ID: 930398944

View in Genome Browser
Species Human (GRCh38)
Location 2:50858723-50858745
Sequence TTTTAAATGAAAAATCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1026
Summary {0: 1, 1: 0, 2: 12, 3: 109, 4: 904}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930398944 Original CRISPR TTTTAAATGAAAAATCAGGA GGG Intronic
900716282 1:4147037-4147059 TTTTAAAAGAAGAATCATGTTGG - Intergenic
901617770 1:10555416-10555438 TTTTCAATGTAAAATAAGGGAGG + Intronic
902692577 1:18119004-18119026 GTTTAAATGAAAACTAAGTAAGG - Intronic
903439719 1:23378547-23378569 TTAGAAATGAAAAATCAGCTGGG + Intergenic
903913042 1:26742664-26742686 TTTCAAATGAAATATCAAGCTGG + Intronic
904124732 1:28230075-28230097 TTTTAAATTAAAAATAGAGATGG - Intronic
904251342 1:29226559-29226581 TTTTAAATAAAAAATATAGATGG - Intronic
904395455 1:30218270-30218292 TTTTAAAAGAAAAATGGGGAGGG - Intergenic
904689743 1:32285006-32285028 TTTTAAGTAAATAATCAGGTGGG + Intronic
904857771 1:33512126-33512148 TTTTAAATTAGAACTCAGCAGGG - Intergenic
905196699 1:36284903-36284925 TTTCAAATGAAAAGTGTGGAAGG + Intronic
905228956 1:36500037-36500059 TTTTAAAAAAAAAATCATGAAGG + Intergenic
905542763 1:38773496-38773518 TTTAAAAAAAAAAAACAGGAAGG + Intergenic
905678537 1:39848421-39848443 TATTAAATTAAAAATAAGAAAGG - Intronic
905856792 1:41319834-41319856 CTGTAAATGAAAAATGAGGAGGG - Intergenic
905881731 1:41468392-41468414 TTTTTAATGAAAGATAAAGAAGG - Intergenic
906163081 1:43665362-43665384 TTTTAAAAGAAAAAAAAAGAAGG - Intronic
906497126 1:46312564-46312586 TTTTAAAAGTAAACTCAGGCAGG + Intronic
906578368 1:46911844-46911866 TGTTTAATGAAAAATTAGGCTGG - Intergenic
907138903 1:52166551-52166573 GTTCAGATGAAAAATCATGAAGG - Intronic
907452708 1:54557064-54557086 TTTTAAATAAAAAATCTGCCAGG - Intronic
907957258 1:59241665-59241687 TTTTAACTGAAAGATTAGGAAGG + Intergenic
908301840 1:62769790-62769812 TTTTAAATGTACAATTAGGCTGG + Intergenic
908696215 1:66844894-66844916 TTTTAAAAGACAATTCAGGCTGG + Intronic
909351908 1:74663606-74663628 TTTTTTAACAAAAATCAGGAAGG - Intronic
909723650 1:78808313-78808335 ATTTAAATGAAAAAGAAGGAAGG + Intergenic
909732186 1:78906840-78906862 TTTTAAATGAAAAATTAAATTGG - Intronic
909888672 1:80974856-80974878 TTTTAAATGAAAAAACATAAGGG - Intergenic
910006300 1:82401201-82401223 TCTTGAGTGAGAAATCAGGATGG + Intergenic
910136832 1:83981899-83981921 TACTAAATTAAAAATCAGCAAGG + Intronic
910268633 1:85368486-85368508 TTCTAAATGAAAAACAAGGCAGG + Intronic
910717001 1:90243272-90243294 TTTTAAAGGCGAAATAAGGAAGG + Intergenic
910796688 1:91104387-91104409 TTTTAAATGAGAGAAAAGGAAGG + Intergenic
911306583 1:96239650-96239672 TCTTAAATGCAAAATCAGTAGGG - Intergenic
911836911 1:102631039-102631061 TTTTAAATGAATAATGACTAGGG + Intergenic
912047320 1:105475292-105475314 TTTTAAATGAAAGATAATCAAGG - Intergenic
912250035 1:108001480-108001502 GGTTAAATGAGAAGTCAGGAAGG - Intergenic
912297423 1:108483959-108483981 TTGTATATGAAAAATCAGAGTGG + Intergenic
912868076 1:113277087-113277109 TTTTCAGTGAAGAATCATGAGGG - Intergenic
914949920 1:152104121-152104143 TTTTAAATACAAAATAATGAAGG + Intergenic
915066392 1:153228573-153228595 ATTTAAGAGAAAAGTCAGGAAGG + Intergenic
915070724 1:153263574-153263596 CTTTAAATAAAAGACCAGGAAGG + Intergenic
915274718 1:154780290-154780312 GCTTAAATAAAAAATCAGAAAGG - Intronic
915576164 1:156779314-156779336 TTTTAAATTAAAAATTAGCTGGG - Intronic
915790686 1:158667136-158667158 TTCTAAACCAAAAATAAGGATGG + Intronic
915878008 1:159633441-159633463 TTTTAAAGGAAGAATGAGAAGGG - Intergenic
917029045 1:170669570-170669592 TTTAAAATAAAAAATCAGACTGG - Intronic
917227090 1:172795819-172795841 TTTCGAAGGAAAAATGAGGAGGG + Intergenic
917307195 1:173638707-173638729 TTTTAAATCAAAAAGCAGGAAGG + Intronic
918046088 1:180941845-180941867 TGTTAAAAGAAGAATGAGGAGGG - Intronic
918299837 1:183192999-183193021 GTTTCAATGAAAATTCAGGCTGG - Intronic
918362819 1:183776442-183776464 TTTTAAAAAAAAAATCTGGCCGG - Intronic
919234232 1:194817682-194817704 TTTTAAATGAAATAAAAGAAGGG - Intergenic
919439689 1:197616115-197616137 TTTTAATAGAAAAATTAAGATGG + Intronic
919512530 1:198483656-198483678 TTTTAAATGAAATAAGAGGTAGG - Intergenic
919971608 1:202583854-202583876 CTTTACATGAAATATCAGAATGG + Exonic
920149406 1:203892395-203892417 TTTTAAATGTAATTTCAGGTAGG - Intergenic
920525523 1:206663376-206663398 CTTTAGTTGCAAAATCAGGATGG - Intronic
920647659 1:207815216-207815238 TTAAAAATGAAAAATGATGACGG - Intergenic
921436334 1:215127674-215127696 TTTACTATGAAAAATCAGCAAGG - Intronic
921444851 1:215233612-215233634 TTTTAAAAGAAAAATCAAGAGGG + Intronic
921827994 1:219695504-219695526 TTAAAAATGAAAATTCAGGCTGG + Intronic
921878275 1:220224652-220224674 TTTTAAAGGCAAAACCAGTAAGG + Intronic
921956294 1:220986901-220986923 GCTTAAAGGAGAAATCAGGATGG + Intergenic
921965636 1:221085688-221085710 CTTTACATGAAAAATGAGGATGG + Intergenic
923310871 1:232734319-232734341 TTTTTACACAAAAATCAGGATGG - Intergenic
923582154 1:235228134-235228156 ATTTAAAAGAAAAATCAGGCCGG - Intronic
923587170 1:235284031-235284053 TTTTAAATGTAGAATGAGGCTGG - Intronic
923729768 1:236538986-236539008 TGATAAATGAAAAATGGGGACGG + Exonic
923767482 1:236905851-236905873 TTTTACTTGAAAAGTGAGGAGGG + Intergenic
923903479 1:238355766-238355788 TTTTAAAAGAATAATTAGGCCGG + Intergenic
924044890 1:240018622-240018644 TTTTAAAGGCTAAATCATGAAGG - Intronic
924147955 1:241096644-241096666 TTTTAATTGAAAAATAAGATTGG - Intronic
924228884 1:241946625-241946647 TTTTAAAAGAAAAGTCTAGATGG + Intergenic
924498304 1:244611676-244611698 CCTTCAATGAAAAATCAGGAGGG - Intronic
924639950 1:245824418-245824440 TTGAAAATGAAAACTCAGGCCGG + Intronic
1063045571 10:2388646-2388668 TTTTACAAGAAAAATAAGAAGGG - Intergenic
1063243815 10:4197671-4197693 TTTTAAATGAAAGTTTAGCAAGG - Intergenic
1063276739 10:4577301-4577323 TTTTAAAGGAAAAATGAAGTGGG + Intergenic
1065044051 10:21729677-21729699 TTTCAAATGAGGAAACAGGACGG - Intronic
1065983118 10:30922357-30922379 TTTGAGATGAAAAATCAAGTGGG + Intronic
1066189574 10:33043580-33043602 TTTTAAAGAAAACATTAGGAAGG + Intergenic
1066512428 10:36116612-36116634 TTTTAAGTGAAAAAGTAGGCCGG - Intergenic
1066516969 10:36173361-36173383 GTCTAAATGAAAAAAGAGGAAGG + Intergenic
1066585733 10:36932681-36932703 TTTGAAATCTAAATTCAGGATGG - Intergenic
1066613232 10:37272178-37272200 TTTTAAATAAAGTATAAGGAAGG + Intronic
1067391723 10:45869253-45869275 TTTTAATAGAAAGATCATGAGGG + Intergenic
1067402960 10:45994409-45994431 TTTTAATAGAAAGATCATGAGGG - Intronic
1067871569 10:49966889-49966911 TTTTAATAGAAAGATCATGAGGG - Intronic
1068557214 10:58472408-58472430 TTTAAAATGAAAAAACAAAAAGG - Intergenic
1069026474 10:63547900-63547922 TTTTAAAAGAAATATCACCAGGG + Intronic
1069152414 10:64980629-64980651 TTTTAAATAAAAAGTTTGGAGGG + Intergenic
1069931371 10:71884102-71884124 TTTTAAAGAAAAAAGCAGGCCGG - Intergenic
1070596568 10:77836896-77836918 TTTAAAATGAAAATTTAAGAAGG - Intronic
1070858481 10:79629055-79629077 TTCTAAATGAGAAAAGAGGAAGG + Intergenic
1070992340 10:80743388-80743410 TTTTAAATCAGAAAGCAGGAAGG + Intergenic
1071110027 10:82144974-82144996 TTTTAAAAGAAAAAGTGGGATGG - Intronic
1071409751 10:85377496-85377518 TGTCAAATGAAAAATGAGGGCGG + Intergenic
1071827305 10:89337910-89337932 TTTTAAGTGAAAAACAAGAATGG - Intronic
1071865336 10:89723776-89723798 TGTTAACTGAAAAATCAGGTTGG - Intronic
1071958627 10:90786111-90786133 TTTTTAATGAAAACACAGGTTGG - Intronic
1072456134 10:95577636-95577658 TTTTAAAAGAAATAGCAGGCTGG - Intergenic
1072925692 10:99614558-99614580 GTTTAAATTAGAAATCTGGAAGG - Intronic
1073243509 10:102073637-102073659 CTTTAAATAAAAATTCAGGTGGG + Intergenic
1073614648 10:104981245-104981267 TTTTAAATTAAAATGCAAGATGG - Intronic
1073710405 10:106030470-106030492 TTTTGAATGAAATATTAGGTTGG - Intergenic
1073861460 10:107747110-107747132 TTTTGAATAAAAAATTAGAATGG - Intergenic
1074672140 10:115803767-115803789 TTTTAACTGCAAAGTCAGAATGG + Intronic
1074744150 10:116514889-116514911 TTTTAAATGAAGAATGAAGAAGG + Intergenic
1074762653 10:116678483-116678505 TTGTGAAGGAAAAACCAGGAGGG + Intronic
1075104541 10:119529791-119529813 TTTTAATTAAGAAATCAGCAAGG + Intronic
1075373585 10:121958738-121958760 TTTTTAATAAAAAATAGGGAAGG - Intronic
1075905845 10:126081347-126081369 TTTAAACTGAAAAATCTGGATGG - Intronic
1076127619 10:127987818-127987840 CTTCAAATGAAAAATGAAGAGGG - Intronic
1076148874 10:128147088-128147110 TTTTATATGAAAATCCAGGTGGG - Intergenic
1076397013 10:130146617-130146639 TTAGAAATGAATTATCAGGAGGG + Intronic
1077765486 11:5155431-5155453 TTTTGAAAGAAAAAGAAGGAAGG - Intronic
1078312020 11:10253647-10253669 ATTAAATTGAAAAATCAGGGCGG - Intronic
1079663043 11:23065852-23065874 TTTTAAATGAAGAATAAAGTAGG - Intergenic
1079732742 11:23955970-23955992 ATTTAAGTGAAAACTCATGATGG - Intergenic
1079975011 11:27080022-27080044 TTTAAAAAGAAAGAGCAGGATGG - Intronic
1081350310 11:42044107-42044129 TTGTAATTGAAAAATAATGAAGG + Intergenic
1081372129 11:42316962-42316984 TTTTAACTGATGAATTAGGAAGG - Intergenic
1081545003 11:44065654-44065676 TTATACATGAGAAATCTGGAGGG - Intergenic
