ID: 930404685

View in Genome Browser
Species Human (GRCh38)
Location 2:50940535-50940557
Sequence CTTGTGACCCAGAGAGCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 248}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930404685 Original CRISPR CTTGTGACCCAGAGAGCACA AGG (reversed) Intronic
900429371 1:2594606-2594628 CTTGGGCCCCAGAAAGCAGAGGG + Intronic
901083208 1:6595226-6595248 GCTGTGAGCCAGAGAGCAGAAGG - Intronic
903162868 1:21502325-21502347 CACATGCCCCAGAGAGCACAGGG + Intergenic
903294460 1:22334925-22334947 CTTGTGACCAGGTGAGCACAGGG - Intergenic
903440373 1:23383656-23383678 CTGGTGGCCCAGACATCACATGG + Intronic
903524968 1:23986825-23986847 CACATGCCCCAGAGAGCACAGGG + Intergenic
903788528 1:25876525-25876547 CCTGTGGCCCAGAGAGAACAAGG - Intergenic
903845354 1:26276700-26276722 ATTGTGACCCAGAGGGCCCAGGG + Exonic
903982219 1:27197379-27197401 CTTATGACCAAGAGAGGAAACGG - Intergenic
904469830 1:30729448-30729470 CCTGAGACCAAGATAGCACATGG - Intergenic
904684719 1:32251706-32251728 CCTGAGGCCCAGAGAGAACAAGG + Intronic
905915465 1:41681561-41681583 TTTGTGAGCCACAGAGGACAAGG + Intronic
906670524 1:47650940-47650962 CTTGGGACCCAGACCTCACAAGG + Intergenic
906925543 1:50111757-50111779 CTTGTCACCCAGTGCACACATGG - Intronic
907049650 1:51321605-51321627 CTGGTGACCCAGAAAGCCAAAGG + Intronic
909067277 1:70950431-70950453 CTTGTGACCCAGTGAGGTGAAGG - Intronic
910363271 1:86436565-86436587 CTATTGATCCACAGAGCACAAGG - Intronic
910677379 1:89828218-89828240 ATAGTGACCCAAACAGCACATGG + Intronic
911236788 1:95420718-95420740 CCTGAGAGCCAGAGAGCAAATGG - Intergenic
912034759 1:105299090-105299112 CTTGTAGCCCAGAGATCACTGGG + Intergenic
913968337 1:143394997-143395019 CGTGGGACCCTGAGAACACAAGG - Intergenic
914062715 1:144220593-144220615 CGTGGGACCCTGAGAACACAAGG - Intergenic
914116435 1:144745761-144745783 CGTGGGACCCTGAGAACACAAGG + Intergenic
914894318 1:151654758-151654780 CATGTGAGACAGAGAGCAAATGG + Intronic
915012249 1:152698406-152698428 CCTGGGAGCCAGAGGGCACAGGG + Intronic
915989739 1:160502070-160502092 GGTGTGGCCCAGAGGGCACATGG + Intronic
916418017 1:164610649-164610671 TTGGTGAACCAGAGAACACAGGG - Intronic
916501300 1:165389639-165389661 CTAGAGACCCAGAGGGCAAAGGG - Intergenic
919249250 1:195030974-195030996 CCTGGGCCCCTGAGAGCACAGGG + Intergenic
920430853 1:205918112-205918134 CTTATGACCCACAGAGGGCAGGG + Intronic
920963991 1:210687283-210687305 CTTGTCACCCAGAGGCCCCATGG + Intronic
921159122 1:212460684-212460706 GGTGAGACCCAGGGAGCACACGG - Intergenic
922898529 1:229118997-229119019 CTGGGGACCCAGAGCTCACAAGG + Intergenic
1066336292 10:34481573-34481595 CTGGCCACCCAGAGAGCAAATGG + Intronic
1067745254 10:48930874-48930896 CATGTGTGCCAGAGAACACAGGG - Intronic
1067755672 10:49002495-49002517 ATTAAGACCCAGGGAGCACAGGG + Intergenic
1069876654 10:71567312-71567334 CCTGTGTCCCAGAGAGCAAGAGG - Intronic
