ID: 930403381

View in Genome Browser
Species Human (GRCh38)
Location 2:50921453-50921475
Sequence AAGCATGTGCACCACTGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 144}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930403381_930403385 12 Left 930403381 2:50921453-50921475 CCATTTCAGTGGTGCACATGCTT 0: 1
1: 0
2: 0
3: 13
4: 144
Right 930403385 2:50921488-50921510 CAATACAGAATGGCTAGGGCAGG 0: 1
1: 0
2: 1
3: 14
4: 137
930403381_930403384 8 Left 930403381 2:50921453-50921475 CCATTTCAGTGGTGCACATGCTT 0: 1
1: 0
2: 0
3: 13
4: 144
Right 930403384 2:50921484-50921506 GTCTCAATACAGAATGGCTAGGG 0: 1
1: 0
2: 0
3: 9
4: 94
930403381_930403383 7 Left 930403381 2:50921453-50921475 CCATTTCAGTGGTGCACATGCTT 0: 1
1: 0
2: 0
3: 13
4: 144
Right 930403383 2:50921483-50921505 TGTCTCAATACAGAATGGCTAGG 0: 1
1: 0
2: 1
3: 12
4: 177
930403381_930403382 2 Left 930403381 2:50921453-50921475 CCATTTCAGTGGTGCACATGCTT 0: 1
1: 0
2: 0
3: 13
4: 144
Right 930403382 2:50921478-50921500 ACTTATGTCTCAATACAGAATGG 0: 1
1: 0
2: 0
3: 9
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930403381 Original CRISPR AAGCATGTGCACCACTGAAA TGG (reversed) Intronic
901542263 1:9926381-9926403 ATGCAACTCCACCACTGAAATGG - Intronic
905118527 1:35663547-35663569 AAGGATGTGCTTCACTAAAATGG - Intergenic
908306270 1:62821512-62821534 AAACACGTCCACCAATGAAATGG - Intronic
909063125 1:70902219-70902241 TAGAATTTACACCACTGAAAAGG + Intronic
909927283 1:81452811-81452833 AAGTATGAGCACCATTGAGAAGG + Intronic
910450605 1:87340038-87340060 GAGCATGTAAAACACTGAAAGGG - Exonic
910472857 1:87573818-87573840 TAGCATGTGCAATACTGCAAGGG + Intergenic
912992642 1:114504565-114504587 AAACTTGTGCACCTCTAAAAGGG + Intronic
913557274 1:119980462-119980484 AAGATTTTGCACAACTGAAAAGG - Intronic
915727566 1:158028779-158028801 TAGCTTGTGCACCTATGAAATGG - Intronic
916434399 1:164763783-164763805 AAGCAACAGCAACACTGAAAAGG + Intronic
917031620 1:170699344-170699366 AAACATTTGCCCCTCTGAAAGGG - Intronic
919006607 1:191907432-191907454 AAGTATGGGAAGCACTGAAAAGG + Intergenic
919655590 1:200194345-200194367 TATCTTATGCACCACTGAAAAGG + Intergenic
922534084 1:226367067-226367089 AAGCATTTCCACTTCTGAAATGG + Intronic
922547258 1:226467165-226467187 GAGTATTTGCACCACAGAAATGG + Intergenic
1063300011 10:4842792-4842814 GAGCATGTGCACCAGTCACATGG + Intronic
1064381222 10:14843411-14843433 GAGCAACTGCACCTCTGAAAAGG - Intronic
1065976229 10:30845264-30845286 ATGCATGTCCAAGACTGAAAAGG - Exonic
1066223210 10:33356233-33356255 AAGCATGTGCTTCGTTGAAATGG - Intergenic
1067476613 10:46571561-46571583 AAGCATGTGTCCCACTGATATGG + Intergenic
1067618125 10:47770220-47770242 AAGCATGTGTCCCACTGATATGG - Intergenic
1068283745 10:54909457-54909479 GAGCATGTGCACCCCTGGACAGG + Intronic
1069326793 10:67241073-67241095 AAACATATGCACCAATGGAAAGG - Intronic
1071221830 10:83476233-83476255 CAGCACCTGCACCACAGAAATGG - Intergenic
1074253428 10:111776824-111776846 AAGCATGGGCTACACTGACATGG + Intergenic
1076479738 10:130777362-130777384 AGCCATGTGCAGCAATGAAAAGG + Intergenic