1082195708 11:49302308-49302330 TTTTAAAGCAAAAAACAAGAAGG - Intergenic
1082614905 11:55347888-55347910 TTTTAAAAAGAAAATCAGTATGG - Intergenic
1083040985 11:59687025-59687047 TTTTAAATCATAAAGCAGCAGGG + Intergenic
1083375766 11:62219263-62219285 TTTTAAATCAAAAAGCAGGAAGG + Intergenic
1084222328 11:67690628-67690650 TTTTAAAAGAAAAGTTAGGTTGG + Intergenic
1084291161 11:68169100-68169122 TTTTAAATGGAACAGCATGATGG - Intronic
1084906023 11:72348269-72348291 TTTTAAAGTAAAAATCACAATGG + Intronic
1084932659 11:72569531-72569553 TTTTAAAACAAAAATGAGGCTGG + Intergenic
1085130192 11:74031710-74031732 TTTTGAAAGAATAGTCAGGAAGG + Intronic
1085166801 11:74408883-74408905 TTTTAAAAGAAAACTCATAAAGG - Intergenic
1085357317 11:75850286-75850308 TTTCAATTGGAAAATCAGGAAGG + Intronic
1085760162 11:79234655-79234677 GTTTAAATGAGAAAGCAGAAAGG - Intronic
1086051190 11:82592593-82592615 TTCTAAATGAACTCTCAGGAGGG - Intergenic
1086511382 11:87561856-87561878 TTTCTCATGAAAAATCATGAAGG - Intergenic
1086535943 11:87846152-87846174 TATTCAAAGGAAAATCAGGAAGG + Intergenic
1086660228 11:89407267-89407289 TTTTAAAGCAAAAAACAAGAAGG + Intronic
1086765599 11:90691827-90691849 TCTTAGTTTAAAAATCAGGATGG - Intergenic
1086820348 11:91428778-91428800 TTTTATATAAAATATAAGGAAGG + Intergenic
1087259764 11:95997959-95997981 TCTTAAATGACAGATGAGGATGG - Intronic
1087419444 11:97902407-97902429 TTTTAAATGAACATGTAGGAAGG + Intergenic
1088159304 11:106850104-106850126 ATTTATATGAAACATCAGAATGG - Intronic
1088185033 11:107157700-107157722 TTTTAAGGAAAAAATGAGGAGGG - Intergenic
1088778634 11:113112013-113112035 CTTTAACTGAAAAATAATGAAGG + Intronic
1088896928 11:114085598-114085620 TTTTGATTGAAGATTCAGGAGGG + Intronic
1089023632 11:115244439-115244461 TCTTAAATGAGACATGAGGAAGG + Intronic
1089718343 11:120386002-120386024 TTTCCAATGCAAAAACAGGAAGG - Intronic
1089883013 11:121793012-121793034 TTTTAAATGAAAAAAAAAAAAGG + Intergenic
1089905590 11:122034684-122034706 TTTAAACTGAAAACTCTGGAGGG + Intergenic
1090182230 11:124710289-124710311 TTTTAAAGTAAAAATCAGCCAGG + Intergenic
1090543314 11:127733113-127733135 TCTTAAATGACAAGTCAGGCAGG + Intergenic
1090618046 11:128534127-128534149 TTTTAAATGATAAAAATGGAGGG + Intronic
1090682362 11:129075302-129075324 TTTTAATTAAAAAATTAGTATGG - Intronic
1090720255 11:129466336-129466358 TTTTAAAGGCAAAGTGAGGAGGG - Intergenic
1090998965 11:131892478-131892500 TTTTAAATTAGAAATCAGCCAGG - Intronic
1091100143 11:132864232-132864254 TTCAAAATAAAAAATCAGGCTGG - Intronic
1091428063 12:408820-408842 TTTTCAAATAAAAATCAGAATGG - Intronic
1091507227 12:1084360-1084382 TTTTAAATAAAATGTGAGGAAGG + Intronic
1091658796 12:2365682-2365704 TGTTAAATTAAAAACCAGCATGG - Intronic
1091843263 12:3635361-3635383 TTTTAAATTAAAAAGCATGAAGG - Intronic
1092518802 12:9244648-9244670 TTTTTAATAAAAAATGAGGATGG - Intergenic
1092554030 12:9536598-9536620 TCTCCAAAGAAAAATCAGGAAGG - Intergenic
1092665257 12:10790185-10790207 TTCTAAATGTGAAATCAGCAGGG - Intergenic
1093176968 12:15923316-15923338 TTTTAAAAGCAAAAACAGGCCGG - Intronic
1093306041 12:17520980-17521002 TTTTAAAAAAAAAATCAGATAGG - Intergenic
1093663838 12:21788870-21788892 TTTTAAATAAAAAATTAGCTGGG - Intergenic
1093731403 12:22569395-22569417 TTCTAAATTAGAAATCAGGCTGG + Intergenic
1093886865 12:24471591-24471613 TTCTAAATGTTAAATGAGGATGG + Intergenic
1093912809 12:24766530-24766552 TTTAAAATGAAAAATTAGCCGGG - Intergenic
1093925412 12:24903875-24903897 TATTAATTTAAAAACCAGGAAGG - Intronic
1094188352 12:27669515-27669537 TTTTTAAAGAAAAGCCAGGAGGG + Intronic
1094231910 12:28115308-28115330 ATTTAAAAGACAAATCAGGAAGG - Intergenic
1094518068 12:31154029-31154051 TCTCCAAAGAAAAATCAGGAAGG + Intergenic
1094799740 12:34019269-34019291 TTTTAAAAGAAAAATGAAGAGGG - Intergenic
1095112529 12:38313588-38313610 TTTTAAAAGAAAAATGAAGAGGG - Intergenic
1095125926 12:38477185-38477207 TTTTATTTGAAAAGTCATGATGG - Intergenic
1095203691 12:39415178-39415200 AGTTAAATTCAAAATCAGGACGG + Intronic
1096306019 12:50476514-50476536 TGTTAAATGAAATATTAGTAAGG - Exonic
1096327298 12:50675615-50675637 TCTTAGATGAAAATTAAGGAGGG + Intronic
1096757407 12:53811505-53811527 TTTGAAATGAAAAATCCCTATGG - Intergenic
1097444612 12:59654009-59654031 TTTTAAATAAAGAATCAGCAGGG + Intronic
1097633843 12:62097752-62097774 TTTTCCATGAAAAATCAGAGTGG - Intronic
1097672581 12:62557888-62557910 TTTTAAGAGAAATATCATGAAGG - Intronic
1097879886 12:64677120-64677142 GTGTAAATGAAGAATGAGGAAGG - Intronic
1098128075 12:67320694-67320716 TTTTAAAAGAGAAATCACCAAGG - Intergenic
1098220957 12:68269435-68269457 TTGTGAATGAAAAATCAAAATGG + Intergenic
1098487411 12:71037476-71037498 TTTTACAAGAAATGTCAGGATGG - Intergenic
1098555412 12:71813053-71813075 TTTTAAATGAGAAAATAGGCTGG - Intergenic
1098687798 12:73447159-73447181 TTTTAATTTAAATATCAGGCAGG - Intergenic
1098826513 12:75304537-75304559 TTACAAATAAAAAATCTGGAGGG + Intronic
1099003060 12:77203783-77203805 TTTTAAAGAAAAAGTTAGGAAGG + Intergenic
1099197220 12:79631831-79631853 TTTTTAAAGAAAAATCAAGTTGG + Intronic
1099310366 12:81012940-81012962 TTTTAAAGGAAAAAAGAAGAGGG - Intronic
1099356289 12:81639263-81639285 TTTTAAAAGAAAAAAAAGCAGGG - Intronic
1099561159 12:84175106-84175128 TTTTAAATGAAAATACATGATGG - Intergenic
1099934106 12:89105083-89105105 ATGTAAATGCAAAATCAAGAAGG + Intergenic
1099966178 12:89448141-89448163 TTTAAAAATAAAAGTCAGGATGG + Intronic
1099984673 12:89649023-89649045 TTTCAAAGGAAATATCAGAAAGG + Intronic
1100519229 12:95357412-95357434 TAATAAATGAAAAATAAGGAAGG - Intergenic
1100546379 12:95606449-95606471 TTTAAAATAAAAAATCAGCCAGG - Intergenic
1101015200 12:100493305-100493327 TTTCAATTGAAAAATTTGGATGG + Intronic
1101319182 12:103658251-103658273 TTTTACCTGAAACAGCAGGAAGG + Intronic
1101390794 12:104298409-104298431 TTTTAAAGGTTAAATCAGTAAGG - Intronic
1101546433 12:105717778-105717800 TTTTAAAGTAAAAATTAGGTTGG - Intergenic
1101684107 12:107000128-107000150 TTTTAAAAGAACACTCAGAATGG + Intronic
1101979479 12:109393215-109393237 TTTAAAATGATAAATCAGGCGGG - Intronic
1102115555 12:110400431-110400453 TTTTAAAGTATAAATCATGAAGG + Intronic
1102133161 12:110549738-110549760 TCTAAAGTGTAAAATCAGGATGG + Intronic
1102299402 12:111760072-111760094 TTTCAAATGAGAAATCTGGCCGG - Intronic
1102369088 12:112366357-112366379 TTTTAAATAAAAAATTAGTAAGG + Intronic
1102378922 12:112446701-112446723 TTTTAAATAAATCAACAGGAAGG - Intronic
1102993686 12:117332566-117332588 ATTTAAAAAAAAAATCAGGCCGG + Intronic
1103109331 12:118261445-118261467 TGTTAAATACAGAATCAGGAAGG + Intronic
1103388338 12:120551601-120551623 ATTTAAAAATAAAATCAGGATGG - Intronic
1104011908 12:124937162-124937184 TTTTAAAAGAAAAATTAGGTTGG - Intergenic
1104567755 12:129900600-129900622 TTTTAAATACAAAGTCAAGAGGG - Intronic
1104832559 12:131763828-131763850 TTTTTAAAGAAAAATGAGGCCGG + Intronic
1105354189 13:19643544-19643566 CTTTAAAAGAAAAATCAGGTCGG - Intronic
1105373457 13:19821131-19821153 TTTTATATCAAAAATTAGAAAGG - Intergenic
1105374846 13:19834272-19834294 TTTTAAAAGAAAAAATAGGCTGG - Intronic
1105380409 13:19881821-19881843 TTCTAAATAAAAAATCAGCTGGG + Intergenic
1105584411 13:21730724-21730746 TTCCAAAAGAAAAATCTGGAAGG + Intergenic
1106268610 13:28132727-28132749 ATATAAATGAAAAATAAGGCCGG + Intergenic
1106608901 13:31259313-31259335 TTTTATGTGAAAAATTAAGAAGG + Intronic
1106633276 13:31499856-31499878 TTTTTCATCAAAAATCATGAAGG + Intergenic
1106690571 13:32111126-32111148 CTTTATTTGAAAAATCAGCAGGG - Intronic
1106720991 13:32434392-32434414 TATTAAATGAAAAAACTGGCCGG - Intronic
1106787868 13:33124979-33125001 CTCTAAATTAAAAATGAGGAGGG + Intronic
1106843802 13:33715169-33715191 TTTAAAATGGAAATACAGGAAGG + Intergenic
1107320493 13:39181260-39181282 TTACAAATGAAAAAGCAGGTGGG - Intergenic
1107463283 13:40626111-40626133 TTTTAAATAAAAAGTAAGGCTGG - Intronic
1108812036 13:54239463-54239485 TTTTGAAGGTAGAATCAGGAGGG - Intergenic
1108823005 13:54376717-54376739 TTTGAAATAAAAAATCAGGCTGG + Intergenic
1108907365 13:55494857-55494879 ATTTATATGAAAATTCAGAATGG - Intergenic
1109093196 13:58074188-58074210 TTTTTTAAGAAAAATTAGGAAGG - Intergenic
1109248650 13:59990107-59990129 TTTTTAATAAAATATCAGAAAGG + Intronic
1109269125 13:60234780-60234802 TTTTAAAGGTAAAATGAGGAGGG - Intergenic
1109683359 13:65782867-65782889 TTTTAGATGAAAAAGCCTGATGG - Intergenic
1109877537 13:68426147-68426169 TTATATATGACAAATAAGGAAGG + Intergenic
1110005492 13:70261491-70261513 TTTTAAATTAAAAATATGTAAGG + Intergenic
1110024285 13:70514406-70514428 TGTAAAATGAAAAACCAAGATGG + Intergenic
1110036732 13:70696714-70696736 TTTTAATTAAAAAAGCAGCATGG - Intergenic
1110282344 13:73709544-73709566 TTATAAATCAGAAGTCAGGATGG + Intronic
1110442381 13:75539618-75539640 GTTTCAATGAGTAATCAGGATGG + Intronic
1110499557 13:76210886-76210908 GTTTAAATGGAGAAACAGGAAGG - Intergenic
1110578531 13:77090495-77090517 TTTTAAATGAAAAAGAAGAAAGG + Intronic
1110709236 13:78631799-78631821 TTTTAAGTTAAAATTGAGGAAGG + Intronic
1110950954 13:81490019-81490041 TTTCAAATGATAACTCAGAATGG + Intergenic
1111118543 13:83815081-83815103 TTTTAAAGGTAAAATGAAGAGGG - Intergenic