1071497607 10:86179594-86179616 CTGGGGACCCAGGGAGCAGAAGG - Intronic
1072102435 10:92241408-92241430 CTTGTGACCAAGACAGCAGCAGG - Intronic
1072159626 10:92754051-92754073 ATTGAGGCCCAGAAAGCACATGG - Intergenic
1072523974 10:96255093-96255115 CGTCTGGCCAAGAGAGCACAAGG + Intronic
1073238374 10:102036580-102036602 CACATGCCCCAGAGAGCACAGGG - Intronic
1073844975 10:107544729-107544751 CCTGGGCCCCTGAGAGCACAGGG - Intergenic
1074743781 10:116510227-116510249 CTGGGGACCCAGGGAGCACTGGG + Intergenic
1074824149 10:117202511-117202533 CTTGTGGCCCAGTGGGCAGAAGG - Intronic
1075589961 10:123684156-123684178 CTCATGTCCCAGAGAGCACACGG + Intronic
1076342583 10:129759831-129759853 CTTGGGACCCAGGGAGCCCTGGG - Intronic
1076424790 10:130359825-130359847 CTGGTGACGCAGGGAGCCCATGG + Intergenic
1076474893 10:130744988-130745010 CTTGGGATCCACAGAGCACAGGG - Intergenic
1077338169 11:2014587-2014609 CCCGTGTCCCAGAGGGCACAGGG - Intergenic
1078345633 11:10545156-10545178 CCTGGGCCCCTGAGAGCACAAGG + Intergenic
1078889175 11:15538623-15538645 CTTCTGACCCAATGAGCACATGG - Intergenic
1079256721 11:18837476-18837498 GGTGTGACCCACAGAGAACAAGG + Intergenic
1083724198 11:64619870-64619892 CTAGTGGCCTAGAGAGCACCAGG + Intronic
1084653032 11:70500131-70500153 CTAGTGCCCCACAGGGCACAGGG + Intronic
1085809971 11:79670996-79671018 CTTGTGACTCACAGAGCATGCGG - Intergenic
1086128988 11:83381478-83381500 ATTGTCACCCAGCTAGCACATGG - Intergenic
1088010375 11:104993914-104993936 ATTGTCACCAACAGAGCACAGGG + Intergenic
1088348253 11:108855298-108855320 CTTGTGACCCTCAAAGCAAAAGG - Intronic
1090025681 11:123165772-123165794 CTAGGGACTAAGAGAGCACAGGG + Intronic
1202821153 11_KI270721v1_random:69769-69791 CCCGTGTCCCAGAGGGCACAGGG - Intergenic
1091996412 12:4997519-4997541 CTTCTGACCCAGGGGGCCCAGGG + Intergenic
1092754872 12:11753745-11753767 CTTCTGCCCCAGAGGGCAGACGG + Intronic
1093082023 12:14823213-14823235 CTTCTGAACCACAGAGCACATGG - Exonic
1093428158 12:19052683-19052705 CTGGTTACTCAGATAGCACATGG + Intergenic
1097173036 12:57128180-57128202 CTGGTGCTCCAGAGAGCAGAAGG - Intronic
1103039653 12:117684680-117684702 CATGTGACACAGAGAGAACTTGG - Intronic
1103126204 12:118424545-118424567 ATTGTGAGCCAGAGAGGACAGGG + Intergenic
1103173571 12:118843321-118843343 CCTGAGTCCCAGAGAGCACAGGG - Intergenic
1103291231 12:119847957-119847979 CTTATGATGCAGAGAGCACAAGG + Intronic
1104292561 12:127483429-127483451 CATGTGCCCCAAAGAGCCCATGG + Intergenic
1106313514 13:28574416-28574438 GTTGTGACACAGTGGGCACATGG + Intergenic
1106891492 13:34250964-34250986 CTTGTGACCCAGAAAAGATAAGG + Intergenic
1107841036 13:44458624-44458646 CCTGGGTCCCCGAGAGCACAGGG - Intronic
1108533252 13:51346811-51346833 CTTGGGTCCCTGACAGCACAAGG + Intronic
1108581833 13:51834405-51834427 CGTGTGACCCACAAAGCCCAGGG + Intergenic
1109224791 13:59680053-59680075 CTTGTGACCAAGAAACCAAATGG - Intronic
