ID: 930403590

View in Genome Browser
Species Human (GRCh38)
Location 2:50924897-50924919
Sequence ATGGCTATTTATCTGTAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 114}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930403590 Original CRISPR ATGGCTATTTATCTGTAACC TGG Intronic
900912793 1:5613822-5613844 ATGGCTGTTTATGTGTCGCCTGG - Intergenic
901501835 1:9657348-9657370 ATTCCTGTTTATCTGTAAGCGGG - Intronic
902614785 1:17617968-17617990 ATGGGTTTTCATCTGTAACATGG + Intronic
904867000 1:33587284-33587306 ATGAGTACTTATCTGTAAACAGG + Intronic
905944128 1:41887741-41887763 GGGGCTATTTATCTTTAATCTGG - Intronic
910174130 1:84410633-84410655 GTGGCTTTTTATCAGTAATCAGG + Intronic
912117105 1:106419911-106419933 ATGGATGTTCATCTGTGACCAGG - Intergenic
912734398 1:112137253-112137275 ATGGGTATTGAGCTGTAGCCAGG + Intergenic
915167712 1:153957954-153957976 AGGGCTGCTTGTCTGTAACCTGG - Intronic
915428180 1:155844405-155844427 CTGGTTATATATATGTAACCAGG - Intronic
921025383 1:211275217-211275239 AAGGTAAATTATCTGTAACCTGG + Intronic
921720168 1:218462725-218462747 ATTGTTGTTTATCTGTATCCTGG + Intergenic
921845475 1:219875155-219875177 CTGGCTAATTATTTGTAGCCAGG + Intronic
923483211 1:234404004-234404026 TTGGCTATTTATCTCCTACCTGG + Intronic
924798139 1:247307900-247307922 GTGGCTATTTCTCTGAAAGCAGG + Intronic
1068056506 10:52018345-52018367 ATGACTATTTATTTGTAAGATGG + Intronic
1068067928 10:52155460-52155482 TTGGATATTTCTATGTAACCAGG + Intronic
1070640593 10:78166129-78166151 GTGGCTATGTATTTGTCACCTGG + Intergenic
1072150217 10:92676362-92676384 ACAGCTATTTTTCTGCAACCAGG + Intergenic
1078343544 11:10521787-10521809 ATGTCTGTGTATATGTAACCAGG + Intronic
1085101965 11:73808585-73808607 TTGGCTATTTCTCTGTAGCTTGG + Intronic
1085231127 11:74971963-74971985 TTAGCTATCTTTCTGTAACCTGG + Intronic
1085946318 11:81277576-81277598 ATGGCTACTTATCTAGAAACAGG - Intergenic
1092504639 12:9083979-9084001 ATGGATTTTTAGCAGTAACCCGG + Intronic
1095188053 12:39224771-39224793 ATGGCTATTTAACTGGACCTGGG + Intergenic
1099129031 12:78803550-78803572 ATGGGTATCTATGGGTAACCTGG - Intergenic
1099129207 12:78804711-78804733 ATGGATATCTACCGGTAACCTGG - Intergenic
1100556325 12:95697582-95697604 ATGGCTATTTATCAGTAAGCAGG + Intronic
1101182531 12:102234963-102234985 ATGCCTATTTCTCTGTAAAGAGG - Intergenic
1107389026 13:39943986-39944008 GTGTCTTTTTATCTGTATCCAGG - Intergenic
1110441830 13:75535059-75535081 AAGGCTATTTAGATATAACCTGG + Intronic
1111475831 13:88746023-88746045 ATGGCTATGTATCTGTGAAATGG + Intergenic
1114806141 14:25839283-25839305 CTTGTTATTTATCTGTATCCAGG + Intergenic
1120677231 14:87434606-87434628 ATGGCTTTTTGTCTGTGCCCAGG - Intergenic
1124445389 15:29726545-29726567 ATGACGATTTAGCTGTAAGCAGG - Intronic
1126302559 15:47214669-47214691 ATGGTTATTTATTTGTATCAGGG - Intronic
1129709355 15:77812618-77812640 ATGGCCATTTATTTCTGACCAGG - Intronic
1130648378 15:85748110-85748132 AGGGCTCTTTTTCTGTAGCCAGG + Intronic
1134869278 16:17637171-17637193 ACAGCTATTTATTTGTAACCAGG - Intergenic
1136095881 16:27956281-27956303 TTGAATATTTATCTATAACCTGG - Intronic