1111161883 13:84405623-84405645 TTTAAAATGAAAAATTAGTTAGG - Intergenic
1111501067 13:89120416-89120438 TTTTAAAGGAAAATTTATGAGGG + Intergenic
1111643519 13:91001106-91001128 TTTTAATTGAAACACCAGAAAGG + Intergenic
1111703174 13:91716078-91716100 TTTAAAAAAAAAAATCAAGATGG - Intronic
1112134171 13:96557477-96557499 CTTTCATTGAAAGATCAGGAAGG - Intronic
1112311742 13:98323611-98323633 TTTTAAAGGAAAATTCTTGAAGG + Intronic
1112673834 13:101674307-101674329 TTTTAAAGGTAAAGTGAGGAGGG - Intronic
1113196070 13:107808033-107808055 CTTTAAGAGAAAAATGAGGAGGG + Intronic
1114785073 14:25587252-25587274 TTTTAATTATAAAATCAAGAGGG + Intergenic
1115369867 14:32601092-32601114 TTTAACATGAATAATCAGAATGG + Intronic
1115459661 14:33646172-33646194 TAATAAATGGAAAATCAGGATGG - Intronic
1115464546 14:33700474-33700496 TTTTAAATGAAAAGGCAGAGAGG + Intronic
1115619516 14:35127545-35127567 TCTTAAGGGAAAAATCATGAGGG + Exonic
1115621225 14:35142507-35142529 TTTTAATTTAAAAATTAGCAGGG - Intronic
1115638207 14:35311492-35311514 TTTTAAGTGAGAAGTCAAGAGGG - Intronic
1116255975 14:42556115-42556137 TTTTAACTGAACAATAAGTAAGG - Intergenic
1116298185 14:43139792-43139814 TTTCAAGTGAGAAATCATGATGG + Intergenic
1116365817 14:44061398-44061420 TGTTAAATGTAAAATCAGAAAGG + Intergenic
1116484015 14:45425006-45425028 TTTTAAAAAAAAAATCTGGCCGG - Intergenic
1116634231 14:47374612-47374634 TTTGAAATGAAACATCAAAATGG + Intronic
1116662569 14:47730144-47730166 TTATAAAGGAAAAAGAAGGAAGG - Intergenic
1117371363 14:55081189-55081211 TGTTAAATAAAAAATAAGCAGGG - Intergenic
1117386767 14:55222452-55222474 TTTTAAAAGAAGAATAAAGAAGG + Intergenic
1117470119 14:56036149-56036171 TTATAAATGAGAAAGCAAGAAGG + Intergenic
1117928940 14:60817982-60818004 ATTTAACTGAAAACTCAGAAAGG + Intronic
1118189757 14:63569872-63569894 TTTTATATAAAAAATGAAGATGG + Intergenic
1118201519 14:63678485-63678507 TTTTATATGAAAAATCCCAAAGG - Intergenic
1118433347 14:65745455-65745477 CTTAAAATGAAAAAACAGCAGGG + Intergenic
1118577851 14:67261933-67261955 TTTTAAAGGCAAAAAAAGGATGG + Intronic
1119119544 14:72061709-72061731 TTTTATATTAAAAATCTGCATGG + Intronic
1119188023 14:72658345-72658367 ATTTAAATTAAAATTCCGGAAGG + Intronic
1119430222 14:74562583-74562605 CCTTAAAAGAAAAATCAGCAAGG + Intronic
1119463087 14:74827992-74828014 TTATCATTGAAAAATCAGTAAGG - Intronic
1119925351 14:78488486-78488508 TTTTACATTAAAAATCAAAAAGG + Intronic
1120104312 14:80476976-80476998 CATTAAATGTAAAATCATGAAGG - Intronic
1120892248 14:89501556-89501578 TTTTAAAGGAAAAATCCAGAGGG + Intronic
1121367026 14:93322414-93322436 TTTTAAATAAATAAGCAGGCTGG - Intronic
1121647792 14:95532666-95532688 CTTTAAAGGAAAAATGAGGAGGG - Intergenic
1121710383 14:96033838-96033860 TTTTAAATGAAAAAATACCATGG + Intergenic
1121805334 14:96815366-96815388 TTTAAAAAGAGAAAACAGGAAGG + Intronic
1122431327 14:101648723-101648745 TTTTAATTGACAAATAATGATGG + Intergenic
1123217592 14:106826261-106826283 TTTTAAAGAAAAAATGAGGAGGG + Intergenic
1202845359 14_GL000009v2_random:167515-167537 TACTAAATGAAATATCTGGAAGG + Intergenic
1202914761 14_GL000194v1_random:157781-157803 TACTAAATGAAATATCTGGAAGG + Intergenic
1202875428 14_GL000225v1_random:203714-203736 TACTAAATGAAATATCTGGAAGG - Intergenic
1202877906 14_KI270722v1_random:24934-24956 TACTAAATGAAATATCTGGAAGG - Intergenic
1202889098 14_KI270722v1_random:138569-138591 TTTAAAATGTAAATTCAGGCGGG + Intergenic
1123390829 15:19870366-19870388 TTTTAAATGAACAATTCAGAAGG - Intergenic
1123785503 15:23667369-23667391 TTTTAAAAGAAAACACAGGGGGG - Intergenic
1124701947 15:31922456-31922478 TTTTAGAAAAAAAAGCAGGAGGG - Intergenic
1124917628 15:33992088-33992110 TTTTAAAAAGAAAATCAGGCCGG + Intronic
1125016738 15:34945786-34945808 TTTTAAATGAAAAAAAGGAATGG - Intronic
1125047760 15:35262223-35262245 TTTTAAATGGGAAATCTGGAAGG - Intronic
1125068318 15:35519536-35519558 TTCTAAATGAAAACTCAGAATGG + Intronic
1125183162 15:36900752-36900774 TCTTTAAAGAAAAATCATGATGG - Intronic
1125281205 15:38044292-38044314 TTTTTAAAGAAAAAGAAGGAAGG + Intergenic
1125291497 15:38153184-38153206 CTTTAAAAGAAAAATAAGGAGGG + Intergenic
1125849962 15:42893521-42893543 TTTTAAATTGAAAATAAGCACGG + Intronic
1126073937 15:44890335-44890357 TTTTAAATAAAAAATAGTGATGG - Intergenic
1126084253 15:44996518-44996540 TTTTAAATAAAAAATAGAGATGG + Intergenic
1126123696 15:45276048-45276070 TTTCAAATGAAAGTTCAGGCAGG - Exonic
1126796070 15:52261379-52261401 GTTAAAATGAAAAATCAGCGTGG - Intronic
1127038155 15:54942705-54942727 TTTAAAAGGAAAAAGCAGGCTGG - Intergenic
1127099424 15:55550189-55550211 TTTGCAAGGAAAAAACAGGATGG - Intronic
1128295821 15:66518514-66518536 TTTTAAAAGAAAATTCTGGCTGG + Intronic
1128491707 15:68153117-68153139 TTTTAAATGACAAATGAGATGGG - Intronic
1128601678 15:69000300-69000322 TTTTAAGTAGAAAAGCAGGAAGG - Intronic
1128642113 15:69347158-69347180 TTTTAAATGCAAAATAACCACGG + Intronic
1128710246 15:69866336-69866358 ATTTAAAAAAAAAATCAGCAGGG - Intergenic
1128846146 15:70897357-70897379 TTTTAAATGAAAAACCAATTAGG - Intronic
1129091725 15:73157897-73157919 TTTTAAAAGAACAATGAGAAGGG - Intronic
1129132692 15:73514809-73514831 TTTAAAAGGAGAAAACAGGAAGG + Intronic
1129437183 15:75550959-75550981 TTTTAAAGGAAAAGCCTGGAAGG + Intronic
1129618449 15:77120190-77120212 TTGTCAATGAAAAACTAGGATGG - Intronic
1130003116 15:80065227-80065249 TTTTTAAGGAAAAATAAGGGAGG - Intronic
1130166684 15:81468331-81468353 TTTGAAATGAAATATCACTATGG - Intergenic
1130277852 15:82491835-82491857 TCTTAAATTAAAAGGCAGGAAGG + Intergenic
1130302914 15:82693620-82693642 TTTTAAATACAAAAGAAGGAAGG + Intronic
1130470181 15:84219020-84219042 TCTTAAATTAAAAGGCAGGAAGG + Intergenic
1130477669 15:84333587-84333609 TCTTAAATTAAAAGGCAGGAAGG + Intergenic
1130494096 15:84454543-84454565 TCTTAAATTAAAAGGCAGGAAGG - Intergenic
1130513090 15:84605233-84605255 TTTACAATGGAAAACCAGGAGGG - Intronic
1130573894 15:85073569-85073591 TTTTAGAAGAAAAATCAAGATGG - Intronic
1130592470 15:85223648-85223670 TCTTAAATTAAAAGGCAGGAAGG + Intergenic
1131238932 15:90721617-90721639 TTTTAAAAGAAAAATTAGGCTGG - Intronic
1131477533 15:92753028-92753050 TTTTAAATGAAGAATCTTGCTGG + Intronic
1133523843 16:6584663-6584685 TTTTAAAAGAAAACACAGGCCGG - Intronic
1133536325 16:6705696-6705718 TTATAAATGAGAAATAAAGAGGG + Intronic
1133611517 16:7438158-7438180 TTATATAAGAAAAATCAGAATGG + Intronic
1133618736 16:7505616-7505638 CTCCAAATGGAAAATCAGGATGG + Intronic
1133956219 16:10446362-10446384 TCTTAAATCAAAAGGCAGGAAGG - Intronic
1134284897 16:12852440-12852462 TTTTAAATGTAAAAAAAGAATGG + Intergenic
1134894748 16:17874861-17874883 TTGGAAATTAAAAATCAGAAAGG - Intergenic
1135233605 16:20733903-20733925 TTTTAAAAGAAAAAACAAAAGGG + Exonic
1135695950 16:24586532-24586554 TTTGAAATGAAAAGTCACAAAGG - Intergenic
1137703897 16:50520410-50520432 ATTTAAATTAAAAATCATCATGG + Intergenic
1138213572 16:55183269-55183291 TTATGAATTAAAAATCAGTATGG + Intergenic
1138385179 16:56631854-56631876 CTTTAAATTAAAAAGCAAGATGG - Intergenic
1138385759 16:56634945-56634967 CTTTAAATTAAAAAGCAAGATGG - Intergenic
1138850711 16:60626618-60626640 TTTTAAAGGAAAACTTAGTATGG + Intergenic
1138962705 16:62046306-62046328 TCTCAAAGGAAAAATCTGGATGG + Intergenic
1139038279 16:62974253-62974275 TTTTAAATAAAAAATAAATATGG - Intergenic
1139991723 16:70945047-70945069 TTTAAAAATAAAAATCAGGCTGG - Intronic
1140119209 16:72068809-72068831 TTTTAAATAAAAAAGCAGGAAGG + Intronic
1140668028 16:77245614-77245636 TTTTGAAAGATAAAGCAGGAAGG + Intergenic
1141249882 16:82345705-82345727 TTTTAAATAAAAAATAATGTTGG + Intergenic
1141258425 16:82426684-82426706 TTTTCTATGAAAAATGAGAAAGG + Intergenic
1141493666 16:84391908-84391930 TTTTAAAAAAAAAAAGAGGAAGG - Intronic
1141739581 16:85882028-85882050 TTTGATAGGAAAGATCAGGAAGG - Intergenic
1141787019 16:86207855-86207877 TTATAAAGGAAAATGCAGGAAGG - Intergenic
1143115161 17:4577833-4577855 TCTAAAAAAAAAAATCAGGATGG - Intergenic
1143232418 17:5368051-5368073 GTTTAAAAAAAAAATCAGGCTGG - Intronic
1143236910 17:5410280-5410302 TTTTAAATATAAAAACAGCATGG - Intronic
1143277681 17:5723948-5723970 TTTTAAAAGCAAAAGCAGAAAGG + Intergenic
1143277682 17:5723972-5723994 TTTTAAAAGCAAAAGCAGAAAGG + Intergenic
1143384387 17:6518993-6519015 TTTAAAAGGAAAAATAAGAAAGG + Intronic
1143786585 17:9260321-9260343 TCTTAAAAGAAAAGTCAAGAAGG + Intronic
1144079601 17:11751352-11751374 TTCTAAATAAAATATCAGTAAGG + Intronic
1144394697 17:14832845-14832867 CTTTAAAAGAAAAAGCAGGCCGG - Intergenic
1144789667 17:17850399-17850421 TTTTACATCAAAAATCAGGAAGG + Intronic
1144820593 17:18070744-18070766 TTTTGGAAGAAAAATCTGGAGGG - Intergenic
1145186928 17:20802983-20803005 TTTTAATTTAAAAATCAGTATGG + Intergenic
1145726750 17:27134764-27134786 GTTTAAAATAAAAATCATGAAGG + Intergenic
1146004126 17:29150034-29150056 ATTTAAATAAAATATCAGTAAGG + Intronic
1146118681 17:30168342-30168364 TTTTAAATGGAAATCCAGAAAGG - Intronic
1146640646 17:34538451-34538473 TTTTAAATAAAAAATAAGGCCGG + Intergenic
1147592117 17:41690335-41690357 TTTTATAGGAAAAAGCAGAAGGG + Intronic
1147843244 17:43387572-43387594 TTTTAAAAGAAAAATCTGCCGGG + Intergenic