1109336155 13:60997210-60997232 CCCTGGACCCAGAGAGCACAAGG - Intergenic
1109348379 13:61145125-61145147 CCTGGGCCCCTGAGAGCACAAGG - Intergenic
1111515631 13:89327311-89327333 CTTGAGATCCAGAGAGCCAATGG + Intergenic
1112138882 13:96615732-96615754 CTTGTGACACAAAGTGCATATGG + Intronic
1112835444 13:103508442-103508464 CATGTCACCCAGGAAGCACAAGG - Intergenic
1113427030 13:110216714-110216736 CTAGTGACCCAGAAAAAACAGGG - Intronic
1113506532 13:110820876-110820898 AGTGGGCCCCAGAGAGCACACGG - Intergenic
1114420988 14:22582559-22582581 CTTAGGACCCAAAGAGCTCAGGG + Intronic
1115783542 14:36798625-36798647 CTTATGACCCAGCAAGCAAACGG - Intronic
1116019203 14:39441061-39441083 CCTGGGCCCCAGAGAGCACAGGG - Intergenic
1116409244 14:44601938-44601960 CACATGCCCCAGAGAGCACAGGG - Intergenic
1119674576 14:76544264-76544286 CTTGAGCCCCAGGGAGCTCAGGG - Intergenic
1121415344 14:93775417-93775439 CATGTCTCCCAGAGGGCACAGGG - Intronic
1125124598 15:36205451-36205473 CTTGAGACCAAGAGAATACATGG + Intergenic
1125332306 15:38594226-38594248 CTTGTGTGCCAGACAGCACAAGG - Intergenic
1125381726 15:39092998-39093020 CTCCTGGCCCAGAGACCACAGGG + Intergenic
1126098221 15:45104201-45104223 CTTGTCAGCCAGAGAGAACATGG + Exonic
1126106004 15:45147575-45147597 CTTGTCAGCCAGAGAGAACATGG - Exonic
1126820265 15:52496299-52496321 CATGTGGCCTAGAAAGCACAGGG - Intronic
1128529543 15:68434337-68434359 CGTGTGTCCTACAGAGCACAGGG - Intergenic
1128997878 15:72310015-72310037 CTTCTGCCCCAGTGAGCAGAAGG + Intronic
1129784783 15:78302680-78302702 CTTGTGACCCAGTAACCGCATGG - Intergenic
1130557749 15:84934882-84934904 CCTGAGACCCAGAGAGAAAAAGG - Intronic
1133423910 16:5670928-5670950 ATTGAGGCTCAGAGAGCACAAGG + Intergenic
1133978651 16:10617965-10617987 CTGATGACCCAGACAGGACAGGG - Intergenic
1137524186 16:49219435-49219457 CTTGAGACCCAGAGAGGTAAAGG - Intergenic
1138815108 16:60194664-60194686 CTCTTCACCCAGAGATCACAAGG + Intergenic
1139633450 16:68244546-68244568 CTGGGGAACCAGAGAGGACATGG - Intergenic
1141388930 16:83648222-83648244 CATGTGACTCTGAGAACACACGG - Intronic
1141668111 16:85476505-85476527 CTGGTGACCCAGGGAACAGAAGG - Intergenic
1141736997 16:85860541-85860563 CTTGTGACTCAGGCAGCACAAGG + Intergenic
1142276301 16:89120644-89120666 CCTGTGACCCAGAGAGAAGATGG - Intronic
1143659627 17:8316452-8316474 CCTGAGACCCAGCGAGCAGAAGG - Intronic
1143739995 17:8945459-8945481 CTGGTGACCCAGAGAGAGCCTGG + Intronic
1144390094 17:14785106-14785128 GTTGTGAGCGAGTGAGCACAGGG - Intergenic
1144798048 17:17905862-17905884 CTGGGGACCCAGATAACACAGGG - Intronic
1144805487 17:17963718-17963740 CTTGTGACCTTCACAGCACATGG - Intronic
1146731155 17:35194766-35194788 CACATGCCCCAGAGAGCACAGGG + Intergenic
1146905470 17:36615147-36615169 ACTGTGACCGAGAGGGCACATGG - Intergenic
1148338896 17:46861462-46861484 TATGTGCCCCAGAGAGCCCATGG - Intronic