1139098172 16:63731343-63731365 ATTGCTATTTTTCAGTAATCTGG - Intergenic
1145831014 17:27916311-27916333 ATGGCTATTTATGTTTCACATGG + Intergenic
1145894250 17:28444111-28444133 TTTTCTATTTATCTGTGACCAGG + Intergenic
1145977262 17:28991504-28991526 GTGGCTATTTAAATGTAAACTGG - Intronic
1146978794 17:37140455-37140477 ATGCATATTGATCTGTAGCCAGG - Intronic
1155039669 18:22054309-22054331 AAAGCTATTTATCTGAAAACGGG - Intergenic
926666849 2:15534531-15534553 ATGGTTACTTACCTGTGACCAGG + Exonic
928617312 2:33053585-33053607 CTGGCTATTTTGCTGTATCCGGG + Intronic
930196826 2:48518671-48518693 TTGGCTTTCTATCTGTAAACTGG - Intergenic
930403590 2:50924897-50924919 ATGGCTATTTATCTGTAACCTGG + Intronic
933995514 2:87665774-87665796 ATGTCTATTCATCAGTATCCTGG + Intergenic
936298341 2:111285141-111285163 ATGTCTATTCATCAGTATCCTGG - Intergenic
937118109 2:119423892-119423914 TTTGATATATATCTGTAACCAGG - Intergenic
937688438 2:124724474-124724496 ATGTATATTTATCTTTAACTTGG - Intronic
938610019 2:132937874-132937896 TTGGCTAATTTTCTGAAACCTGG - Intronic
941461414 2:165776636-165776658 AAAGTTATTAATCTGTAACCTGG + Intronic
942532910 2:176932008-176932030 ATGGCTAGTTATCTGACACTGGG - Intergenic
943653479 2:190482166-190482188 ATGGCAGATTCTCTGTAACCTGG + Intronic
944325517 2:198399469-198399491 TTGGCTATTTATCTGAAGCCAGG + Intronic
946084501 2:217157412-217157434 TTGGATATTTATCTGTAAAATGG - Intergenic
1177182819 21:17761715-17761737 ATGACTATTTTTCTGAAACAAGG + Intergenic
1179182171 21:39054760-39054782 TTGGCTATGTCTTTGTAACCAGG + Intergenic
1181986188 22:26801181-26801203 ATGTTTATATATCTGCAACCGGG - Intergenic
1183550997 22:38485274-38485296 ATGGTTATTTTTCAGTAACGGGG + Exonic
953457467 3:43054385-43054407 ATGGATATTTACCTTTGACCAGG - Intronic
961613587 3:128161019-128161041 ATGGTTTTTTATCTGTAAAATGG - Intronic
962977241 3:140456345-140456367 AGGGCTCTTTATCTGTAACCTGG + Intronic
965565050 3:170106786-170106808 ATGGCTATTTATCTGTCCTTTGG + Intronic
966081121 3:176002569-176002591 AGGCCTATTTATCTGTATGCAGG + Intergenic
967296291 3:187968279-187968301 ATGAGTAATTATCTGTAAACCGG + Intergenic
969887589 4:10229471-10229493 TTGGCAACTTATATGTAACCTGG + Intergenic
971629576 4:28973630-28973652 TTGGTTATTTATCTGGAAGCTGG + Intergenic
973282053 4:48369102-48369124 ATAGCTATTGATTTCTAACCAGG - Intronic
974610818 4:64213588-64213610 ACTGCTATTGATTTGTAACCTGG - Intergenic
975833204 4:78391778-78391800 AGGGCTATTTATCTGTACACAGG - Intronic
977357952 4:95969927-95969949 ATGGCTAGGGATCTGGAACCAGG + Intergenic
977381005 4:96273343-96273365 AGAGTTATTTTTCTGTAACCTGG - Intergenic
978428962 4:108612532-108612554 CTGTCTCTTTATCTGTAACATGG - Intergenic
979339385 4:119503018-119503040 ATGCCTATTTATTTCTAACCAGG - Intronic
980452519 4:132993290-132993312 ATGGCTATTTATATTTAAGTGGG + Intergenic
982416208 4:155135454-155135476 ATGTCAATTTATCTGTTAACTGG - Intergenic
983559531 4:169086967-169086989 ATGGCTATTTAAATTTAAACTGG + Intergenic
983789336 4:171776100-171776122 AGGACTATTTATCTGTACCATGG - Intergenic
