ID: 930402890

View in Genome Browser
Species Human (GRCh38)
Location 2:50913253-50913275
Sequence CTAGTTCACAAGTTAGCCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 77}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930402890_930402896 7 Left 930402890 2:50913253-50913275 CCTATGGCTAACTTGTGAACTAG 0: 1
1: 0
2: 0
3: 4
4: 77
Right 930402896 2:50913283-50913305 CTGTGAAATGGAATCACAATTGG 0: 1
1: 0
2: 2
3: 24
4: 249
930402890_930402898 18 Left 930402890 2:50913253-50913275 CCTATGGCTAACTTGTGAACTAG 0: 1
1: 0
2: 0
3: 4
4: 77
Right 930402898 2:50913294-50913316 AATCACAATTGGACAATTTAGGG 0: 1
1: 0
2: 0
3: 17
4: 250
930402890_930402893 -5 Left 930402890 2:50913253-50913275 CCTATGGCTAACTTGTGAACTAG 0: 1
1: 0
2: 0
3: 4
4: 77
Right 930402893 2:50913271-50913293 ACTAGGGTTTCCCTGTGAAATGG 0: 1
1: 0
2: 0
3: 13
4: 158
930402890_930402897 17 Left 930402890 2:50913253-50913275 CCTATGGCTAACTTGTGAACTAG 0: 1
1: 0
2: 0
3: 4
4: 77
Right 930402897 2:50913293-50913315 GAATCACAATTGGACAATTTAGG 0: 1
1: 0
2: 0
3: 9
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930402890 Original CRISPR CTAGTTCACAAGTTAGCCAT AGG (reversed) Intronic
903074651 1:20753901-20753923 GTCCTTCACAAGTTAGCTATAGG - Intronic
908996564 1:70162992-70163014 GTAGTTCACAAGTCTGCAATGGG + Intronic
912631193 1:111248082-111248104 CTGGGAAACAAGTTAGCCATGGG - Intergenic
918997793 1:191784483-191784505 CTAGTTGCAAAGTTAGGCATTGG + Intergenic
1068228603 10:54139699-54139721 CTAGTTCAGAAGTTATCTAAAGG + Intronic
1068527544 10:58147643-58147665 TTATTTCACTAGTTACCCATTGG - Intergenic
1079326269 11:19495071-19495093 CCAGTCCACAAGTTATCCATGGG - Intronic
1086151752 11:83619184-83619206 CTAGTTCAGATGTAAACCATGGG - Intronic
1088513520 11:110601590-110601612 TTAGCTCACAAGTTATCCAAAGG - Intronic
1095360144 12:41327547-41327569 CTACTTCACAAGCTACACATAGG - Intronic
1095614142 12:44168383-44168405 ATAAATCACAAGTTAACCATGGG - Intronic
1096392763 12:51242072-51242094 CATGTTCAGAAGGTAGCCATAGG + Intronic
1099570061 12:84305595-84305617 CTGTTTCACAAGTTTGCTATAGG - Intergenic
1104559932 12:129834389-129834411 CAATTTCTCAAGATAGCCATTGG + Intronic
1106151075 13:27102674-27102696 CTAGTTCATATGTCAGTCATTGG - Intronic
1109796083 13:67314895-67314917 GTAGTTCACAAGTTAGACCTGGG - Intergenic
1116337857 14:43680955-43680977 TTAGTTCACAGTTTAGCTATAGG + Intergenic
1118502278 14:66372897-66372919 CTAGTTCACCAGTTTGCAGTTGG + Intergenic
1119006068 14:70930654-70930676 CTGGTTTACAAGTGAGCTATTGG - Intronic
1121264388 14:92590042-92590064 CTAGTTCATCAGTTACACATTGG - Intronic
1121501821 14:94444106-94444128 CTATTTGACAAGTTTCCCATAGG + Intronic
1121783211 14:96635929-96635951 CTAGTTCCAAAGCTCGCCATGGG - Intergenic
1121802625 14:96787233-96787255 CAAGTTCACAAATTATCCTTTGG + Intergenic
1131024764 15:89130888-89130910 CTGCTTCTCAAGTTAGGCATGGG - Intronic
1132421576 15:101674419-101674441 CTAATTCACAACTTACCCAATGG - Intronic
1138850317 16:60621345-60621367 GTAGGTCACAAGTTTGACATGGG + Intergenic
1145944979 17:28767118-28767140 CTGGCTCACAAGTCAGACATTGG - Intronic
1147344709 17:39782122-39782144 CTAGTTGATAAGTTAGGCAAAGG + Intronic
1148552582 17:48559402-48559424 CTAGCTCCCAAGCTAGCCTTTGG - Intronic
1149374322 17:56029036-56029058 CTAGGTCACCAGGTAGCAATTGG + Intergenic
1150099571 17:62410729-62410751 CAAGTTCACAAGTTAACAAGTGG + Intronic
1158574392 18:58623923-58623945 TTAGTTATAAAGTTAGCCATGGG - Intronic