1147957754 17:44146344-44146366 TGTAAAAGCAAAAATCAGGACGG - Intronic
1148283284 17:46365685-46365707 TTTAAAATGGAAAAGCAGGCTGG + Intergenic
1148305502 17:46583606-46583628 TTTAAAATGGAAAAGCAGGCTGG + Intergenic
1148635007 17:49142245-49142267 TCTTAAGAGAAAAAGCAGGAAGG + Intronic
1149067890 17:52502081-52502103 TTATAAATGAAAAATCAGATAGG + Intergenic
1149315050 17:55431161-55431183 TTTTAAAGGGAAAATAAGGGAGG - Intergenic
1149520106 17:57312331-57312353 TTGAAAAAGAAAAATTAGGAAGG - Intronic
1149586228 17:57789302-57789324 TTTAAAATGGAAAATAAGTATGG + Intergenic
1149900018 17:60467263-60467285 ATTTAAAAGAAAAACAAGGATGG + Intronic
1149970002 17:61208135-61208157 TTTCAAATCTAAATTCAGGATGG + Intronic
1151269723 17:72984818-72984840 TGTTAAATGAATAAGGAGGAAGG + Intronic
1152546551 17:81003154-81003176 TTTTAAATGATCATACAGGACGG + Intronic
1153020105 18:621178-621200 TTTTAAATTAAAAATCTGACTGG - Intronic
1153302610 18:3604517-3604539 CCTTAAGTGAAAAATAAGGAGGG - Intronic
1153741687 18:8136731-8136753 ATTTAAATGAAAAATCTAGGAGG + Intronic
1153853731 18:9123789-9123811 TTGTAAAAGAAAAATGAGGCAGG - Intronic
1153860737 18:9202484-9202506 TTTATAATGAAATATCAGGAAGG - Intronic
1153914866 18:9736130-9736152 TTTTTAATGAAAAATTAGCCAGG - Intronic
1153922080 18:9800781-9800803 TTTTAAATAAAAAAAAAGGGGGG - Intronic
1154040822 18:10854060-10854082 CTTTAAAAAAAAAATCAGCATGG - Intronic
1154153223 18:11923798-11923820 TTTTAAATAAAACATCTGAAAGG + Intergenic
1154195312 18:12261502-12261524 TTTTAAACCAAAAAGCATGAAGG - Intronic
1154243333 18:12672442-12672464 TTTTAAAACAAAAATCAGTATGG + Intronic
1154353025 18:13602742-13602764 TTTTAAATAAAAAATTAGGCCGG - Intronic
1154361595 18:13667420-13667442 TTCTAAGTCAAAAATCAGGTTGG + Intronic
1154510175 18:15090963-15090985 TTTTAGAGGAAAAAGCAGAAGGG + Intergenic
1155063576 18:22249699-22249721 TTTAAAATGAAAAAGAAGGCCGG - Intergenic
1155958836 18:31976984-31977006 TTTTAAACCAGAAAGCAGGATGG - Intergenic
1156049730 18:32917961-32917983 TTCTAAATGAATACTCAGGGAGG - Intergenic
1156217188 18:35011603-35011625 GTGTAAAGGAAAGATCAGGAAGG + Intronic
1156469196 18:37366929-37366951 TCTTAAATGAGAAACCAAGAAGG - Intronic
1156563532 18:38157175-38157197 TTTTTAATGAAGAAACAGAAAGG + Intergenic
1156619895 18:38838137-38838159 TTTTCAATGATAAATCAAGCAGG + Intergenic
1156622235 18:38866255-38866277 GTTTAATTGAAAATACAGGATGG + Intergenic
1156964273 18:43071764-43071786 TTTTAAATACAAAATAAAGAAGG - Intronic
1157147774 18:45182934-45182956 TTTTTAAATAAAAATCATGAGGG + Intergenic
1157541300 18:48512113-48512135 TTTTAAAAGAAATATGAGGCTGG + Intergenic
1157541543 18:48514423-48514445 TTTTAAAAGAAATATGAGGCTGG + Intergenic
1157676213 18:49570532-49570554 TTTTAAAACAAAACTCAGGCTGG + Intronic
1157785572 18:50479049-50479071 TTTTAAAGGTAAAATGAGGAAGG + Intergenic
1157791412 18:50534849-50534871 TTTTCAACAAAAAATCATGAAGG - Intergenic
1158550748 18:58433731-58433753 TGTTAAAAAAAAAATCAGGCCGG - Intergenic
1158622185 18:59042480-59042502 TTTTCAAAGGAAAATCTGGAAGG + Intergenic
1158861715 18:61598828-61598850 TTTTAAATGAGATTTCAGGGAGG - Intergenic
1159067916 18:63590203-63590225 TTTTAAATACAACATCAGCACGG - Intronic
1159102514 18:63971464-63971486 TTTTAAATGAGGAGTCAGGCTGG - Intronic
1159245883 18:65804601-65804623 CTTTAATTTAAAAATAAGGAGGG + Intronic
1159730472 18:72020621-72020643 TTTTAAATTAAAAATACGTATGG + Intergenic
1159745632 18:72231163-72231185 TATTAAATAAAAAATTAGGAAGG - Intergenic
1159800537 18:72894034-72894056 TTTTAAATGTGAAAATAGGAAGG - Intergenic
1159848727 18:73499951-73499973 TATTAACTGAAAGATCAAGAAGG - Intergenic
1159987568 18:74861771-74861793 TTTTAAATGAAAAACATGAAAGG - Intronic
1160354440 18:78215175-78215197 TTTAAAATAAAAAATAAGAAAGG + Intergenic
1161569331 19:5021928-5021950 TCTTAAATTAAAAATCTGGCTGG - Intronic
1162214669 19:9123601-9123623 TTTTAATGGAAAAATGAGGAAGG + Intergenic
1163013925 19:14442201-14442223 TTTTAAATTAAAAAACAGGCTGG - Intronic
1163889301 19:19996839-19996861 TTTAAAATGAGAAATTGGGATGG - Intergenic
1164760573 19:30725563-30725585 TGTTAAACTAAAATTCAGGAAGG - Intergenic
1165581507 19:36868903-36868925 TTTGAAATGAAAAGCCAGGCGGG - Intronic
1165619217 19:37230484-37230506 TTTTAAACTAAATGTCAGGAAGG - Intronic
1165683214 19:37795591-37795613 TTTTAAATTAAAAATAAGAAAGG - Intronic
1166056104 19:40289938-40289960 TTTTAAATAAAAAATAAAAATGG - Intergenic
1167009993 19:46801087-46801109 TCTTAAATAAACAATCAGGGAGG - Intergenic
1168435529 19:56314349-56314371 TTTCCAATCAAAAATCGGGAGGG + Intronic
1168577386 19:57524522-57524544 TTTAAAGTGAACAATCAGGTAGG - Intergenic
1202664493 1_KI270708v1_random:105343-105365 TTTAAAATGTAAATTCAGGCGGG + Intergenic
1202672770 1_KI270710v1_random:7995-8017 TACTAAATGAAATATCTGGAAGG + Intergenic
925007790 2:458038-458060 TTTTAAATGACAAATCGGTCAGG - Intergenic
925632686 2:5911686-5911708 ATTGAAAGGAAAAATCAGAAAGG - Intergenic
926347250 2:11958742-11958764 ACTTATATGAAAAATGAGGAGGG + Intergenic
927300900 2:21513075-21513097 TTCAAAAAGAAAAATGAGGAGGG - Intergenic
927334060 2:21900005-21900027 TTTTAAATGAACAAAAAGCAAGG + Intergenic
927396018 2:22652147-22652169 TTTTAAGTAAAGGATCAGGAGGG + Intergenic
927795262 2:26042483-26042505 TTTTAAATAAAAAATTAGCTGGG + Intronic
928160045 2:28914632-28914654 TTTAAAAGTAAAAATCAGGCCGG + Intronic
928307655 2:30183668-30183690 TATAAAATGAAAAATTAGGCTGG - Intergenic
928409791 2:31046116-31046138 TTTTATATGTAAAATGTGGATGG - Intronic
928612465 2:33004001-33004023 TTTTCAAGGAAAAATAAGGATGG - Intronic
928665030 2:33542371-33542393 TTTTAAATGAAGAGTAATGAGGG - Intronic
928971381 2:37033361-37033383 ACTTAAATGAAAAATCCAGAAGG + Intronic
929054425 2:37863487-37863509 TTTAAAACAAAAAATCAGAAGGG - Intergenic
929130285 2:38561165-38561187 TTTTAATTTATAAATGAGGAAGG - Intergenic
929510177 2:42560302-42560324 TTTTAAAAAAAAAATCAGCCGGG - Intronic
929696375 2:44119783-44119805 TCATAAAAGAAACATCAGGAGGG + Intergenic
929945931 2:46371774-46371796 TTTTACATCTAAAGTCAGGAAGG - Intronic
930342770 2:50138150-50138172 TTGTAAATGAAATATGTGGAAGG - Intronic
930398944 2:50858723-50858745 TTTTAAATGAAAAATCAGGAGGG + Intronic
930825659 2:55694247-55694269 TTTTAAAATAAAAACCAGGGCGG - Intergenic
931120079 2:59206807-59206829 TATGAAATTAAAATTCAGGAAGG + Intergenic
931129407 2:59317045-59317067 TTTTAAAAGTTAAATCATGATGG + Intergenic
931310164 2:61071235-61071257 TTTTAAATAAAAAATTGAGAAGG - Intronic
931384392 2:61784410-61784432 TTTTAAATGAAAAGTATGTATGG + Intergenic
931484478 2:62676439-62676461 TTTTAAATGTAAATTCTGAAAGG - Intronic
931571060 2:63669654-63669676 CTTTAAATTAAAAATTAGGCTGG - Intronic
931824191 2:65982607-65982629 TTAAAAAGGAAAAATCAAGAAGG - Intergenic
931848227 2:66226567-66226589 ATTTAAAAAAAAAATCAGCAAGG - Intergenic
931959290 2:67464370-67464392 TTTCAAATGCAAAGTCAGTATGG - Intergenic
932134924 2:69219906-69219928 TGTTCAAAAAAAAATCAGGAAGG - Intronic
932168538 2:69531866-69531888 CTTTAAGTGAAGAATGAGGAGGG - Intronic
932987082 2:76738977-76738999 TTTTAAATAGAAAATGAGGCTGG - Intergenic
933765181 2:85703158-85703180 GATTAAAGGAAAAATCAAGAGGG - Intergenic
934030122 2:88037456-88037478 TTTTAAAAAAAAAATAAAGATGG - Intronic
934956008 2:98620045-98620067 TTTCAAAGGAACAAACAGGAAGG - Exonic
935510045 2:103960084-103960106 TTTTAAATGAAAGATTAAAAAGG - Intergenic
936086428 2:109472595-109472617 TTTTAAATGAAACAGATGGATGG - Intronic
936661694 2:114550112-114550134 ATTTAAATGAAAAATGAGGGAGG - Intronic
936681186 2:114773371-114773393 TTTTAAATGAACACTCATCACGG + Intronic
936681188 2:114773434-114773456 TTTTAAATGAACACTCATCACGG + Intronic
936692524 2:114908391-114908413 TATTAAATGAAAAAATAGTATGG - Intronic
936708523 2:115103703-115103725 TTTTCCATGAAGAATCAGAAAGG + Intronic
936766985 2:115863368-115863390 TTTTGAATGAAAAATCAAGTTGG - Intergenic
937007407 2:118529902-118529924 TTTTAAATGAAAAAAAAAAAAGG + Intergenic
937102881 2:119285309-119285331 TGTTACAGGAAAAATAAGGAAGG - Intergenic
937487771 2:122333849-122333871 TTTTACATGCAAACTCAGGAAGG - Intergenic
937546439 2:123027600-123027622 TTTGAAAGGAGAAATCAGGCAGG + Intergenic
937782149 2:125850811-125850833 ATTTAAATGTAAAAACAGGAAGG - Intergenic
937821025 2:126311214-126311236 TTTTGAATGAAAATTTCGGAAGG - Intergenic
938505397 2:131875401-131875423 TTTTAGAGGAAAAAGCAGAAAGG + Intergenic
939185406 2:138854919-138854941 TTTTAAATAAAAAATTAGCTGGG - Intergenic
939248496 2:139656260-139656282 TTTCAATTGGAAAAACAGGAGGG - Intergenic
939381132 2:141437904-141437926 TTTTAAATGCAAACTCATTAAGG - Intronic
939446533 2:142316811-142316833 TTTGAAATAAAAAAACAGAAAGG + Intergenic
939949612 2:148453965-148453987 TTTTAAATGAGTTATCAAGATGG + Intronic
940238371 2:151535568-151535590 GTTAAAATGAAAACTTAGGATGG + Intronic
940256633 2:151737880-151737902 CTATGAATGAAAAATCAGGAAGG - Intergenic
940534279 2:154919151-154919173 TATTAAATAAACAATCAAGAAGG - Intergenic
941085686 2:161114956-161114978 TTTGAAAAACAAAATCAGGAAGG - Intergenic
941089041 2:161153386-161153408 ATTTAAATTAAAAATCAGGCTGG + Intronic
941352165 2:164450156-164450178 TTTTGACTGAATAATAAGGAAGG - Intergenic