984421660 4:179530555-179530577 ATGGCAATTTATCCAAAACCTGG - Intergenic
987046464 5:14113678-14113700 ATGGAAATTTATCCGCAACCGGG - Intergenic
987659289 5:20851467-20851489 ATGGCTATTTCTCTGGAGCCAGG + Intergenic
988764357 5:34354186-34354208 ATGGCTATTTCTCTGGAGCCAGG - Intergenic
990545849 5:56820479-56820501 ATAGGTATGTTTCTGTAACCTGG + Intronic
990738532 5:58889632-58889654 CTGTCTATTTATCTGAAAACTGG - Intergenic
991156416 5:63441479-63441501 ATTGCTTTTTATCTATAACTTGG - Intergenic
992250330 5:74869652-74869674 CTGGCTAGTTATCTGTAGCAGGG - Intergenic
999895515 5:156029298-156029320 ATGGTTATTTTTCTGTAATCAGG + Intronic
1000038448 5:157466851-157466873 ATGCCTCTATATCTGTAGCCTGG - Intronic
1000621260 5:163489287-163489309 ATGGGTATTGGTCTGTAGCCCGG + Intronic
1002706508 5:181164304-181164326 ATGGCCTTTTCTCCGTAACCAGG - Intergenic
1002707153 5:181169760-181169782 ATGGCCTTTTCTCCGTAACCAGG - Intergenic
1002797230 6:483585-483607 ATTGCTATATATTTCTAACCTGG + Intergenic
1003810215 6:9770862-9770884 AAGGCTTTTTATCAGCAACCTGG - Intronic
1004295671 6:14407793-14407815 ATGCCTATTTATCTTTAAAATGG + Intergenic
1004409660 6:15369214-15369236 ATTGCAAGTTATCTCTAACCCGG - Intronic
1005526501 6:26656630-26656652 ACAGCTATTTGTCTGTATCCCGG - Intronic
1010052754 6:71527085-71527107 GGGTCTAATTATCTGTAACCAGG - Intergenic
1014042200 6:116841202-116841224 ATTGCTAGCTATCTGTTACCTGG - Intergenic
1015666080 6:135630782-135630804 ATGACTATTTATGTGTAGACAGG + Intergenic
1017414587 6:154206225-154206247 ATGTGTATTTCTCTGGAACCTGG + Intronic
1025278348 7:57604854-57604876 GTGGGTATTTATCTGAAATCAGG - Intergenic
1030582453 7:111375242-111375264 ATGGCTTTTCATCTGTTTCCTGG - Intronic
1030917750 7:115337944-115337966 ATGGCTATTTATCTTTATCCGGG + Intergenic
1035137695 7:156720908-156720930 ATCCCTATTTATCTGTACCCTGG - Intronic
1037377084 8:18242421-18242443 ATGGCTTTTTTTTTTTAACCTGG + Intergenic
1048274696 8:133057444-133057466 ATGGCCATTTAGATATAACCTGG + Intronic
1048616210 8:136078178-136078200 ATGGATATTTATGTGTAAACAGG + Intergenic
1050387810 9:5109587-5109609 ATGGCTATTTTTATGTAATTTGG - Intronic
1051062645 9:13062621-13062643 CTGGCCATTTTTCTTTAACCTGG + Intergenic
1053196280 9:36121529-36121551 TTGGCTTTTTATTTGTTACCTGG - Exonic
1057485951 9:95484393-95484415 TTGTTTGTTTATCTGTAACCTGG - Intronic
1060064055 9:120487120-120487142 AAGGATATTAATCTGTAACGTGG + Intronic
1186971631 X:14851582-14851604 CAGGCTATTCATCTGAAACCTGG + Intronic
1189618097 X:42805669-42805691 ATTATTATTTATCTGTAATCTGG - Intergenic
1192670616 X:73136626-73136648 ATGGCTCTTTATTTCTAACACGG - Intergenic
1192946485 X:75969208-75969230 ATGGCTTTTTCTCTGTTAACTGG + Intergenic
1200412485 Y:2874985-2875007 ATGGAAATTTGTCTGTAACTAGG + Intronic
1201343833 Y:12961038-12961060 ATGGATATATAGATGTAACCAGG + Intergenic
1202164186 Y:21969250-21969272 TTGGCTATTTATCTGCAGCAGGG + Intergenic
1202227170 Y:22617122-22617144 TTGGCTATTTATCTGCAGCAGGG - Intergenic
1202315952 Y:23578532-23578554 TTGGCTATTTATCTGCAGCAGGG + Intergenic
1202554813 Y:26091535-26091557 TTGGCTATTTATCTGCAGCAGGG - Intergenic