ID: 930406041

View in Genome Browser
Species Human (GRCh38)
Location 2:50956867-50956889
Sequence TCAGCCCCAGTTTACATACA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 497
Summary {0: 1, 1: 0, 2: 5, 3: 49, 4: 442}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930406036_930406041 26 Left 930406036 2:50956818-50956840 CCTTACAGATGACATTCATCCTA 0: 1
1: 0
2: 0
3: 9
4: 120
Right 930406041 2:50956867-50956889 TCAGCCCCAGTTTACATACACGG 0: 1
1: 0
2: 5
3: 49
4: 442
930406039_930406041 7 Left 930406039 2:50956837-50956859 CCTAACAAACTCAATGAGGAGGT 0: 1
1: 0
2: 0
3: 5
4: 130
Right 930406041 2:50956867-50956889 TCAGCCCCAGTTTACATACACGG 0: 1
1: 0
2: 5
3: 49
4: 442

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930406041 Original CRISPR TCAGCCCCAGTTTACATACA CGG Intronic
901333160 1:8425926-8425948 TTATCCCCATTTTACAGACAAGG + Intronic
902043728 1:13510509-13510531 TCAGCCCCATTTTACAGATGAGG + Intronic
902576530 1:17381429-17381451 TCATCCCCATTTTACAAATAGGG - Intronic
902735799 1:18399767-18399789 TCACCCCCATTTTATAGACAGGG + Intergenic
903035254 1:20488722-20488744 TCAGGCCCATTTCACAGACAAGG + Intergenic
903834496 1:26194137-26194159 TCAGCCCCATTTCTCAGACAAGG - Intronic
904233940 1:29101338-29101360 TTATCCCCACTTTACAAACAAGG - Intronic
904630337 1:31836828-31836850 TTAGCCCCATTTTACAGACGAGG - Intergenic
904881170 1:33698320-33698342 TGAGCCCCATTTTACCTATAGGG + Intronic
904883482 1:33718055-33718077 TCATCTCCAGTTTACATCCAAGG + Intronic
905114593 1:35626700-35626722 TTATCCCCATTTTACTTACAAGG - Intronic
905432245 1:37932669-37932691 TTATCCCCATTTTATATACAAGG + Intronic
905812659 1:40923901-40923923 TCAGCCTCATTTTGCAGACAAGG - Intergenic
905944469 1:41890111-41890133 TCATCCCCATTTTACAGACAAGG - Intronic
906304954 1:44711894-44711916 TCATCCCCAGTTTACAGATGAGG + Intronic
906948725 1:50317268-50317290 TCAGCCCCATTTTAGAGACGAGG + Intergenic
907218461 1:52886357-52886379 TCAGCCTCATTTTACAGACAAGG - Intronic
907545632 1:55257548-55257570 TTATCCCCATTTTACAAACAAGG - Intergenic
907638209 1:56157853-56157875 GTAGCCCCATTTTATATACAAGG - Intergenic
908392231 1:63693913-63693935 TTATCCCCAGTTTACAGAAAAGG - Intergenic
908517929 1:64912655-64912677 TCATCCCCATTTTACATTCCGGG + Intronic
909565811 1:77052415-77052437 TTATCCCCATTTTACAAACAAGG - Intronic
910503402 1:87921194-87921216 TCAGCCTCAGTTTCCTCACAAGG - Intergenic
910803666 1:91169891-91169913 TCATCCCCATTTTACAAACAAGG + Intergenic
910844893 1:91595255-91595277 TTAGCCCCATTTTATAGACAAGG - Intergenic
910873619 1:91856994-91857016 TCACCTCCATTTTACAAACAAGG - Intronic
911746171 1:101444115-101444137 TTAGCCCCAGTTTTGCTACATGG + Intergenic
913124120 1:115769490-115769512 TCAGCCCCACTTTACATAGAGGG - Intergenic
914250137 1:145915231-145915253 TAGGCACCAGTGTACATACAGGG - Intronic
914420490 1:147524057-147524079 TCAACCCCATTTCACAGACAAGG - Intergenic