941798353 2:169626712-169626734 TTTTATTTGTTAAATCAGGACGG + Intronic
942627997 2:177924132-177924154 TTTTAAAGGAAAAATAAAAAAGG - Intronic
942668003 2:178342708-178342730 TTTTAAATGAAGTAAGAGGAAGG + Intronic
942899976 2:181103732-181103754 CTTTAAATGGAAAATTTGGAGGG + Intergenic
943278512 2:185899830-185899852 TTTTATATGGAAAAAAAGGAAGG - Intergenic
943405650 2:187480434-187480456 TTTCCAATGTAAAATGAGGATGG - Intronic
943593813 2:189831237-189831259 TTTTAAATGAGAAAATTGGAAGG + Intronic
943642829 2:190378038-190378060 TTTTAAGTGAAAAACCTGGCTGG - Intergenic
943939590 2:193974807-193974829 TATTAAAAAAAAAATCAGGATGG - Intergenic
944119807 2:196228821-196228843 TTTTAAATGATAAAACACAAAGG + Intronic
944183629 2:196924997-196925019 TATTAAACCAAAAATAAGGAGGG + Intronic
944689099 2:202143380-202143402 TTTAAAATGTTAAATCAGGCTGG - Intronic
945028936 2:205645649-205645671 TTTTTAAAGAAAAGTCAGGAAGG + Intergenic
945767959 2:214003404-214003426 TCTTATGTGAACAATCAGGAAGG + Intronic
945814979 2:214593701-214593723 TTTTAAAAGGAGAATGAGGAAGG + Intergenic
946550703 2:220798998-220799020 TTTTAAGTGAAAGATCATCATGG + Intergenic
946909527 2:224445743-224445765 TTAAAAATTAAAAATCAGGCTGG - Intergenic
946992526 2:225351381-225351403 ATTTAAAGGAAAAATCAATAAGG + Intergenic
947296066 2:228631956-228631978 TTTTCATTAGAAAATCAGGAAGG + Intergenic
947632096 2:231660576-231660598 TTTAAAAAGAGAAATAAGGATGG + Intergenic
948555158 2:238804472-238804494 TTTGAAAGGAAAAATCAGGCGGG + Intergenic
1168846436 20:947749-947771 TTTCAACTGACCAATCAGGATGG + Intergenic
1168989362 20:2081010-2081032 TTTTCAGTGAAAAATCTGGCTGG - Intergenic
1169325881 20:4676124-4676146 TTTTAGAGGAAAAATAAGGAGGG - Intergenic
1169518667 20:6347130-6347152 TTTTAATACAAAAATCAGGGAGG - Intergenic
1169727900 20:8755815-8755837 TTGTAAAGGATAAATGAGGAGGG + Intronic
1169898326 20:10527889-10527911 TCCCAAATGAAAAAGCAGGATGG - Intronic
1169977867 20:11350923-11350945 TATAAAATGAAAAATCAGAATGG + Intergenic
1170034925 20:11980193-11980215 TTTAAAAGGAAAATACAGGAGGG + Intergenic
1170040159 20:12031948-12031970 TATAAAACGAAAACTCAGGAAGG - Intergenic
1170343747 20:15359085-15359107 TTCTAAGTGAAAAATCAGGTCGG - Intronic
1172176288 20:32974027-32974049 TTTTAAAAGAAAAAACAGTGTGG - Intergenic
1172946003 20:38690005-38690027 TTTTAAAGTAAAAATAAAGATGG - Intergenic
1173344140 20:42183275-42183297 TTTTAAGTGCAACATAAGGAAGG + Intronic
1173359689 20:42331321-42331343 TTTTAAAAGAGTAATCAGTAGGG + Intronic
1173553905 20:43952055-43952077 TTTTAAAAAAAAAATCAGCCGGG - Intronic
1173714148 20:45187682-45187704 TTTAAAATGAGAATACAGGAGGG + Intergenic
1173984572 20:47251027-47251049 TTTTGAAGGAAAAAAAAGGAGGG + Intronic
1174013049 20:47466091-47466113 TTTTAAATGAGAATTCTGGTTGG - Intergenic
1174461201 20:50684244-50684266 TTTTAAATGGAGAGTCAGGATGG + Intronic
1174501219 20:50986126-50986148 TTTTAAAAGAAAAAAGAGGCGGG - Intergenic
1174683823 20:52434413-52434435 TTTCAAATAAAAAGTGAGGATGG - Intergenic
1175426270 20:58869222-58869244 TCTCAATTGAAAAAACAGGAGGG + Intronic
1175527177 20:59643204-59643226 TTTTAAAAGAAGAATTAGGCCGG - Intronic
1176634113 21:9172426-9172448 TACTAAATGAAATATCTGGAAGG + Intergenic
1176639197 21:9282395-9282417 TACTAAATGAAATATCTGGAAGG - Intergenic
1177009544 21:15715407-15715429 TATTAAATGAAAATACAGCAAGG + Intergenic
1177066031 21:16437382-16437404 TTTTAAATGAAACACCAGACAGG - Intergenic
1177090556 21:16762138-16762160 TTTTAAAAAAGAAATCAAGAAGG + Intergenic
1177162134 21:17559338-17559360 TTTTAAAAAAAAAATTAGCAGGG - Intronic
1177227860 21:18280725-18280747 TTTTACATGAAAAATAGAGAGGG + Intronic
1177622763 21:23618102-23618124 TTTTTAATGAAAGATAAAGATGG + Intergenic
1177733699 21:25061809-25061831 TTTTAGGTGAAAAATCAATACGG + Intergenic
1177794054 21:25754498-25754520 TTGTAAATTAAAAATCAGATAGG - Intronic
1178436615 21:32565427-32565449 CTTTAAATAAAAAATCAAGAAGG - Intergenic
1178880413 21:36445784-36445806 TTTTAAATGAAAGAAGAAGATGG + Intergenic
1179453819 21:41484612-41484634 TTTTATATGAATAATCAATATGG + Intronic
1179527231 21:41989016-41989038 GTTTACATGAAACATCAGGATGG - Exonic
1180331224 22:11482256-11482278 TTTAAAATGTAAATTCAGGCGGG + Intergenic
1180372503 22:12055226-12055248 TACTAAATGAAATATCTGGAAGG - Intergenic
1180389972 22:12220437-12220459 TACTAAATGAAATATCTGGAAGG + Intergenic
1180415964 22:12714043-12714065 TACTAAATGAAATATCTGGAAGG - Intergenic
1180423243 22:12889884-12889906 TACTAAATGAAATATCTGGAAGG - Intergenic
1180638507 22:17279557-17279579 TTTTAAAGGAAAGATGGGGATGG + Intergenic
1180668813 22:17536708-17536730 TTTTAAGTAAAAGATCAGAATGG + Intronic
1180671872 22:17560033-17560055 TTTAAAGTGAAAAATCAGGCTGG + Intergenic
1180744316 22:18077353-18077375 TTTTAACAGCAAATTCAGGATGG + Intergenic
1180886026 22:19244477-19244499 TTTTAACAGAAAAATGAGCATGG + Intronic
1181389956 22:22573194-22573216 TTTGAAATAAAACTTCAGGAGGG - Intergenic
1182879062 22:33717795-33717817 TTTGAAATGAGATTTCAGGATGG - Intronic
1182909562 22:33970777-33970799 TTTTAAATGAAAATTATGGGAGG + Intergenic
1183398128 22:37585002-37585024 TTTTAAATTAAAATTAAGGCTGG - Intergenic
1183643590 22:39108617-39108639 TTTTAAAACAAAATTAAGGACGG + Intergenic
1184064634 22:42110825-42110847 TTTTAAATAAAAAAGCAGGAAGG - Intergenic
949100475 3:138275-138297 TTTTAAAGGTAAAATGATGAGGG + Intergenic
949667183 3:6353159-6353181 TTTTAAATAAAAATTCAGGCTGG - Intergenic
950615582 3:14155291-14155313 TAATAAATGAGAAAACAGGAAGG - Intronic
951151325 3:19293393-19293415 TTTTAAATAACAAATGAGAATGG - Intronic
951304200 3:21038330-21038352 TTTTAAATGTAAATTCAGAAAGG + Intergenic
951712937 3:25603537-25603559 TTTTAAAAAAACAATCAGGCTGG - Intronic
951825308 3:26861637-26861659 GATAAAATGAAAAATCAGAAAGG + Intergenic
951837564 3:27000101-27000123 TTTCAAATGAAAACTCAGGCGGG - Intergenic
952055832 3:29444498-29444520 TTATAAAGGAACAATCAGTATGG + Intronic
952470647 3:33647657-33647679 TTTTATATACAAAAACAGGAGGG + Intronic
952539368 3:34351316-34351338 ATCTAAATGAAAGATCAGCATGG - Intergenic
955021806 3:55129024-55129046 TTTTAAAAGAAAAAACAGGCTGG + Intergenic
955574208 3:60341589-60341611 TATTAAAAAAAAAATCAAGAGGG - Intronic
955894222 3:63682139-63682161 TTTGAAATGAAAAGTAGGGATGG + Intergenic
955898700 3:63728214-63728236 TTTTAATTAAAAAATCAACATGG - Intergenic
956198714 3:66682267-66682289 TTTGAAATGAAAGAAAAGGAAGG - Intergenic
957101004 3:75828446-75828468 TACTAAATGAAATATCTGGAAGG + Intergenic
957460115 3:80506063-80506085 TTTTAAACAAAAAATTAGGCAGG + Intergenic
957665676 3:83222615-83222637 TTTAAAATTAGAAATCAGAAAGG + Intergenic
959237095 3:103738279-103738301 TTTTAAGGGAAGAATCAGGCAGG + Intergenic
959342883 3:105153317-105153339 TTTTTAATGTAATATCAGAAAGG + Intergenic
959394691 3:105822706-105822728 TTTTAAAAGAAAACACAAGATGG - Intronic
959511892 3:107222942-107222964 TTTTATAAGAAAAATCAGAAAGG + Intergenic
959840440 3:110968815-110968837 TTGTAAATCAAAAAGCAGGAAGG - Intergenic
959931380 3:111986787-111986809 TTTTAAATCAAATATCAAAATGG - Intronic
960237154 3:115296985-115297007 TTTTAAAGAAAAAATCAACAGGG + Intergenic
960452651 3:117829464-117829486 TTTTAAAGGAACTAACAGGAAGG - Intergenic
960901476 3:122558429-122558451 CTTACAATGAAAAATCAGGTAGG - Exonic
960910669 3:122645994-122646016 TTTTAAACCAAAAATTTGGAAGG + Intergenic
960964425 3:123094923-123094945 TTTTAAAGGGAAAAGCAGGGTGG - Intronic
961035240 3:123637501-123637523 TTAGAACTGAAAAATCAGGTGGG - Intronic
961421822 3:126812114-126812136 TTTTAAGTGAAAAATCATAGTGG + Intronic
961998746 3:131272860-131272882 TTTTTAATGAAACATCCTGAAGG - Intronic
962146424 3:132844655-132844677 TTTTAACTGAAAAGACTGGATGG - Intergenic
962604323 3:137020091-137020113 TTTTCAGTGAAAAATCAAAATGG - Intergenic
963493162 3:146026723-146026745 TTTTGAAAAAAAAATCTGGAAGG + Intergenic
964206604 3:154181917-154181939 TTTTAAATAAAAAATGATAAAGG - Intronic
964688169 3:159420507-159420529 TTATGAATTAAAAATAAGGAGGG - Intronic
964869066 3:161293175-161293197 TTTTAAGGGAAAAATGAGGAGGG + Intergenic
965169972 3:165250559-165250581 TTTTAAATTATAATTCAGAAAGG - Intergenic
965836250 3:172856397-172856419 TTTTATATGAAAGATGAGGCCGG + Intergenic
966007596 3:175035338-175035360 TTTAAAATGGAAAAACAGTATGG + Intronic
966061959 3:175768517-175768539 TTTTAAAATAAAATTCAGAATGG - Intronic
966167457 3:177036417-177036439 TTTTAAAGCAAAAACTAGGATGG - Intronic
966274203 3:178145103-178145125 TTTTATATGATAAATCACTAGGG - Intergenic
966403146 3:179566985-179567007 TTTTAAGAGAAAATTCAGGCAGG - Intronic
966818655 3:183908502-183908524 TTTTAAAGGAAAAATCAGGTTGG - Intergenic
966837060 3:184057436-184057458 TTTTAAAACAAAAAACAGGCAGG + Intronic
967232303 3:187351432-187351454 TTTAAAAAGAAAAATCATGTGGG + Intergenic
967482115 3:189985029-189985051 TTTTAAAAGAATAATAAGTAAGG + Intronic
967527159 3:190508302-190508324 TTTTAAATGGAGAATGAGGGAGG - Intergenic
967607425 3:191464338-191464360 TTATAAATCAAAAATCAGGCCGG - Intergenic
1202747698 3_GL000221v1_random:122632-122654 TACTAAATGAAATATCTGGAAGG + Intergenic
969833234 4:9815871-9815893 TTTAAAATAAAAAATGAGGCCGG + Intronic
970230199 4:13901946-13901968 TTTTAGCTGAAAAATGAGAATGG + Intergenic
