 5:156764653-156764675 ATCTACAAAAGGAAGGTAGGGGG - Intronic
1000467078 5:161592961-161592983 ATGAAAATAAGCAAGCTGGCCGG + Intronic
1000690908 5:164319751-164319773 ATGTATAAAAGGAGGGAGGCAGG - Intergenic
1001090185 5:168734315-168734337 ATGAACCAAAGACAGGAGGCAGG - Intronic
1001155166 5:169266407-169266429 CTGAAGAAAAGGAATGTGGGTGG + Intronic
1001478427 5:172067793-172067815 ATGAAAAAGAGGAAGGTTTCAGG + Intronic
1001546002 5:172570869-172570891 ATGGAAAAAAGGAAGGAGGGAGG + Intergenic
1002370740 5:178752053-178752075 AAGAAGAAAAGGAAGGAAGCAGG - Intergenic
1002701195 5:181126199-181126221 ATCAGAAAAAGGAGGGTGGCTGG - Intergenic
1002962519 6:1929108-1929130 ATGACCAAAAACAAGATGGCAGG + Intronic
1003342971 6:5239651-5239673 GTGACAAGAAGGAAGGTGGCAGG + Intronic
1003359254 6:5408691-5408713 ATGAACAAACGGAAGAAGGAAGG + Intronic
1004010634 6:11682625-11682647 AGTAACCAAAGGAAGGTGGCTGG - Intergenic
1004213314 6:13675338-13675360 ATCAACAAAAGAAAGATAGCTGG + Intronic
1004643705 6:17539610-17539632 ATGGACATAAGGAACATGGCAGG - Intronic
1005878225 6:30032034-30032056 GGGGACAAAGGGAAGGTGGCTGG + Intergenic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1006854470 6:37123567-37123589 ATGAACTAAAGGAGGCTGGAAGG + Intergenic
1007698226 6:43747271-43747293 CAGAACAAAAGGAAGATGGAGGG + Intergenic
1007871263 6:45041682-45041704 AAGAAGAAAAAGAAGGTGGAAGG - Intronic
1008302984 6:49865561-49865583 GAAAACAAAAGGAAGGTGGTTGG + Intronic
1009751398 6:67882800-67882822 AGGAACATAAGGAAGATGGGAGG + Intergenic
1010302402 6:74277020-74277042 ATGAAAAAAAGCAAGGTGACAGG + Intergenic
1013015294 6:106155466-106155488 AGGAAGAAAAGACAGGTGGCAGG + Intergenic
1013082873 6:106827951-106827973 AAAAAAAAAAGCAAGGTGGCCGG - Intergenic
1015326981 6:131934176-131934198 ATGTACAAGAGGAAGGAGGTGGG + Intergenic
1016590606 6:145739383-145739405 AGGAATAAAAGAATGGTGGCTGG + Intergenic
1017055543 6:150432587-150432609 AAGAAGAAAAGGAAGGTGTGGGG + Intergenic
1018247693 6:161838600-161838622 ATGAGGAAGAGGAAGGTGGCTGG - Intronic
1018377518 6:163227266-163227288 AGGAACAAGAGGGAGGTGGGAGG + Intronic
1018407135 6:163498565-163498587 AAGAACAAAAGGAAGAAGGGAGG - Intronic
1020050330 7:5077052-5077074 AGGAAGAAAAGGAAGGAGGAAGG - Intergenic
1020074633 7:5249618-5249640 AAGAACAAAAGGGAGGTCGGAGG + Intergenic
1021453327 7:20802456-20802478 AAGAATAAAAGAAAGCTGGCGGG - Intergenic
1021726151 7:23549883-23549905 ATAAAGAAAAAGAAGGAGGCCGG - Intergenic
1021942478 7:25691489-25691511 ATGTCCATAAGGAAGATGGCAGG + Intergenic
1022657641 7:32335030-32335052 ATGGGCAAAATGAAAGTGGCCGG - Intergenic
1023895811 7:44431966-44431988 AAAAACAAATGGAAGGAGGCTGG - Intronic
1024278872 7:47701507-47701529 AAGAAGAAAAGGAAGGAGGGAGG + Intronic
1025995701 7:66526022-66526044 AGGACAAAAAGAAAGGTGGCTGG - Intergenic
1026679923 7:72458051-72458073 ACTAAGAATAGGAAGGTGGCTGG - Intergenic
1027475940 7:78631411-78631433 ATGAACTGAAAGAAGGAGGCAGG - Intronic
1029009740 7:97246453-97246475 ATGAACAAAAAGAAAAAGGCCGG + Intergenic
1029273547 7:99391340-99391362 AAGAAAAAAAGGAGGGAGGCAGG - Intronic
1030759223 7:113330784-113330806 TTGCAACAAAGGAAGGTGGCAGG + Intergenic
1030927837 7:115479604-115479626 AGGAAGGAAAGGAAGGTGGAAGG - Intergenic