1079323291 11:19470276-19470298 AAGCAGGTGGAACACTGGAAAGG + Intronic
1079373285 11:19870291-19870313 AATCATGTGCTCCTCTGAATGGG - Intronic
1088991076 11:114954109-114954131 AGGCTGGTGCACCAGTGAAATGG - Intergenic
1091120889 11:133056692-133056714 AAGCATGTGCAGTACTCAGATGG + Intronic
1093062502 12:14622059-14622081 AAGCATGTCCACCACTTCCATGG + Exonic
1093276461 12:17134492-17134514 ACACATGTGCACCACTGATAGGG - Intergenic
1096051533 12:48613787-48613809 AAGCATTTGCTTCTCTGAAAAGG + Intergenic
1096944099 12:55384620-55384642 AAGTATCTGAAACACTGAAATGG + Intergenic
1098995197 12:77111108-77111130 AAGAATGTGGTCCACTAAAATGG - Intergenic
1102389694 12:112539634-112539656 CAGCAAGTGCTCCATTGAAAGGG - Intergenic
1104860308 12:131919970-131919992 CAGCCTGCGCACCACTGCAAAGG - Exonic
1106772577 13:32976033-32976055 AAGCATTTCTTCCACTGAAATGG - Intergenic
1107115578 13:36742374-36742396 AAGCCTGTGAACCAAGGAAAGGG - Intergenic
1109982856 13:69933213-69933235 AGGCATGTGAGACACTGAAAAGG + Intronic
1111755923 13:92395723-92395745 AAATATGTGCACCATTGAAAAGG - Intronic
1112994340 13:105554750-105554772 AAGAATGTGCACCCTGGAAATGG + Intergenic
1113123023 13:106944433-106944455 AAGCATGTGCACAAATAACAGGG + Intergenic
1114353347 14:21879194-21879216 AAGCATGTGTTGCAGTGAAATGG + Intergenic
1115477889 14:33833945-33833967 GAGCATGTACAACACAGAAACGG + Intergenic
1126689428 15:51276990-51277012 AGGTATTTGCACCTCTGAAAGGG + Intronic
1127574616 15:60278906-60278928 AACCATGTTCACCACAAAAATGG + Intergenic
1130055645 15:80523210-80523232 AGGGATGTGGACCACTGGAAGGG + Intronic
1133777903 16:8912154-8912176 AAGCATGTGAACCAGTGCAGTGG + Intronic
1134474992 16:14565753-14565775 AAGCCTGTGCTCCACTAAGAAGG - Intronic
1135049487 16:19181028-19181050 AAGCAAATGCCCCATTGAAAGGG + Intronic
1136230127 16:28880836-28880858 AAGGAAGTGGACCACTGCAAAGG - Intronic
1139645498 16:68326686-68326708 AGACAAGTGCACCACTGCAAAGG + Intronic
1140593940 16:76386361-76386383 AAAAATGTGTACCACTGAGAAGG - Intronic
1141454708 16:84133138-84133160 AAACAAATGAACCACTGAAACGG + Intronic
1144820232 17:18067682-18067704 AGGCATGTAAACCACTGAGAAGG - Exonic
1145370013 17:22300247-22300269 AGGCATGTGCCCAACTGAAGGGG - Intergenic
1146313759 17:31791266-31791288 CAGCATATGCCCCTCTGAAAAGG + Intergenic
1146461723 17:33051177-33051199 ATGCCTGTCCTCCACTGAAAGGG - Intronic
1149459191 17:56813265-56813287 CAGCATGTGCACAACTGTGATGG - Intronic
1149760350 17:59223354-59223376 AAGCATATGAAGCACTGACATGG - Intronic
1150673047 17:67218748-67218770 AAGCATGTGAATCACTTAAGAGG - Exonic
1153022604 18:644551-644573 AAGCGTGAGCAAAACTGAAAAGG + Intronic
1153226296 18:2902541-2902563 TACCATGTGCACCCCTGAAATGG - Intronic
1154024873 18:10697531-10697553 AAGCATGTGCATAAATGCAATGG + Intronic
1156312587 18:35938478-35938500 GGGCATGTGCACCACTTACAGGG - Intergenic
1156407808 18:36799398-36799420 AACCATGTGGCCCACTGAATTGG + Intronic
1157630372 18:49089313-49089335 AAGCATATGCAACATTTAAAAGG + Intronic
1158070748 18:53467791-53467813 AAGCATCTGTAAGACTGAAAAGG + Intronic