1149383754 17:56121724-56121746 CATGTGACCCAGAGAATAAAGGG + Intronic
1150205640 17:63404218-63404240 CTTGTGCACCTGAGAGCCCATGG + Intronic
1151948173 17:77330683-77330705 CTTGCCTCTCAGAGAGCACATGG + Intronic
1152292077 17:79445716-79445738 CTTGTGACTCTGGGAGCACATGG - Intronic
1152445429 17:80340015-80340037 CTTGTGCCCCAGGGAGCCCAGGG - Exonic
1152576080 17:81141604-81141626 CTTGTGTCCCAGGAGGCACAGGG - Intronic
1157700041 18:49756552-49756574 CTTGTGGCCTAGAGGGCACTGGG - Intergenic
1160942117 19:1625289-1625311 CATCTGACACAGAAAGCACATGG + Intronic
1164777885 19:30868392-30868414 GCTGTGGTCCAGAGAGCACAGGG + Intergenic
1164777922 19:30868671-30868693 CATGTGTGCCAGTGAGCACATGG - Intergenic
1166907897 19:46126561-46126583 CTTGTGCCCCATAAAGCACTTGG + Intergenic
1202702124 1_KI270712v1_random:172465-172487 CGTGGGACCCTGAGAACACAAGG - Intergenic
926158152 2:10469464-10469486 CTGGTGCTCCAGAGTGCACAAGG - Intergenic
926421668 2:12705754-12705776 CTTATGAGCCAGAAATCACATGG - Intergenic
926547107 2:14255514-14255536 CCTGGGTCCCCGAGAGCACAGGG + Intergenic
927298718 2:21485124-21485146 CATGTCACCCAAAGAACACAGGG - Intergenic
927408591 2:22799947-22799969 CCTGTGACCCAGTGAGCAAGAGG - Intergenic
930030591 2:47056074-47056096 CCTGGGACCTAGAGGGCACAAGG - Intronic
930404685 2:50940535-50940557 CTTGTGACCCAGAGAGCACAAGG - Intronic
933844690 2:86315736-86315758 ATGGTGACCCAGAGAGCATCTGG - Intronic
934173037 2:89555911-89555933 CGTGGGACCCTGAGAACACAAGG - Intergenic
934283351 2:91630268-91630290 CGTGGGACCCTGAGAACACAAGG - Intergenic
935927328 2:108083718-108083740 CTCCAGACCCAGAGAGAACATGG + Intergenic
936045250 2:109182539-109182561 CTTGGGACATAGAAAGCACATGG + Intronic
936061697 2:109299026-109299048 CAGGTGACCCAGAGGGCACTGGG - Intronic
937248391 2:120508869-120508891 CCTGGGACCCAGACAGCATAAGG + Intergenic
938009722 2:127819361-127819383 CCCTTGGCCCAGAGAGCACATGG + Intergenic
938211332 2:129467659-129467681 TTTTAGAGCCAGAGAGCACAGGG - Intergenic
941731481 2:168922612-168922634 CTTGGGAGCCAGAAAGCAAATGG - Intergenic
943039640 2:182788650-182788672 CTTTTGTCCCAGAGAACAAAAGG + Exonic
943436382 2:187869480-187869502 CTGGAGACCCAGAGAGCAGCTGG - Intergenic
946909554 2:224445975-224445997 CTTGATACCCAGACAGGACAAGG - Intergenic
948479465 2:238240714-238240736 CTGGTGACCCGCAGAGCCCAGGG - Intergenic
1174149021 20:48473086-48473108 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174149047 20:48473244-48473266 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174149085 20:48473495-48473517 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174558306 20:51412339-51412361 CTTGTGACTCAGAATGCAGACGG - Intronic
1175919084 20:62441671-62441693 CTGGTGACCCTGGGAGCAGAGGG - Intergenic
1175919166 20:62441973-62441995 CTTGTGACCCTGAGAGGAGGGGG + Intergenic
1179798713 21:43800425-43800447 CCTGAGACCCAGATAGCACTTGG - Intronic