970597172 4:17611092-17611114 TTTTAAAACATAAATCAGGCCGG + Intergenic
971107976 4:23548027-23548049 CATTTAATGAAAATTCAGGAGGG - Intergenic
971615893 4:28790224-28790246 TTTTAAATGATAGATCAAAATGG - Intergenic
971794895 4:31214741-31214763 TTTTACATAAAAAAGCAGCATGG - Intergenic
972076436 4:35094974-35094996 CTTTAAAGGAAATATCAGGCAGG + Intergenic
972392471 4:38626684-38626706 TTTTAAATAAAGAATTAGGCTGG - Intergenic
972426377 4:38937069-38937091 TTTAAAGAGAAAAAACAGGAAGG - Intronic
972637424 4:40896623-40896645 TCTTAACTGAATAATCAAGAAGG + Intronic
972925782 4:44004501-44004523 TATTAAATAAAAAATCAACATGG - Intergenic
973148883 4:46863405-46863427 TTGTAAAAGAAAATTCATGAAGG + Intronic
973225271 4:47776448-47776470 TTTTAAATGAATAATATGGGAGG - Intronic
973268238 4:48232681-48232703 TTTTTAATGGAATTTCAGGAAGG - Intronic
973335633 4:48953147-48953169 TTTTAAATGAAAAAATAAGTAGG - Intergenic
973846764 4:54920773-54920795 TTTTAATTGAGAAATCTGTAGGG + Intergenic
973948375 4:55984670-55984692 TTTTTAATGAATAACAAGGATGG + Intronic
974236809 4:59192234-59192256 AGTTAAATGAAATATCAGGAAGG - Intergenic
974435467 4:61852138-61852160 TTTTAAAAGATAAAAAAGGAAGG + Intronic
975241955 4:72070407-72070429 TTTTAAAGGAAAAATGAGGAGGG + Intronic
975362965 4:73493248-73493270 TTTTAATGGAAGAATGAGGAAGG + Intronic
975430067 4:74278854-74278876 TTTTTAATGAATAATTTGGAAGG - Intronic
975599489 4:76084541-76084563 TTTAAAAACAAAAATCTGGAAGG + Intronic
975631063 4:76402749-76402771 TTTCAAAGGTAAAATCAGCAGGG + Intronic
976553773 4:86426802-86426824 TTTCAAATGAAATATGAGGTAGG - Intronic
976619072 4:87109819-87109841 TTTTAAAAGATAAGGCAGGATGG - Intronic
976780564 4:88754008-88754030 ATTTAAAGGGAAAAACAGGAGGG + Intronic
976891801 4:90057582-90057604 ATTTAAAAGAAAAATCCTGAAGG - Intergenic
976985725 4:91294531-91294553 CCTGAAATGCAAAATCAGGATGG + Intronic
977223382 4:94365444-94365466 TATAAAATGCAAAATCATGAAGG - Intergenic
977609442 4:99017108-99017130 TTTCAAATGAAAAGTCATGCTGG + Intronic
977649745 4:99455419-99455441 TTTGAAAGGAAAAATGAGGCGGG - Intergenic
977824768 4:101517890-101517912 TTTTAAATGAGAGATCTGGCAGG - Intronic
978015809 4:103744656-103744678 TGTTGAATGAAAAAGCAGGTGGG + Intergenic
978109040 4:104939764-104939786 TTTTAAATGTAATATTAGGGTGG - Intergenic
978157834 4:105509787-105509809 TTTTACAGGAAAAATCATAAAGG + Intergenic
978310938 4:107384257-107384279 TTTTAAATCAGAAAGCAGGAAGG + Intergenic
978828909 4:113058718-113058740 ATTTAAAATGAAAATCAGGAAGG + Intronic
978857494 4:113409837-113409859 TTCTAAATGAATAAACAGGTTGG - Intergenic
978878028 4:113665654-113665676 TATTAAATGATAAATAAGGCTGG - Intronic
978978769 4:114915562-114915584 GTGTTAAAGAAAAATCAGGAAGG - Intronic
978981615 4:114954384-114954406 GCTTAAATGTAAAAGCAGGATGG + Intronic
978988530 4:115047626-115047648 TTTTAATTTAATAATGAGGATGG + Intronic
978993355 4:115116011-115116033 TTCTGAATGAAAAATGAGGCAGG - Intergenic
979014019 4:115409017-115409039 TTTTAAATAAAATAAAAGGAGGG - Intergenic
979059380 4:116037576-116037598 TTTTAAAGGAAAAAATAAGAAGG - Intergenic
979544659 4:121926278-121926300 TTTTAAAGGAAAAGTGAGGAGGG - Intronic
979655184 4:123184096-123184118 GTTTAAAAAAAAAATCAGGTCGG - Intronic
979678002 4:123430486-123430508 TTCTTAAAGAAAAATCAAGAGGG - Intergenic
979699080 4:123647098-123647120 TTTTGTATGTAAATTCAGGATGG + Intergenic
979700228 4:123658660-123658682 TCTTAGGTGAAAAATCATGAGGG - Intergenic
979707480 4:123737974-123737996 TTATAAATGAAAATTCTGTAGGG - Intergenic
980475398 4:133307832-133307854 TTTTAAATAAAAAAAGAAGAGGG - Intergenic
980641659 4:135587742-135587764 TTTTAAATGAAAAAAAAGGAGGG - Intergenic
980831075 4:138129762-138129784 TGCTAAATGGAAAAGCAGGAGGG + Intergenic
980882024 4:138720639-138720661 TTTTTACTGAAAAAACACGAGGG + Intergenic
981213389 4:142135448-142135470 ATTTATTTGAAAAATCAGAAGGG + Intronic
981435564 4:144717271-144717293 TTTTAACTATAAAGTCAGGATGG + Intronic
981629493 4:146802017-146802039 TTTTAAAGCGAAAATCAGGATGG + Intronic
981781163 4:148431227-148431249 TTTTAAAGTAAAAATGAGGAGGG - Intronic
982210801 4:153034076-153034098 TTATAAGTGAAAACTCAGCAGGG - Intergenic
982475956 4:155850727-155850749 TTTTAATTGCAAAATGAAGAGGG - Intronic
982540349 4:156661821-156661843 TTTTTAATGTGAAAGCAGGAGGG - Intergenic
982756259 4:159221943-159221965 CTTTAAATGTAAAATAAGGTAGG + Intronic
983107351 4:163704358-163704380 TTGTAAATAAAAAATAAGCAAGG + Intronic
983228275 4:165105665-165105687 TTTTAAAATAAAAATCAACAGGG + Intronic
984046822 4:174811199-174811221 TTTTTAATGAAAAATAAACAGGG + Intronic
984436309 4:179714258-179714280 TTTTAAATCAGAAATAAGAATGG + Intergenic
984779926 4:183515933-183515955 TTTTAAATATAAAATTAGAATGG - Intergenic
1202754094 4_GL000008v2_random:40786-40808 TACTAAATGAAATATCTGGAAGG - Intergenic
986050351 5:4084245-4084267 TTAAAAAAAAAAAATCAGGAGGG - Intergenic
986186444 5:5445708-5445730 TTTTAAATAAAAAATGTGGCTGG - Intronic
986350238 5:6870919-6870941 TTTTAAAAGAAATCTCTGGAGGG + Intergenic
986387291 5:7247243-7247265 ATTTATTTGAGAAATCAGGAGGG - Intergenic
986709165 5:10475389-10475411 TTTTATATAAATAATCAGTAAGG - Intergenic
986877476 5:12129096-12129118 TTTTATATGAAAAGTGAAGAAGG - Intergenic
987154045 5:15070003-15070025 TTGTAAAGGAAAAATGAGGAGGG + Intergenic
987430611 5:17828362-17828384 TGTTAAATGAAAAATCATCATGG - Intergenic
987785409 5:22492641-22492663 TAGAAAATGAAAAATCAGGCTGG - Intronic
987866775 5:23551131-23551153 TTTTAAATCAAAAATCTGTCTGG - Intergenic
988263125 5:28915384-28915406 TTTAAAATGAAAACTCATTAAGG - Intergenic
988921564 5:35947088-35947110 TTTTAAATGAAAAATGAAGAGGG + Intergenic
989797034 5:45487925-45487947 TTTTAAATGATAAAACACAATGG + Intronic
989863704 5:46419848-46419870 TTTTAATTAAAAAAACAAGATGG - Intergenic
990252679 5:53932483-53932505 TTCTAAATGACAAATAAGCAAGG + Intronic
990370335 5:55111519-55111541 TTTTAACTGCAAAAAGAGGATGG + Intergenic
990540256 5:56765359-56765381 TTTTAAAAGAAAATTTAGGCTGG - Intergenic
990808349 5:59692593-59692615 TTTTATATCAAACATCAGTATGG + Intronic
990962812 5:61412731-61412753 TTTTAAATTAATATTCAAGATGG - Intronic
991023561 5:62006427-62006449 TTTAAAAAGAAAAATAAGTAAGG - Intergenic
991315026 5:65292724-65292746 TATTGATTAAAAAATCAGGAGGG - Intronic
991528007 5:67584312-67584334 GTTTATATGAAAAATCAGCCAGG + Intergenic
992062905 5:73074498-73074520 TTTTAAATGGAAAGACAGAATGG - Intronic
992192125 5:74303530-74303552 TTTCAAAGGGAAAGTCAGGAAGG - Intergenic
992475527 5:77098275-77098297 TTTTAAAAAAAAAAAGAGGAAGG - Intergenic
992561227 5:77954896-77954918 GTTTAAAATAAAAATCAGGCTGG + Intergenic
992870674 5:81002402-81002424 TTTTAAACGAATAATGATGAGGG + Intronic
992882335 5:81122908-81122930 TTTTAAATGAACCATTGGGAGGG - Intronic
992904340 5:81331239-81331261 TTTTAAATTAAAAAACAGGCCGG + Intronic
993808651 5:92444887-92444909 TTTTTAATGAAAAATGAAGTTGG - Intergenic
993827730 5:92713017-92713039 TTTTAAGAGAAAAATCTGAATGG + Intergenic
993950935 5:94174314-94174336 TATTAAATGAGAAACAAGGAAGG - Intronic
993962122 5:94311423-94311445 TTTAAAATGAAAATTCAAAAAGG + Intronic
994082070 5:95718155-95718177 TTTTAAAAGAAAAAAAAAGAGGG - Intronic
994099064 5:95875027-95875049 TTTAAAATGAAAAAATAGGTTGG - Intergenic
994158854 5:96532863-96532885 TTTTAATTAAAAAATCAGCCAGG + Intronic
994500428 5:100569965-100569987 TTTAAAATGAGCAATAAGGATGG + Intronic
994626168 5:102221976-102221998 TTCTTTATGAAAAATCAGAAAGG - Intergenic
994773063 5:104008149-104008171 TTTCAAGTGAGAAATCAGAAGGG - Intergenic
995605109 5:113845664-113845686 TTTTACAAGAAAAATCTGGAGGG + Intergenic
995788348 5:115855852-115855874 TTTTAAAAGAATGATGAGGATGG + Intronic
995938700 5:117551333-117551355 GATTAAATGGAAAATCAGGTAGG - Intergenic
996441037 5:123491098-123491120 CATTAAATGAAACATCAGGGTGG - Intergenic
996443977 5:123523087-123523109 TTTTTTATGGAACATCAGGATGG + Intronic
996447436 5:123571970-123571992 TTTTAAAGGAAAAATGAGGAGGG + Intronic
996539736 5:124617348-124617370 TTTTAAGAGAAAAACCAGGTAGG + Intergenic
996543807 5:124656744-124656766 TTTTAAAAAAAAAATCTGAAAGG + Intronic
997084266 5:130778491-130778513 TTTAAAAAGAAAAAGGAGGAAGG + Intergenic
997113563 5:131101489-131101511 TTTCAAAGGCAAAATGAGGAAGG + Intergenic
997301178 5:132806740-132806762 TTTTAAATAAAAACTCAGGCCGG + Intronic
997502625 5:134388819-134388841 CTTTGAATGAAAATTTAGGAGGG + Intronic
998185178 5:139973839-139973861 TTTTAAATGAAACATGGGGCAGG + Intronic
998195140 5:140062474-140062496 TTTAAAACCTAAAATCAGGAGGG + Intergenic
998314516 5:141169448-141169470 TTTAGAATGAAAAATCAAGGTGG + Intergenic
998435498 5:142104788-142104810 TTTTAAAGGCAAAATGAGCAAGG - Intergenic
998742397 5:145219366-145219388 TTTTATATCAAAAATCTGTAGGG - Intergenic
998946238 5:147342378-147342400 CCAGAAATGAAAAATCAGGAAGG + Intronic
999796623 5:154994803-154994825 TCAAAAATGAAAAATCAGGCTGG - Intergenic
999929588 5:156416526-156416548 TTTTAAATGAAAAAAATGGGGGG + Intronic
999981703 5:156963830-156963852 TTTTAAATAAAAAATTGAGATGG - Intergenic
1000080721 5:157843591-157843613 TTTTAAATGAAGAGTGAGAAGGG - Intronic
1000095746 5:157969439-157969461 TTAAAAATGAAAAATTAGCAAGG + Intergenic