915105374 1:153532290-153532312 CCTGCCCCAGTTTACAGAGATGG + Intergenic
916190125 1:162170329-162170351 TTAGCCCCATTTTACAGATAAGG + Intronic
916632993 1:166637140-166637162 TCAGCTCCAGTTTACACTCATGG + Intergenic
916759346 1:167802529-167802551 TTATCCCCATTTTACAAACAAGG + Intergenic
917634633 1:176923020-176923042 CTAGCCCCATTTTACAGACATGG + Intronic
917678774 1:177345024-177345046 TTATCCCCAATTTACAGACAGGG + Intergenic
917964439 1:180169502-180169524 TCATCCCATGTTTACAGACAAGG - Intronic
919569172 1:199224207-199224229 TCAGCACCAGTTGATAGACAGGG + Intergenic
920727687 1:208451725-208451747 TCAGCCCCTGTTCTCATTCATGG + Intergenic
920974209 1:210770410-210770432 TCAGCCCCTTTTCACAAACAAGG + Intronic
921812457 1:219530270-219530292 TTAGCCCCATTTTACAGATAAGG - Intergenic
922090865 1:222393865-222393887 TAAGCCAAACTTTACATACATGG + Intergenic
923346768 1:233061247-233061269 GCAGCCAGAGTTTAAATACAGGG + Intronic
924617136 1:245621336-245621358 TTAGCCCCATTTTACATATAAGG - Intronic
1063724162 10:8618433-8618455 TTAGCCACAGTTTACAGATAAGG - Intergenic
1063766063 10:9141776-9141798 ATAGCCCCAGTTTTCATATAAGG - Intergenic
1064074106 10:12255204-12255226 TCAGCCACAGTTTATAAGCAGGG + Intergenic
1065245541 10:23752929-23752951 TCACCCCCATTTTACACAGAAGG + Intronic
1065351927 10:24803664-24803686 TAAGCCTCAGATGACATACAAGG + Intergenic
1065981274 10:30900602-30900624 TGATCCCCATTTTACATACAAGG + Intronic
1066216162 10:33289963-33289985 TCACCCCCACTTTAAATCCAGGG + Intronic
1067996954 10:51284334-51284356 TTAGCCCCACTTTACGTACTAGG + Intronic
1068533743 10:58217281-58217303 AAAGCCCCAGTTATCATACATGG + Intronic
1069061642 10:63901089-63901111 TCAGCCCCATTTTACAGATGAGG + Intergenic
1070055647 10:72932197-72932219 TCATCCCCATTTTACAGATAAGG - Intronic
1070282442 10:75059582-75059604 TTAGCCCCATTTTACAGATAAGG + Intergenic
1070480837 10:76881300-76881322 TCAGCCCTATTTTACAGAAAAGG - Intronic
1070748415 10:78949046-78949068 GCAGGATCAGTTTACATACATGG - Intergenic
1070759813 10:79017052-79017074 TCATCCCCATCTTACAGACAAGG + Intergenic
1072519781 10:96221141-96221163 TCAGCCCCACTTTACAGATGAGG - Intronic
1072725345 10:97809424-97809446 TGACCCCCATTTTACAGACAGGG + Intergenic
1074189184 10:111121461-111121483 TCACCCCCATTTTACATGTAAGG + Intergenic
1074500202 10:114016917-114016939 TCTGTCCCATTTTACAGACAAGG + Intergenic
1074542935 10:114380364-114380386 TCATTCCTAGTTTAAATACAAGG - Intronic
1075065412 10:119285914-119285936 TGAGCCCCATTTTGCAGACAGGG - Intronic
1075576511 10:123581559-123581581 TAAGCCCCATTTTACAGAGAAGG + Intergenic
1076623393 10:131807347-131807369 TCAGACCCAGCTTCCAGACATGG + Intergenic
1077421428 11:2451939-2451961 TCAGGCCCAGTTTGTATCCATGG + Intronic
1078468075 11:11565096-11565118 TCAGAACCAGTGTACATACTGGG - Intronic
1079525360 11:21380600-21380622 TCAACCCCATTTTTCATCCAAGG - Intronic
1080420174 11:32102987-32103009 TCATCTCCATTTTACAGACAAGG + Intronic