1179966028 21:44806319-44806341 CTTGAGGGCCAGAGAGCACGTGG + Exonic
1179969834 21:44829439-44829461 CTTGTGATCCAAAGAGCATTAGG + Intergenic
1181546473 22:23605398-23605420 CTAGTGACCCACAGACCCCAGGG + Intergenic
1181589882 22:23877537-23877559 GTTGGGACCAAGAGAGGACAGGG - Intronic
1182181290 22:28351415-28351437 CTTGAGATCAAGAGAGCCCACGG - Intronic
1182357234 22:29727734-29727756 CATGTAACCCAGTGAGCGCATGG - Exonic
1182743706 22:32588258-32588280 CTTGCGGCCCAGAGAGGACAAGG - Intronic
1183309537 22:37101876-37101898 CCAGTGCCCCAGATAGCACAGGG - Intronic
1184272057 22:43390056-43390078 CTTGTCACACAGTGATCACATGG - Intergenic
1184396493 22:44244994-44245016 CTTGTCTTCCAGAGGGCACAGGG + Exonic
949159375 3:861318-861340 CTGGAGACCCAGAGAGCAGCTGG - Intergenic
950669457 3:14517364-14517386 TTTGAGACCCAGAGAGGAAAGGG - Intronic
950994371 3:17479957-17479979 CCTGGGACCCCAAGAGCACAGGG - Intronic
951264817 3:20552880-20552902 CTTGGGCCCCCAAGAGCACAGGG + Intergenic
953447668 3:42981311-42981333 CTTGAGGTCCAGAGACCACAGGG + Intronic
953504688 3:43473474-43473496 CGTGTGGCACTGAGAGCACAGGG - Intronic
953519200 3:43625038-43625060 CTTGGAAGCCAGAGAGAACATGG - Intronic
954453624 3:50585269-50585291 CCTGCAACCCAGAGAGTACAGGG - Intergenic
955112127 3:55959704-55959726 CTGGTGAGCCAGAGAGCACAGGG + Intronic
955867962 3:63405525-63405547 GATGAGACCCAGATAGCACAGGG + Intronic
956750073 3:72338031-72338053 CTTGTCAGCCAGAGAGGCCATGG - Intergenic
957417770 3:79929011-79929033 CCTGAGCCCCTGAGAGCACAGGG - Intergenic
957789375 3:84919224-84919246 CACATGCCCCAGAGAGCACAGGG - Intergenic
959135194 3:102409883-102409905 CTTGTGCCTCAGAAAGCATAGGG + Intronic
959476667 3:106820996-106821018 CCTGGGCCCCCGAGAGCACAGGG - Intergenic
960068697 3:113403998-113404020 ATTCTGACCCTGAGAGCACCTGG + Exonic
961683363 3:128613597-128613619 CTTGAGGCCCAGAGAGGTCAGGG + Intergenic
961793410 3:129392700-129392722 CTGGTGACTCAGAGAGGGCATGG + Intergenic
961807407 3:129499318-129499340 CTGGTGACTCAGAGAGGGCATGG + Intronic
965124480 3:164607961-164607983 CTTGTGACCCCTAATGCACAAGG + Intergenic
966585596 3:181620713-181620735 GTTTTGACCCAGAGGGTACAGGG - Intergenic
973877532 4:55235126-55235148 CTTCTCACCCAGGAAGCACAAGG + Intergenic
974628818 4:64457410-64457432 CCTGGGCCCCTGAGAGCACAAGG - Intergenic
976913359 4:90337330-90337352 GTTGTGACCCACAGTGGACAAGG + Intronic
980285768 4:130776908-130776930 CATCTCACCCAGAAAGCACAAGG + Intergenic
982087742 4:151853564-151853586 CATGTGGCCCAGAGAACTCATGG + Intergenic
982904321 4:161048799-161048821 CCTGGGACCCATAGAGTACAGGG + Intergenic
982961251 4:161840194-161840216 CTTGTGCTCCCGAGAGTACATGG - Intronic
983215857 4:165002088-165002110 CATGTGTTTCAGAGAGCACAGGG - Intergenic
983501815 4:168507898-168507920 CTTGGATCCCAGAGAGCACATGG - Intronic
984296551 4:177861653-177861675 CCTGGGCCCCCGAGAGCACAGGG - Intronic