1000155194 5:158543936-158543958 CTTTAGATGAAAAATCAGAGAGG - Intergenic
1000230145 5:159308282-159308304 GTTTAAATGCAAAATAAAGAAGG + Intergenic
1000933182 5:167277658-167277680 TTTAAGTGGAAAAATCAGGAAGG - Intergenic
1001504849 5:172270241-172270263 ATTTAAATTAAAAATTAGGCAGG - Intronic
1002029927 5:176420391-176420413 TTTTAAAGGCAAAATGAGGAAGG - Intergenic
1002412638 5:179095518-179095540 TTTTAAATGTGAAATCAGCCAGG - Intergenic
1003015652 6:2465455-2465477 TTTAAAAAAAGAAATCAGGACGG - Intergenic
1003143746 6:3492783-3492805 TTTATAATGAAAGAGCAGGATGG + Intergenic
1003513617 6:6801504-6801526 TTTTAAATGGAAAACCGGGCTGG - Intergenic
1003648409 6:7935469-7935491 TTTCAAATGAAAGAGCAGGCCGG + Intronic
1003776540 6:9371934-9371956 GGTTAAATGAAAAATCAAAATGG + Intergenic
1003835856 6:10071815-10071837 TTTCAAATGAAAAAATAGGTTGG - Intronic
1004158599 6:13193268-13193290 CTTTAAAGGAAAAACAAGGATGG - Intronic
1005756118 6:28926211-28926233 TTTTAAATTAAAAAAAAGGAAGG - Intergenic
1006050168 6:31336070-31336092 TTTTAGATGACAAAGGAGGATGG + Intronic
1006255795 6:32830934-32830956 TTTTAAATGTACAATTTGGACGG + Intronic
1007004425 6:38347067-38347089 TTTAAAAAGAAAGAACAGGAGGG - Intronic
1007057098 6:38897158-38897180 TTAAAAATGAAAAATCAGCCGGG - Intronic
1007103758 6:39269153-39269175 TTTTTAATGAAAAAAGAAGAAGG - Intergenic
1007316657 6:40994662-40994684 TTCCAAATGGAATATCAGGAGGG + Intergenic
1007326680 6:41066970-41066992 TTTTAAGAGAAATTTCAGGAAGG - Exonic
1008660731 6:53664958-53664980 TTTTATATTAAAAATCATGTTGG - Intronic
1008816196 6:55569743-55569765 TTAAAAATAAAAAATAAGGAGGG + Intronic
1008935702 6:56989801-56989823 TGTTAAGTGACAAATCAGTAAGG - Intronic
1009033337 6:58086740-58086762 TCTTAAAAGATAAATCAGGCTGG - Intergenic
1009288522 6:61853738-61853760 TTTCACATGAAAAATCAAGGTGG + Intronic
1009316281 6:62224889-62224911 TTTTATATGATATATCAGGTAGG - Intronic
1009420047 6:63455439-63455461 TTTTAAATGAAAAAAGAAGAGGG - Intergenic
1009744131 6:67791311-67791333 TTCTAAAAGAAAAATAAGGCTGG + Intergenic
1009846535 6:69142178-69142200 TTTTAAATGAAGGAACAGGTCGG - Intronic
1009899114 6:69790306-69790328 TCTTACATGAAAAATCAAAATGG - Exonic
1009922602 6:70080975-70080997 TTTTCAAAGTAAAATGAGGATGG + Intronic
1010066041 6:71683712-71683734 TTTTTAATGGAAAATAAGTATGG - Intergenic
1010085989 6:71918657-71918679 GTTTAAAAGAAAAATCTTGATGG + Intronic
1010098047 6:72070038-72070060 TATTAAAGGAAAAATTGGGAAGG - Intronic
1010862684 6:80932926-80932948 TTTTATATAAAAACTCAAGATGG - Intergenic
1011533450 6:88350797-88350819 TTTTTAAGAAAAAATCAGGGAGG + Intergenic
1012003391 6:93682712-93682734 TTTTAAAAGAAAAGTCTGTAAGG + Intergenic
1012044383 6:94251283-94251305 TTTAAAATGAAATTACAGGAAGG - Intergenic
1012593099 6:101006650-101006672 GTATAAATGAAAAATCAGACAGG + Intergenic
1012957460 6:105586723-105586745 TTTTAAGTGAAAAGACAGGTGGG - Intergenic
1013171172 6:107637441-107637463 TTGTAGATGTAAAATCAAGAAGG - Intronic
1013349584 6:109293229-109293251 TTTAAAATTAATCATCAGGATGG + Intergenic
1013530180 6:111012009-111012031 GTTCAAATGAAATATCAGTAGGG + Intronic
1013668403 6:112371839-112371861 TTGTCAATGAAGAATCAGTAGGG - Intergenic
1013769891 6:113616450-113616472 TTTTAAATGAAAAAGCGGACTGG + Intergenic
1013777890 6:113699362-113699384 TTGTAAAGGAAAAATGAAGAGGG + Intergenic
1014051239 6:116957604-116957626 TTTTAAATGTATAATCTGCAAGG + Intergenic
1014388809 6:120834857-120834879 TTTGGAATGAAAACTCAGGTTGG - Intergenic
1014832273 6:126116703-126116725 TTTTAACTGTAAAATAAGGATGG + Intergenic
1015158912 6:130129470-130129492 TGTTGAATCAAGAATCAGGAAGG + Intronic
1015161831 6:130160809-130160831 TTTCAAATGTAAAATGTGGAAGG + Intronic
1015602552 6:134924502-134924524 TTTTAAAGGTAAAATGAGGAAGG - Intronic
1015698896 6:136012708-136012730 TTTTAGCTGAGAAATGAGGAAGG + Intronic
1015843251 6:137494647-137494669 AGTTAAAAAAAAAATCAGGAAGG - Intergenic
1015975335 6:138784655-138784677 TTTAAAAAGCAAAATCAGGCTGG - Intronic
1015977369 6:138804344-138804366 TGTTAGATGACAAATCAGAAAGG - Intronic
1016177173 6:141095412-141095434 TCCTCAATGCAAAATCAGGATGG - Intergenic
1016220155 6:141658585-141658607 TTTTAAATGATAACTAAAGAGGG - Intergenic
1016405875 6:143730103-143730125 TTTTAAATGAAGAATAAGGTTGG - Intronic
1016574178 6:145549279-145549301 TTTCAAACCAAAAATAAGGATGG - Intronic
1016611711 6:145997751-145997773 ATTAAAATGGAAAATAAGGATGG + Intergenic
1016645458 6:146402055-146402077 TTTTGAGAGAAAAATCAGCATGG + Intronic
1016653771 6:146494336-146494358 TTCTAAATGCAGAATCAGGTTGG + Intergenic
1017437562 6:154431145-154431167 TTATAAATGACAAACTAGGACGG + Intronic
1017484903 6:154893507-154893529 TTTCAAATAATAAATCAGAAGGG - Intronic
1017569010 6:155722210-155722232 TTTTAAAGTAAAGATGAGGAGGG - Intergenic
1017755734 6:157527391-157527413 TTTTGAATGGAAAATCTGGGTGG - Intronic
1018147819 6:160909491-160909513 CTTTAAATGGAAAAGCTGGATGG + Intergenic
1018920673 6:168170353-168170375 TTTTAAAGGAAAAATGAGGATGG - Intergenic
1019226634 6:170516560-170516582 TATTAAATTATAAATGAGGAGGG + Intergenic
1019495251 7:1335384-1335406 TTTTAAACGTAGAATCTGGAGGG - Intergenic
1020089225 7:5328825-5328847 TATTAAAAGAAAAATTAGCAAGG + Intronic
1020208730 7:6141490-6141512 TATTAAATGAAAATTCAGGCCGG - Intronic
1020344621 7:7149537-7149559 TTTTAAATAAATAATAATGAGGG + Intergenic
1020409406 7:7874518-7874540 TTTAAAATACAAAATCAGGCCGG + Intronic
1020449418 7:8304595-8304617 TTTTAACTGAGAACTGAGGATGG - Intergenic
1020496692 7:8861960-8861982 TTTTAATTGGAAAATTATGAGGG - Intergenic
1020543870 7:9498484-9498506 TTCTACATGAAACCTCAGGATGG + Intergenic
1020566128 7:9797984-9798006 TTTTAATTGAAAAATCTACATGG - Intergenic
1020656529 7:10935073-10935095 TTATAAATTAAGAATCAGAAGGG - Intronic
1020712327 7:11623452-11623474 TTTTAGATGATGAATAAGGAAGG - Intronic
1020796374 7:12682635-12682657 TTTTAGCTGAAAAATCAGTTAGG + Intergenic
1021122277 7:16809817-16809839 CTTTAAACGAAAATTCATGAAGG + Intronic
1021896288 7:25239329-25239351 TTTTGAATGAAAAATCTGGCAGG + Intergenic
1021910475 7:25381141-25381163 TTTTAATTGAATAAACAGAAAGG - Intergenic
1022214161 7:28241587-28241609 TTTGAAACGGAAAATCTGGATGG - Intergenic
1022561045 7:31349851-31349873 TTTAAAATAAAAATTGAGGAAGG + Intergenic
1023378627 7:39584154-39584176 TTTTAAAAGAAAACTAAGGAAGG + Intronic
1023466609 7:40462752-40462774 TACCAAATGAAAATTCAGGAGGG - Intronic
1024474089 7:49792288-49792310 TTTTATCTGTAAAATGAGGATGG - Intronic
1024724817 7:52180677-52180699 TTTTAAAAGAAAAGCCAGTATGG + Intergenic
1024992537 7:55247071-55247093 TTTCAAATGAAAATTTAGTAAGG + Intronic
1026048738 7:66926693-66926715 TTTAAAATGAAAAAACAGAAAGG + Intronic
1027419606 7:78006363-78006385 TTTTAGTTTGAAAATCAGGACGG + Intergenic
1027514928 7:79129748-79129770 TATTAAATGAAAAATTCAGAAGG + Intronic
1027649298 7:80845563-80845585 TTTTAGAGGTAAAATCAGCAAGG - Intronic
1028018291 7:85741835-85741857 TTTTAAATCAAAAAGCAGAAAGG - Intergenic
1029203869 7:98856824-98856846 ATTTACTTGAAAAATCTGGATGG - Intronic
1029238029 7:99139604-99139626 TTTTGATTGAAAAATCAAGCAGG - Intronic
1029678013 7:102084813-102084835 TTATAGATCAGAAATCAGGATGG - Intronic
1030533096 7:110734624-110734646 ATTTAATTAGAAAATCAGGATGG + Intronic
1030585067 7:111407577-111407599 TTTTAAATGAAATATCCAGAAGG + Intronic
1031342557 7:120621648-120621670 TTTTAAATAAAAAATGAAGTAGG + Intronic
1031647662 7:124246336-124246358 TTTTAAATGAAAGAGGAAGAAGG - Intergenic
1031900050 7:127398858-127398880 ATTTAAATGAAAGATCTGTAAGG - Intronic
1032236441 7:130127986-130128008 TTGTAAATTAAAAGACAGGAAGG - Intronic
1032243325 7:130184271-130184293 TTTAAAATGAACAATCAGTGAGG + Intronic
1032265104 7:130365120-130365142 TTCTCACTGAAAAATAAGGATGG + Intronic
1032336834 7:131033014-131033036 TTTTAAAAGTAAAACCAGGCAGG + Intergenic
1032585023 7:133138429-133138451 ATTTAAAAAAAAAATGAGGAAGG - Intergenic
1032720606 7:134548147-134548169 TTAAAAAAGTAAAATCAGGAAGG + Intergenic
1033005999 7:137563443-137563465 TTTTAAATAAAAAATAAAAATGG + Intronic
1033120980 7:138666143-138666165 TTTTAAAGACAAAATGAGGAAGG - Intronic
1033981674 7:147172673-147172695 TTTCAACTGAAAAATCTTGATGG - Intronic
1034495034 7:151415359-151415381 TTTAAAATGGAAAATCACAAGGG + Intergenic
1034576919 7:152007712-152007734 TTTAAAATGAGAAAACAGGCCGG - Intronic
1035827714 8:2661985-2662007 CTTTAACTGAAAAATCCAGATGG - Intergenic
1036053613 8:5226869-5226891 TTTTAAAAGGAAAATGAAGAAGG - Intergenic
1036059166 8:5295674-5295696 GTGTAAAGGAAAAATCAGGCAGG + Intergenic
1036731136 8:11265929-11265951 TTTTTGAAGAAAAATGAGGAGGG - Intergenic
1037196305 8:16194624-16194646 TTTTTAATGAAAAATTAGATTGG - Intronic
1037275541 8:17174247-17174269 TTTTAAATTATAAATTAGCAGGG - Intronic
1037419484 8:18687165-18687187 CTTTTAAAGAAAATTCAGGATGG + Intronic
1037427231 8:18769234-18769256 CTTTAAATGAAAATAAAGGAAGG + Intronic
1038754112 8:30325066-30325088 TTTTATTTAAAAAATCAGAAGGG + Intergenic
1038799176 8:30733693-30733715 CTTTAAAAGAAAAATAAGGCTGG - Intronic
1039219547 8:35314143-35314165 TTTTAATTAACACATCAGGATGG - Intronic
1039770828 8:40685258-40685280 TATTAAATGTAAAAGCAAGAAGG + Intronic