1031018522 7:116601336-116601358 ATGAACAGAAGGAAGTTCACTGG - Intergenic
1032153504 7:129449935-129449957 AGGAACATAAGGAAGCTGGTTGG - Intronic
1032439141 7:131928496-131928518 CTGCTCAAAAGGAAGGTGACAGG + Intergenic
1032923796 7:136578710-136578732 AAGAACAAAATGAAGTTGGTTGG - Intergenic
1033093029 7:138404345-138404367 ATGAACAAGAGGAAGAAGGTGGG - Intergenic
1033848236 7:145461908-145461930 ATGAAGTAAAGGAAGCAGGCAGG - Intergenic
1033928058 7:146488538-146488560 ATGAAGAGAAGGAAGGTAGGAGG - Intronic
1034169497 7:149052027-149052049 AGGAACAAAATGAAGCTGGTTGG + Intergenic
1034736868 7:153437442-153437464 ATGAATAAAAGGAAAGTCACAGG - Intergenic
1034855783 7:154545424-154545446 ATGAAGAAAAGGAGGGAGGGAGG - Intronic
1034908806 7:154974686-154974708 ATGAACAAAAGGACTGTTGATGG - Intronic
1034972689 7:155428894-155428916 ATGAACACAGGGAGTGTGGCTGG - Intergenic
1035518070 8:253560-253582 CTCAGCAAAAGGAATGTGGCAGG - Intergenic
1036708440 8:11061775-11061797 ATGAGAAGAAGGAAGGGGGCTGG + Intronic
1037236961 8:16731401-16731423 ATGAAGTAAGGGAAGGTGGCAGG - Intergenic
1039044185 8:33435024-33435046 ATCAACAACAGGAAGGAGACAGG + Intronic
1039330238 8:36529870-36529892 ATGAACATAATGAAGGTGGTTGG + Intergenic
1039562896 8:38527385-38527407 ATGGCCACCAGGAAGGTGGCAGG + Intronic
1041278575 8:56189121-56189143 ATGAATAAAAGGAAGATGAGAGG + Intronic
1042732234 8:71948782-71948804 ATGAAAAGAAGGAAGGGGGAGGG + Intronic
1043804408 8:84653409-84653431 ATGAGCAAAAGAAAGGTAGGAGG - Intronic
1044682890 8:94799829-94799851 ATGATCTAAGGGAAGGTGACAGG + Intergenic
1044751380 8:95419569-95419591 AGGAACAAACGGAAGCTGGGAGG - Intergenic
1045369255 8:101505186-101505208 ATGAAGAAAAGGATGGGGGAGGG - Intronic
1046368935 8:113274853-113274875 AAGAAAAAAAGGAAGGAAGCAGG + Intronic
1046369915 8:113289656-113289678 ATGCACCAAAAAAAGGTGGCAGG - Intronic
1046944396 8:119961118-119961140 CTGAATAAAAGAAAAGTGGCTGG + Intronic
1048544109 8:135370082-135370104 ATGAAAGAAAGGAAGATGGAGGG + Intergenic
1048763499 8:137822495-137822517 AGGAACCAAAAGAATGTGGCAGG + Intergenic
1049865107 8:144930161-144930183 ATAAAGAAAAGTAGGGTGGCGGG + Intergenic
1050051673 9:1608601-1608623 ATCCTCAAAAGGAAGGTGGAGGG + Intergenic
1050513668 9:6420052-6420074 AAGAAAAAAAAAAAGGTGGCGGG - Intronic
1050548465 9:6728907-6728929 ATGAAAAAAAGGAAGAAGGCTGG + Intronic
1051383737 9:16484799-16484821 ATGAACAAAAGCAATATGCCAGG + Intronic
1051630394 9:19135375-19135397 ATGAAAAAAAAAAAGTTGGCTGG + Intronic
1051662121 9:19435416-19435438 AGGAAAAAGAGGAAGGGGGCAGG + Intronic
1052285018 9:26775372-26775394 AGGAACACAAGGAAGCTGTCAGG + Intergenic
1052423207 9:28270568-28270590 CTGCACATAAGGGAGGTGGCTGG - Intronic
1055130683 9:72770863-72770885 AAGAACAAAAGGAAGAAGGAGGG - Intronic
1055544582 9:77356156-77356178 ATGAAGAAGAGCAAGGAGGCTGG - Intronic
1056006362 9:82275789-82275811 AGGAAAACAAGGAAGGTGGGAGG - Intergenic
1056400033 9:86217925-86217947 AAGAACAAAGAGAAGGTTGCAGG - Intergenic
1057235346 9:93353341-93353363 ATGAAAAAAAGGAAGTTGCCAGG + Intergenic
1057259048 9:93574172-93574194 TTGAACAAAAGGAATGTATCTGG + Intergenic
1057316189 9:93970133-93970155 AGGAACATAAGGAAGCTGGTTGG + Intergenic