1159889316 18:73939433-73939455 AAGCAGGTGCAGCTCTGAGACGG - Intergenic
1162418476 19:10552460-10552482 AAGAATGTCCACCCCTGAAAAGG + Intronic
1165268386 19:34681102-34681124 ATGCATGTTCACCAGTGACATGG - Intronic
1165382125 19:35488977-35488999 AACCATGTGCGCGACTGGAACGG - Intronic
925022970 2:586714-586736 AAGCACGTACACCACTCAGAAGG + Intergenic
926833161 2:16987422-16987444 CAGCATGTCAGCCACTGAAACGG - Intergenic
927827657 2:26319869-26319891 ACACATGTGCACCACTGCACTGG + Intronic
927878059 2:26671904-26671926 AAGCATTGACACCACAGAAATGG - Intergenic
928388403 2:30889089-30889111 AATCATCTGCAACTCTGAAAAGG - Intergenic
928786938 2:34899301-34899323 AGGCCTCTGCACCACTCAAATGG + Intergenic
929203395 2:39262393-39262415 AAGCATGTGCCCCAAGGTAATGG - Intronic
930403381 2:50921453-50921475 AAGCATGTGCACCACTGAAATGG - Intronic
932633529 2:73367864-73367886 AAGCAAGGGCTCCACTGAATGGG + Intergenic
935254874 2:101300859-101300881 CAGTATGTGCACAACTGCAAGGG + Intronic
940612268 2:156006668-156006690 AAGCATGTGCACCTCTGGCCAGG + Intergenic
940862096 2:158781288-158781310 AAGCCTGTGAACCATGGAAAGGG - Intergenic
942694956 2:178631194-178631216 AAGCAGATGCACCAGTGAAATGG - Exonic
948596380 2:239082202-239082224 AAGGACGTGCACCATGGAAACGG - Exonic
1169559260 20:6782084-6782106 AATCATGTGCACAATTCAAAGGG + Intergenic
1174006809 20:47417398-47417420 AAGTATTTACACCACAGAAATGG + Intergenic
1175365739 20:58454524-58454546 AAGGATGTGCACCCCCAAAATGG - Intergenic
1176264416 20:64201643-64201665 GAGCATTTACACCACAGAAATGG + Intronic
1176976938 21:15333364-15333386 AATCATTGGCATCACTGAAAGGG - Intergenic
1179161507 21:38903326-38903348 AAGCATCAGGAACACTGAAAGGG + Intergenic
1180917239 22:19497770-19497792 AAGGATGTGAGCCACTGCAAAGG - Intronic
949406097 3:3716373-3716395 AAGCATATACACCAAGGAAAGGG - Intronic
951988152 3:28644249-28644271 TGGCATGTGGACCACTGAATGGG - Intergenic
955379048 3:58422141-58422163 AAGCTTGTGGACCATGGAAAGGG + Intronic
955458867 3:59157522-59157544 CAGAATGTGCACCACTAAGAGGG - Intergenic
955459707 3:59168371-59168393 CAGCCTGTGTACCACTGACATGG + Intergenic
955561745 3:60198819-60198841 ATGCATTTGCACCAGTGTAAAGG + Intronic
956527143 3:70177746-70177768 AAGAAGTTGCACCACTGAAAAGG + Intergenic
958614954 3:96481439-96481461 GAGCATGTGCAACACAGAGAGGG + Intergenic
959586943 3:108033849-108033871 ATACATGTGCACCATTAAAAGGG - Intergenic
961927912 3:130502547-130502569 AAGCATGCAAATCACTGAAATGG + Intergenic
962410723 3:135139717-135139739 AAGAATGGGCACCACAGAAGAGG - Intronic
977401568 4:96539207-96539229 AAACATGTGCACCAATGTGATGG + Intergenic
977898244 4:102388177-102388199 AATAATGTGCACCAGTGAAAAGG - Intronic
978079699 4:104577052-104577074 CTGGATGTGCACAACTGAAATGG - Intergenic
981279851 4:142945460-142945482 AAGCCTGTGCAGAACTGAGAAGG + Intergenic
981840841 4:149109778-149109800 AAGCATGGACTCCACAGAAATGG - Intergenic
982272548 4:153605963-153605985 AGGCGTGTGCACCACTGCCAGGG - Intronic
982654682 4:158132721-158132743 AAGCATTTGCACCAGTCAAAGGG + Intronic
983093661 4:163537326-163537348 AAGAATGTACACCACAAAAAAGG + Intronic