1039862753 8:41473068-41473090 TGTTTAATGAAAGATCAGGATGG - Intergenic
1040066882 8:43152609-43152631 TTTTAAATAAAAAATTAGCTGGG - Intronic
1041114317 8:54519911-54519933 TTTGAAAAGAAGAATCAGAAGGG + Intergenic
1041810110 8:61898909-61898931 TTTTAAAAGAAAAGGCAGGCAGG + Intergenic
1042463533 8:69099494-69099516 TTAGAACTGAAAAATCAGTACGG + Intergenic
1042553084 8:70011625-70011647 TTTTAAATAAAGAATAAGGCTGG - Intergenic
1042582399 8:70295008-70295030 CTATAAATGAAAAATCCTGATGG + Intronic
1042731909 8:71944962-71944984 TATTGACTGAAAAATCAGGGAGG - Intronic
1043058954 8:75475767-75475789 TTATAAATGAAAAATAAGGCTGG - Intronic
1043073822 8:75670493-75670515 TTTAAAATGGAAAGTCAAGATGG + Intergenic
1043082267 8:75781826-75781848 GTATAAATCAAAACTCAGGATGG + Intergenic
1043111997 8:76197064-76197086 TATTCAATGAAAAATATGGATGG - Intergenic
1043992392 8:86771913-86771935 TATTAAATAAAAAAGCAGTATGG - Intergenic
1044260959 8:90120253-90120275 TTTTAAAAGCAAAAGCAAGAGGG - Intergenic
1044563316 8:93635975-93635997 TTATAAATGGACAATCAGGAAGG + Intergenic
1044608683 8:94070815-94070837 TTTTAAAAGATGAATCAAGATGG - Intergenic
1045014079 8:97983726-97983748 TCTTATTTGAAAAATAAGGATGG - Intronic
1045980071 8:108174821-108174843 TGTTAACTTAAAAATCAGGCTGG + Intergenic
1046017673 8:108625047-108625069 TTGTTAATGAAAACTCTGGAGGG + Intronic
1046130630 8:109963413-109963435 TTTGCAAAGAAAAATCATGAAGG + Intergenic
1046437725 8:114215169-114215191 TTTAAAAGGAAAAATTAGGTTGG - Intergenic
1047125011 8:121950219-121950241 TATTAAATGGAAGATCAGTATGG - Intergenic
1047414901 8:124656473-124656495 TTTTAAATGAAAATGAAGGCTGG + Intronic
1047649947 8:126909701-126909723 TTTTAAAAAATAAATCAGGCTGG - Intergenic
1047824718 8:128560775-128560797 TTTTAAAAGATAAATTTGGAAGG + Intergenic
1047898453 8:129393340-129393362 TTTTAAAAGTAAAATCAGAGGGG + Intergenic
1047936900 8:129790570-129790592 ATTTGAAAAAAAAATCAGGAGGG + Intergenic
1048127381 8:131651164-131651186 ATTCATATGAAAAATGAGGATGG + Intergenic
1048657484 8:136557234-136557256 TTTGAGAGGAAAAGTCAGGAGGG + Intergenic
1049025063 8:139982702-139982724 TTTTAAAGGAGAGATTAGGAAGG + Intronic
1049972563 9:834281-834303 TGTTAAAAAAAAAATCAGGGCGG + Intergenic
1050043901 9:1523788-1523810 TTTAACATGTAAACTCAGGAGGG - Intergenic
1050048972 9:1577923-1577945 TTTATAATGAAAAATAAGCAGGG - Intergenic
1050381094 9:5031754-5031776 CTTAAAATGAAAAGGCAGGAGGG + Intronic
1050480605 9:6083520-6083542 TTTTAAGTCAGAAAGCAGGAAGG + Intergenic
1050529869 9:6579502-6579524 TATCAAATAAATAATCAGGATGG - Intronic
1050648633 9:7750498-7750520 TTTTAAAAGAAAAATAAAGTTGG + Intergenic
1050691586 9:8233504-8233526 TTTTAAAAGAAACATAAGAAAGG + Intergenic
1050742476 9:8837796-8837818 TTTTAAAGGGAATATCAGGCTGG - Intronic
1050893333 9:10852686-10852708 TTTAAAATGAACTAACAGGAAGG - Intergenic
1051432269 9:16992008-16992030 AGATAAATGAAAAATCAGAAGGG + Intergenic
1051705452 9:19874386-19874408 ATTTAGATGAAAAATAAGAATGG - Intergenic
1051898946 9:22017991-22018013 TTATAGATGGAATATCAGGAGGG + Intronic
1052283789 9:26761932-26761954 TTTTCAAAGAAAACTTAGGAAGG + Intergenic
1052430834 9:28364978-28365000 TTTTATTTGAGAAATCAGGTAGG + Intronic
1052467514 9:28848783-28848805 ATTTAAAATAAAACTCAGGATGG - Intergenic
1052528041 9:29646670-29646692 TGTTAAATGAAAAAGTAGAATGG - Intergenic
1052571458 9:30229323-30229345 TATTAAATGAAACATCAGTGGGG + Intergenic
1053719922 9:40935184-40935206 TTTTAAATAGACGATCAGGAAGG - Intergenic
1053725485 9:40995136-40995158 TTTTAAATACAATATCAGGGTGG + Intergenic
1054340451 9:63856649-63856671 TTTTAAAAGAAAAAAAAGTATGG + Intergenic
1054791203 9:69258604-69258626 ATTTAAAATAAAAAGCAGGATGG - Intergenic
1054830266 9:69617167-69617189 TCTTAAAGGAAAAGTGAGGAGGG - Intronic
1054858878 9:69929641-69929663 CTTTAAATAAAAAAGCAGGAAGG - Intergenic
1054974178 9:71122542-71122564 TTAGAAATGGAAAATCAGCATGG - Intronic
1055028105 9:71744007-71744029 TTTTAAATGAAATGTTAGGTCGG + Intronic
1055862800 9:80773737-80773759 ATTTAAATGAAATTTCAGGAAGG - Intergenic
1055953412 9:81751864-81751886 CTTTATAAGAAAAATCAGAAAGG + Intergenic
1056169853 9:83974328-83974350 TTTTAAAAAAAAAAACAGGCTGG - Intronic
1056528456 9:87465907-87465929 TGTTAAATAAAAGATAAGGATGG - Intergenic
1056598464 9:88027018-88027040 TTTTAAAGGAAAAATCATTTAGG - Intergenic
1056618456 9:88188976-88188998 TGTTAAGAAAAAAATCAGGAAGG - Intergenic
1056942306 9:90966035-90966057 TTGCATATGGAAAATCAGGAAGG + Intergenic
1057096690 9:92317112-92317134 TAATAAAAGAAAAATCAGGCTGG - Intronic
1057737152 9:97673778-97673800 TTGAAAATGAAAGATGAGGAAGG + Intergenic
1058960066 9:109984710-109984732 TTTTTAAAGAAAAATCAGCTGGG + Intronic
1059855458 9:118392471-118392493 ACTTAAAATAAAAATCAGGAAGG - Intergenic
1059893879 9:118837334-118837356 TTTATAATGAAAAATCAGGGAGG + Intergenic
1059932642 9:119276337-119276359 TATGAAAAGAAAAATCAGGAAGG - Intronic
1060231415 9:121827997-121828019 TAATAAATAAAAAATAAGGAAGG - Intronic
1060441621 9:123645041-123645063 TTATAAATGATAAATAGGGAAGG - Intronic
1061126298 9:128678362-128678384 TTTTAAAAAAAAAATTAGGCTGG - Intergenic
1061134624 9:128726402-128726424 ATTGAAATGTAATATCAGGAAGG - Intergenic
1061563043 9:131418743-131418765 ATTTTAAAGAAAACTCAGGATGG - Intronic
1062065171 9:134522784-134522806 ATTAAAATAAAAAATGAGGAAGG - Intergenic
1203756953 Un_GL000218v1:140062-140084 TACTAAATGAAATATCTGGAAGG + Intergenic
1203455087 Un_GL000219v1:159385-159407 TTTTAAATAGACAATCAGGAAGG + Intergenic
1203716333 Un_KI270742v1:152723-152745 TACTAAATGAAATATCTGGAAGG + Intergenic
1203534881 Un_KI270743v1:25512-25534 TACTAAATGAAATATCTGGAAGG - Intergenic
1203650563 Un_KI270751v1:116292-116314 TACTAAATGAAATATCTGGAAGG + Intergenic
1185810745 X:3107657-3107679 GTTTAAAAGAGTAATCAGGATGG + Intronic
1185850474 X:3481173-3481195 TTTTAATTTAAAAATAAGGCCGG - Intergenic
1187166720 X:16811354-16811376 TCTTAAAAAAAAAATAAGGAAGG - Intronic
1187234015 X:17449700-17449722 ATTTAAAGGAAAAATCAGTCAGG + Intronic
1187328664 X:18315774-18315796 TTTTAAAGGCAAAACAAGGAAGG - Intronic
1187724084 X:22184252-22184274 TTTTAAAGGAAACATCTGGCTGG + Intronic
1187816323 X:23235983-23236005 TTTTAATTAAAAAATCAGGCCGG - Intergenic
1187848893 X:23571144-23571166 ATTTAATTGAGAAACCAGGAGGG + Intergenic
1188163905 X:26837815-26837837 TTTTAAATGAATTATTAGGTTGG - Intergenic
1188408971 X:29847941-29847963 TTTTAAAAGAATAAGCAGAATGG - Intronic
1188617027 X:32169942-32169964 TTTTAAAAGAAAAAATAGCAAGG + Intronic
1188825600 X:34829756-34829778 TTTTAAATGAAAAAGAATGAAGG + Intergenic
1188861151 X:35258499-35258521 TGGTAAATGAAAAATAAGTATGG + Intergenic
1188930155 X:36099118-36099140 TTATAAATGAAGAATAAGGTGGG + Intronic
1188939399 X:36218370-36218392 CATTTAATGAAAAATTAGGAGGG - Intergenic
1189171687 X:38915640-38915662 TTCTAAAAGAAAAATCTGCAAGG - Intergenic
1189202977 X:39213576-39213598 TTTTAAATGAAAGCACAGAATGG - Intergenic
1189205442 X:39234443-39234465 TATCAAAAGAAAAGTCAGGAAGG - Intergenic
1189712876 X:43832851-43832873 TTTATAAAGAATAATCAGGAAGG + Intronic
1190053293 X:47167820-47167842 TTATAAATAATAAATCAGTAAGG - Intronic
1190066302 X:47243980-47244002 TTTTGAATGCAAAATGAGGGGGG - Intronic
1190464369 X:50710985-50711007 TTTAAAATTAAAAATAAGGCTGG - Intronic
1190883059 X:54507102-54507124 CTTAAAAAGAAAAATCAGGCCGG - Intergenic
1191744132 X:64467218-64467240 TTTTCTGTGAGAAATCAGGAAGG + Intergenic
1192076001 X:67997489-67997511 TTCTAAAAAAAAAATGAGGAGGG - Intergenic
1192173058 X:68868589-68868611 TTTTAAAAGAAAAATCACCCTGG + Intergenic
1192682404 X:73265372-73265394 TTTTAAATGTAGAATCACTAAGG - Intergenic
1193318370 X:80091834-80091856 TTAAAAATGAAAAAACAGGCCGG + Intergenic
1193731656 X:85109630-85109652 GTGTAAGTGAAAAATGAGGACGG - Intergenic
1193801120 X:85937538-85937560 ATTAAAATGGAAAATCAGGCTGG + Intronic
1193848075 X:86499711-86499733 ATTGCAATGAAAAATCATGAAGG - Intronic
1194369649 X:93056935-93056957 TTTTAACTGAAAAGCAAGGAAGG + Intergenic
1194610975 X:96044037-96044059 TTTTCAATGAAAAATCAACCTGG - Intergenic
1194674585 X:96779201-96779223 TTTTAAAAGAAATATCAGCATGG + Intronic
1194842797 X:98764783-98764805 TTATAAAAGAAAAATATGGATGG + Intergenic
1197238678 X:124097589-124097611 TTTGAAATGAAAAGTATGGAAGG + Intronic
1197951493 X:131902295-131902317 TGTTACATGAAATATCAGAATGG + Intergenic
1198699248 X:139380155-139380177 TTTAAAAGGAAAAATCAAAAAGG - Intergenic
1199188318 X:144941068-144941090 TTTTAACTTAAAAATGAGGCTGG - Intergenic
1199284043 X:146036695-146036717 TTTTAAAGGAAAACTCTGGTAGG - Intergenic
1199318987 X:146416031-146416053 TTTTAAATTAATAATCACAATGG - Intergenic
1199348532 X:146771739-146771761 GTTTAAATGAGAAATAAGAAAGG + Intergenic
1199363438 X:146949242-146949264 TTTTAAATGCAGAATTTGGAGGG - Intergenic
1200649219 Y:5820297-5820319 GTAAAAATAAAAAATCAGGATGG + Intergenic
1200677839 Y:6173144-6173166 TTTTAACTGAAAAGCAAGGAAGG + Intergenic
1200811833 Y:7494033-7494055 TTTTAATTTAAAAATAAGGCTGG + Intergenic
1201170525 Y:11257678-11257700 TACTAAATGAAATATCTGGAAGG + Intergenic
1201709813 Y:16978313-16978335 ATTAAAATTAAAAGTCAGGAAGG + Intergenic
1202132152 Y:21622562-21622584 TATTTAAAGAAAAATCATGAAGG - Intergenic