1057445541 9:95111936-95111958 ATGACCAACAGGAATGTGGCAGG + Intronic
1057934093 9:99222125-99222147 GTGATCCAAAGGAAGGAGGCCGG + Intronic
1058049187 9:100389459-100389481 AAGAACAAAGGGAAGGTTGGAGG - Intergenic
1058226719 9:102372803-102372825 AGCTACAAAAGGAAGGTGGGAGG + Intergenic
1058394018 9:104528885-104528907 AAGCACAAAAGGAATGGGGCAGG + Intergenic
1058444061 9:105038521-105038543 ATGAACCAAAGGAAAGTCCCAGG - Intergenic
1058575681 9:106398773-106398795 GTGATCAAAAGGAAGGAGGCTGG + Intergenic
1058660407 9:107261505-107261527 GTGCAAAAAAGGAAGGTGCCAGG + Intergenic
1059929899 9:119250095-119250117 AGGAAGAAAAGGAAGGAGGGAGG + Intronic
1060355482 9:122904182-122904204 ATGAAAAAAAGGAAGGCCGTGGG + Intronic
1062058586 9:134482354-134482376 AAGATCAAAGGGAAGATGGCAGG + Intergenic
1062387693 9:136319664-136319686 ATTAAAAAAAGAAAGGGGGCCGG - Intergenic
1185671220 X:1811608-1811630 CAGCAGAAAAGGAAGGTGGCAGG + Intergenic
1185840312 X:3383441-3383463 TTGCAGAGAAGGAAGGTGGCAGG - Intergenic
1185954834 X:4478168-4478190 ATGAAAGAAAGGAAGGAGGGAGG + Intergenic
1187184742 X:16972628-16972650 AAGAACAAAATTAAAGTGGCTGG - Intronic
1187186592 X:16992559-16992581 AAAAACATAAGGAAGGTGGAAGG - Intronic
1187323664 X:18266485-18266507 ATGGACAAAAGTAACCTGGCAGG - Intronic
1188880543 X:35486734-35486756 GTGCACACAAGCAAGGTGGCAGG + Intergenic
1189123387 X:38419277-38419299 TTGAACAAAAGGAAGAAAGCTGG - Intronic
1189447985 X:41098839-41098861 ATGAAAAAGACGAAGTTGGCTGG - Intronic
1189466074 X:41278540-41278562 ATTAAAAAAAGGAAGGTGCCTGG - Intergenic
1189487784 X:41446233-41446255 CTGATCAAAATGAGGGTGGCAGG - Intergenic
1189810305 X:44775271-44775293 ATGAACAAAAAGCAGGGGACAGG + Intergenic
1190017866 X:46843613-46843635 ATGAACAAAGGGAATGTGATAGG + Intronic
1190165800 X:48071867-48071889 AGGAACAATAGGAAGGCGGCAGG - Intergenic
1190199737 X:48350576-48350598 ATGAACACAAGGAAGGGAGAGGG + Intronic
1191967362 X:66774527-66774549 AGGAAGAAAAGGAAGGAGGGAGG - Intergenic
1193156016 X:78175008-78175030 AGGAACATAATGAAGTTGGCTGG - Intergenic
1193189159 X:78548964-78548986 CTGAACAATAGGAAAGTGGCAGG + Intergenic
1193906203 X:87247499-87247521 CTGAACAAAAGGAAAGGAGCTGG - Intergenic
1194776916 X:97976513-97976535 ATGAACAAAGAGAAGATTGCTGG - Intergenic
1194837889 X:98703797-98703819 CTGAACAAAAAGAACGAGGCTGG - Intergenic
1195020614 X:100823414-100823436 ATGAAACAAATGAAGGTGGGAGG + Exonic
1195428047 X:104757547-104757569 ATAGACAAAAGGAAGATGTCTGG + Intronic
1195754191 X:108184827-108184849 GTGAACAGAAGGAAGCTTGCAGG - Intronic
1196286318 X:113884827-113884849 ATGAACAATAGAAAGATGACTGG - Intergenic
1196780625 X:119380669-119380691 ATGAAAAAAAGAAAACTGGCTGG - Intergenic
1197072634 X:122318188-122318210 AGGACCAAAAAAAAGGTGGCAGG + Intergenic
1197221729 X:123921064-123921086 AAGAAAAAAAGAAAGGAGGCCGG - Intergenic
1199811313 X:151352644-151352666 ATGAACCAAAGGAAGGAAGGAGG - Intergenic
1199902211 X:152186889-152186911 TTGAAGAAAAGGAAGCAGGCTGG - Intronic
1200229104 X:154435257-154435279 ATGAACCTGGGGAAGGTGGCAGG - Exonic
1201235666 Y:11908470-11908492 CTGCAGAGAAGGAAGGTGGCAGG + Intergenic
1201929635 Y:19328262-19328284 ATGACCAACAGGTAGGTGGTGGG - Intergenic