985171944 4:187159607-187159629 CTTGTGCCACAGTGAGCACTAGG + Intergenic
985293697 4:188412223-188412245 TTAGTGAACCTGAGAGCACAGGG - Intergenic
986064920 5:4225883-4225905 CTAGGGACACAGAGAGAACACGG - Intergenic
986256887 5:6108259-6108281 CCTCTGGCCCAGAGAGTACAGGG + Intergenic
988065505 5:26225846-26225868 CTTGAGACCCAGAGAGGAGCTGG - Intergenic
993689603 5:90983213-90983235 CTTCTGTCCCAAAGAGCTCAAGG - Intronic
998216473 5:140241596-140241618 CCTGTGACAGGGAGAGCACAGGG + Intronic
999871829 5:155759574-155759596 CTTGTGTACAAGATAGCACATGG + Intergenic
1002442441 5:179271408-179271430 CCTGTGTCCCCGAGAGCTCAGGG - Intronic
1004476054 6:15973267-15973289 CCTGAGACCCAGAGAGCCAATGG - Intergenic
1004634832 6:17456698-17456720 CTTGAGAACCAGACAGCAAAGGG - Intronic
1004747588 6:18526648-18526670 TCTGTTACCCAGGGAGCACATGG + Intergenic
1006602649 6:35236207-35236229 ATTGTGACCTAGAGAGCAAAGGG + Intronic
1006917494 6:37603923-37603945 CTGATGCCACAGAGAGCACAGGG - Intergenic
1007214698 6:40228071-40228093 CTTGGGCCCCCGAGAGCACAGGG - Intergenic
1007461988 6:42025706-42025728 CTTGTGACTCAGAGCCCAAAAGG - Intronic
1007503039 6:42313162-42313184 CTTGTGACCCTGAGATCGCCTGG + Intronic
1009049185 6:58258285-58258307 CACATGCCCCAGAGAGCACAGGG - Intergenic
1012100737 6:95083614-95083636 CTCGGGACCCCGGGAGCACAGGG - Intergenic
1013839929 6:114379277-114379299 GTTGAGACCCATAGAGAACATGG - Intergenic
1014208451 6:118682595-118682617 CTTGTTACCCAAAGAGCACAAGG + Intronic
1014760634 6:125352865-125352887 CTTGTGACCTTGAGAACAGAAGG - Intergenic
1017423320 6:154295547-154295569 CTTGGGGAACAGAGAGCACAGGG + Intronic
1018006311 6:159625516-159625538 CTTGAGACCTAAAGAGAACAGGG + Intergenic
1018026318 6:159809067-159809089 CTTGTGACCGAGAGAGCTGTTGG + Exonic
1018576631 6:165266515-165266537 CCTGGGAGCCAGAGAGCCCATGG - Intergenic
1019521718 7:1463667-1463689 CTGGGGACCCAGGGAGGACATGG + Intergenic
1020169299 7:5832681-5832703 CTTGGGAGGCAGAGATCACAGGG - Intergenic
1020835506 7:13145300-13145322 ACTGTAACCCAGAGAGGACAAGG - Intergenic
1021838482 7:24703678-24703700 GGTGTGACCCAGAGAGTACATGG + Intronic
1026365475 7:69644164-69644186 CTTGCTACACAGAGAACACAGGG - Intronic
1027682087 7:81233620-81233642 CTCGGGCCCCTGAGAGCACAGGG + Intergenic
1027735024 7:81920905-81920927 CCTGGGCCCCTGAGAGCACAGGG + Intergenic
1028145637 7:87317323-87317345 CTTGTACTTCAGAGAGCACAAGG - Intergenic
1028819021 7:95184268-95184290 CTTGTGACCCATAGTTCACGAGG + Intronic
1029111375 7:98214492-98214514 CTTGGGACAGAGAGAGCCCAGGG + Intergenic
1030828406 7:114190048-114190070 CTTAGGACCCAGACATCACAAGG + Intronic
1030884547 7:114922171-114922193 CTCCTGACCCAGACAGCGCAGGG + Exonic
1030930912 7:115522278-115522300 GCTGTGACTCAGAGAGCACCAGG - Intergenic
1032914779 7:136477663-136477685 CTTGGGAAGCAGAGAGCCCAGGG - Intergenic
1033290462 7:140078621-140078643 GTGGTGACCCAGAGAGCAACAGG + Intergenic