983676903 4:170305406-170305428 AAGCATGAGCACCTCTGTGAGGG - Intergenic
986433640 5:7706207-7706229 AAGAATGTGCACAACTGGAAAGG + Intronic
988085631 5:26472271-26472293 TAGCATTGCCACCACTGAAATGG - Intergenic
993673569 5:90791388-90791410 AAGCATGGGCACTCCTGAAAGGG - Intronic
994288853 5:98003615-98003637 AAGCATGGTAAACACTGAAAAGG + Intergenic
994843594 5:104956884-104956906 AATAATTTTCACCACTGAAATGG - Intergenic
996883951 5:128333894-128333916 TTGCATGTTCACCACTGACAGGG - Intronic
999028051 5:148258451-148258473 AATCATTTGCATCCCTGAAAGGG - Intergenic
1002676226 5:180915261-180915283 AAGCACGTGCCCCACTGTGATGG - Intronic
1006796640 6:36736259-36736281 AAGCTTGGGAACCACTGGAAGGG + Intergenic
1008120192 6:47606256-47606278 CAGAATGTCCACCATTGAAACGG - Exonic
1011340329 6:86306876-86306898 AATCATTTACACCACTGGAAAGG - Intergenic
1012801869 6:103840653-103840675 TAACATTTGCACCCCTGAAAAGG + Intergenic
1023636194 7:42213323-42213345 CAGCATGTTCTCCTCTGAAATGG + Intronic
1024270196 7:47635990-47636012 AAGCAGGGGCACCCCAGAAAGGG + Intergenic
1027887781 7:83931514-83931536 AAGCAAGCACACCACAGAAAAGG + Intergenic
1028688125 7:93616301-93616323 AACCATGTGAATCTCTGAAATGG - Intronic
1028740836 7:94273264-94273286 AGCCATGTGTACCACTGTAAGGG + Intergenic
1030452358 7:109729012-109729034 AACCATGTGTAACACTGATAAGG - Intergenic
1030616621 7:111744151-111744173 TGGGATGTGCACCACTGAGAAGG + Intronic
1032775491 7:135108803-135108825 AATCATTTGCATCCCTGAAAGGG - Intronic
1032858451 7:135856886-135856908 GAGTATGTGCACCACAGAATTGG + Intergenic
1035082610 7:156230243-156230265 AAGCATGTACTTCATTGAAAAGG + Intergenic
1037927178 8:22852718-22852740 AAACATGTGAGCAACTGAAATGG - Intronic
1046642998 8:116753463-116753485 GAGCGTTTTCACCACTGAAAAGG + Intronic
1047544988 8:125807181-125807203 GAGCCTGTGCACAACTGAGAAGG - Intergenic
1050168746 9:2793519-2793541 TAGCATTTGTACCACTGAGAAGG + Intronic
1051693651 9:19744531-19744553 AAGCATATGCCCCAAGGAAAGGG + Intronic
1052355341 9:27498715-27498737 AGGCACATGCACCATTGAAAGGG + Intronic
1055686116 9:78776760-78776782 ATGCATTTACATCACTGAAAGGG - Intergenic
1056127732 9:83553482-83553504 AATCATAGGCACCCCTGAAAGGG - Intergenic
1056759779 9:89406335-89406357 AAGTCTGTGCACCATAGAAATGG + Intronic
1059351628 9:113669538-113669560 AAGCATGCCCACTACAGAAAAGG + Intergenic
1059829401 9:118077045-118077067 AAGCATGGGAACCACAGAGAAGG + Intergenic
1061899335 9:133665093-133665115 GAGCATTTGCACCATGGAAATGG - Intronic
1187028018 X:15456219-15456241 AAGCATTTGCAAAACTGGAAAGG - Intronic
1188417821 X:29957797-29957819 AAGCATTTGTAACAATGAAAAGG + Intergenic
1189061781 X:37761428-37761450 AAGTATTTACACCACAGAAATGG + Intronic
1189083520 X:37997533-37997555 AAGCATGTGCACACCTGACCTGG - Intronic
1193749435 X:85324903-85324925 AAGCATTTGCTTCTCTGAAAAGG + Intronic
1193859080 X:86641475-86641497 AATCATTGGCACCCCTGAAAGGG + Intronic
1194502107 X:94694231-94694253 TAGCATTTGCATCCCTGAAAAGG + Intergenic
1194948206 X:100093121-100093143 AATCATTTGCATCCCTGAAAAGG + Intergenic
1195464102 X:105160526-105160548 AAGCATTTGCACAATTGAAATGG - Intronic