926410548 2:12597786-12597808 CTAGTTTACAACTTGGGCATTGG - Intergenic
930402890 2:50913253-50913275 CTAGTTCACAAGTTAGCCATAGG - Intronic
930896809 2:56455922-56455944 CTAGTTCACAGGTGTGGCATGGG + Intergenic
931099596 2:58981478-58981500 TTAGTTCACAAGGCAGTCATCGG - Intergenic
935357975 2:102222252-102222274 CTAGGTCACAATTTATCCACTGG + Intronic
940006157 2:149010938-149010960 CTGGTTCCCAGGATAGCCATAGG + Intronic
945569116 2:211441906-211441928 CTAGTCCAAGAGGTAGCCATGGG + Intronic
948610100 2:239161615-239161637 CTTGATCTCAAGTCAGCCATAGG - Intronic
1173720025 20:45249430-45249452 CAATGTCAAAAGTTAGCCATAGG + Intergenic
1176589592 21:8632700-8632722 GTAGTTCATATCTTAGCCATTGG - Intergenic
1180272422 22:10609694-10609716 GTAGTTCATATCTTAGCCATTGG - Intergenic
1183174252 22:36211209-36211231 CTACTTCTCAAGACAGCCATTGG + Intergenic
949137706 3:589023-589045 GTAGTTCATATCTTAGCCATTGG + Intergenic
952127526 3:30319116-30319138 CTACATCACAACTTAGTCATTGG - Intergenic
955693991 3:61617270-61617292 CTTATTAACAAGTTAGCCCTTGG - Intronic
955787377 3:62554702-62554724 CTGGTTCACAGGTTAGAAATGGG + Intronic
956326585 3:68059706-68059728 CTAGTCCACAGTTTAGCCAAGGG + Intronic
976468893 4:85404304-85404326 CTAGTTCTCAAGTAAACCGTTGG + Intergenic
978696888 4:111592062-111592084 CTAGTTCCAAAGTTAGTTATTGG + Intergenic
988534965 5:32059031-32059053 CTAGCTCCCAGGTTAGCCATGGG + Intronic
989662893 5:43818474-43818496 CAATTTCACAAATTAGCCAAGGG - Intergenic
990547647 5:56839051-56839073 CTTGATCACAACTTGGCCATAGG + Intronic
992068301 5:73127156-73127178 TTAATTCACAAGTTAGCTGTTGG - Intronic
993330142 5:86589431-86589453 CTAATACACACATTAGCCATTGG + Intergenic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
1000957912 5:167563977-167563999 GTCGTGCACCAGTTAGCCATGGG - Intronic
1002370888 5:178753322-178753344 CAAGGTCACAAGTTAGTGATAGG - Intergenic
1003067212 6:2913959-2913981 CTAGTTTGCAAGTTAGCTTTGGG + Intergenic
1004412795 6:15396964-15396986 CTTGTTGACATGTTAGCTATCGG + Intronic
1012077500 6:94710076-94710098 CCAGTAGACAAGTTAGCCTTTGG + Intergenic
1012512842 6:100024421-100024443 CTAGTTTAAAAGTCATCCATGGG + Intergenic
1012972773 6:105749334-105749356 CTGGTTGACAACTCAGCCATGGG - Intergenic
1013827116 6:114226999-114227021 GTAGTTCACAAGTTTATCATTGG - Intronic
1017180357 6:151546266-151546288 CCTGGTCACAAGTTAGCCATAGG - Intronic
1020555171 7:9662012-9662034 CTAGTTCACTAGTTCACTATTGG - Intergenic
1023803707 7:43856242-43856264 GTGGTTCAGAAGTCAGCCATGGG - Intergenic
1024755430 7:52524855-52524877 TTTGTTCACAAGTGAGGCATAGG + Intergenic
1037274668 8:17165215-17165237 CTTGATCACAAGTTAGCCCCTGG - Intronic
1052876790 9:33573868-33573890 CTAGGTCACAAGGTACCCACTGG - Intergenic
1053499215 9:38570518-38570540 CTAGGTCACAAGATACCCACTGG + Intronic
1059747270 9:117215013-117215035 CTTCTTCACAAGGTTGCCATAGG + Intronic
1186419730 X:9415347-9415369 CTAGGTTACAAGTTAGTCTTTGG + Intergenic
1192198901 X:69051092-69051114 CTAGTTCACAGGCTTGCCGTAGG - Intergenic
1196198561 X:112860210-112860232 CTAGTTCAATACTTAGCTATGGG + Intergenic
1196596242 X:117548886-117548908 CAAGTTCACCAGTTCCCCATGGG - Intergenic
1196889543 X:120278592-120278614 CTAGTTTACAACTTGGCCACTGG + Intronic
1198484493 X:137073367-137073389 CTTGCTCAAAGGTTAGCCATAGG + Intergenic
1202267498 Y:23036081-23036103 CTAACTCACAATTTAGCAATAGG + Intergenic
1202420490 Y:24669825-24669847 CTAACTCACAATTTAGCAATAGG + Intergenic
1202450296 Y:25000257-25000279 CTAACTCACAATTTAGCAATAGG - Intergenic