1034107247 7:148500988-148501010 CTTGAAACCCAGAGGGCACCTGG + Intergenic
1034561702 7:151884353-151884375 CTTTTGACCCACATGGCACAGGG - Intergenic
1036082099 8:5568161-5568183 CTTGGGACCCACCGAACACAGGG - Intergenic
1036737380 8:11330623-11330645 CACATGCCCCAGAGAGCACAGGG - Intergenic
1039040064 8:33399355-33399377 TAGGTGAACCAGAGAGCACAAGG - Intronic
1041274313 8:56142075-56142097 CCTGGGCCCCAGAGAGTACAGGG - Intergenic
1041459073 8:58091777-58091799 CTTGTAACCCAGAGACCACATGG - Intronic
1043533130 8:81172033-81172055 CTTGGGCCCCCGAGAGCACAGGG + Intergenic
1044771713 8:95642571-95642593 CTAATGACCTAGAGACCACATGG - Intergenic
1045658560 8:104412039-104412061 TGTGCAACCCAGAGAGCACATGG - Intronic
1046209164 8:111044089-111044111 CTGGTGTCCCTGAGAGCCCATGG + Intergenic
1048548054 8:135405167-135405189 CCTGGGCCCCTGAGAGCACAGGG + Intergenic
1049494417 8:142923027-142923049 CATGTGGCCCAGAAAGCAGAGGG + Intergenic
1050589795 9:7149388-7149410 CCTGGGACCCTGAGAGCACAGGG + Intergenic
1051389897 9:16552658-16552680 CTTGTGTCCCATAGAGCATCAGG + Exonic
1055381301 9:75709869-75709891 CTTGTAACTCACAGAGCACTAGG - Intergenic
1057933045 9:99212507-99212529 CTTAGGACTCAGGGAGCACATGG + Intergenic
1058279665 9:103098441-103098463 CTTGGGACCTAGAGAAAACAGGG + Intergenic
1058604200 9:106703238-106703260 CTTGTGAACCATATAGTACATGG + Intergenic
1058683724 9:107462880-107462902 CCTGTGAGTCAGAGAGCAAAAGG + Intergenic
1058925078 9:109655335-109655357 CTTGTCACCCAGAGGGCCTATGG - Intronic
1059290593 9:113220935-113220957 ATTGTGACCCAGAATGCAAAAGG + Intronic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1060361671 9:122964910-122964932 CTTTTGAGCCAGAGAGGTCAAGG + Intronic
1060618737 9:125043966-125043988 CTTAAGACCCTGAGAACACAGGG - Intronic
1061257217 9:129460015-129460037 CCTGTGAGCCAGAGAGCACTGGG + Intergenic
1061893179 9:133633420-133633442 CATGTGGCCAAGAGAGCACCTGG + Intergenic
1062194275 9:135264263-135264285 CTGATGACCCACAGAGAACAGGG - Intergenic
1188727870 X:33607398-33607420 CTTGGGCCCCTGAGAGTACAGGG + Intergenic
1188815543 X:34708518-34708540 GCTATGACCAAGAGAGCACATGG - Intergenic
1190430258 X:50371918-50371940 CTAGTGACCAAGAGACCACAAGG + Intronic
1190845124 X:54183699-54183721 CCTGTGACCCTGTGAGCACAAGG - Intergenic
1190992386 X:55565969-55565991 GGTGTGACCCACAGAGAACAAGG + Intergenic
1192346753 X:70315749-70315771 CTTGAGACTAAGAAAGCACAAGG - Intronic
1194666707 X:96684554-96684576 CTAGTGGCCCAGCGAGAACAGGG - Intergenic
1195857141 X:109343642-109343664 CTCATGACCCACAGAACACATGG - Intergenic
1198183970 X:134236626-134236648 CTTGTATCTCAGAGAGCCCATGG - Intergenic
1198206998 X:134475733-134475755 CTTGTTTCCTAGAAAGCACATGG + Intronic
1200952803 Y:8917774-8917796 CACATGCCCCAGAGAGCACAGGG + Intergenic
1201014305 Y:9583397-9583419 TATGTGACCCACAGAGAACAGGG + Intergenic
1201720293 Y:17089543-17089565 CCTGGGCCCCTGAGAGCACAAGG - Intergenic