1080605784 11:33863945-33863967 TCATCCCCATTTTACAGATAAGG + Intronic
1082763284 11:57146742-57146764 TCACTCCCATTTTACAGACAAGG - Intergenic
1082851332 11:57767655-57767677 TTATCCCCATTTTACAGACAAGG - Intronic
1083364163 11:62131270-62131292 TTAGCCCCAGTTGACAGGCAAGG - Intronic
1084326960 11:68406058-68406080 TCATCCCCATTTTTCATTCAAGG - Intronic
1084947497 11:72646389-72646411 TTAGCCCCATTTTACAAATAAGG + Intronic
1085260558 11:75202392-75202414 TTAGCCCCATTTTACAGATAAGG - Intronic
1085420372 11:76353338-76353360 TCGGCCCCACTTGACAAACAAGG + Intronic
1085547452 11:77333061-77333083 TCATCCCTACTTTACAGACAGGG - Intronic
1085706427 11:78790360-78790382 TCAACCCCATTTTACAGAAATGG - Intronic
1086018841 11:82200679-82200701 TCATCCTCATTTTACAGACAAGG + Intergenic
1086920022 11:92575592-92575614 TCAGCCCCATTTTAAAGATAAGG - Intronic
1087007768 11:93486178-93486200 TCATCCCCATTTTGCAGACAAGG + Intronic
1087935346 11:104027510-104027532 TCATCCCCATTTTACATAAGAGG + Intronic
1089747575 11:120627963-120627985 TCAGGCCCATTTTACAGATAAGG - Intronic
1090207654 11:124894843-124894865 TTATCCCCAATTTACAGACATGG - Intronic
1090382370 11:126336450-126336472 TCAGCCCCATTTTACAAAGGAGG + Intronic
1090448785 11:126787989-126788011 TCACCCCCATTTTACAGGCAGGG + Intronic
1090700781 11:129293721-129293743 TCATCCCCACTTTACAGATAAGG + Intergenic
1091446962 12:549329-549351 TCATTCCCAGTTTACAGATAAGG - Intronic
1091639660 12:2226327-2226349 TCATCCCCATTGTACATAAAAGG + Intronic
1092158992 12:6305146-6305168 TTATCCTCATTTTACATACAAGG + Intergenic
1093226575 12:16491249-16491271 TCAGCTCCATTTTACACATAAGG - Intronic
1095946138 12:47754558-47754580 TCAACCCCAGTTTACAGATGAGG - Intronic
1096299339 12:50412073-50412095 TCATCCACATTTTACAGACAAGG - Intronic
1096390868 12:51228089-51228111 TTAGCCCCATTTTACAAATAAGG - Intergenic
1096802884 12:54123182-54123204 TTAACCCCATTTTACAGACAAGG + Intergenic
1097827611 12:64190323-64190345 TTAGCCCCATTTTACAGACAAGG + Intronic
1098106809 12:67076207-67076229 TTAGCCCCATTTTACAGATAAGG - Intergenic
1098188933 12:67927141-67927163 TCAGACCCATTTTACTGACAAGG + Intergenic
1098643461 12:72867558-72867580 TCATCCCCATTTTACAGATAAGG - Intergenic
1098932392 12:76434593-76434615 TTAGCCCCATATTAGATACATGG - Intronic
1099317562 12:81103900-81103922 TTAATCCCATTTTACATACAAGG - Intronic
1100088278 12:90937583-90937605 TTATCCCCAATTTACATATAAGG - Intronic
1101016091 12:100502162-100502184 TCAACCCCATTTTACAACCAAGG + Intronic
1101285284 12:103305586-103305608 TTATCCCCATTTTACAGACAAGG - Intronic
1101339507 12:103830170-103830192 TTAGCCCCATTTTACATATAAGG + Intronic
1101385132 12:104250569-104250591 TCATCCCCATTTTACAAACAAGG - Intronic
1101426657 12:104593738-104593760 TCACACCCATTTTACAGACAAGG - Intronic
1101753020 12:107598767-107598789 ACATCCCCATTTTACAGACAAGG + Intronic
1102019666 12:109673422-109673444 TCATCCTCATTTTACATAGAGGG - Intergenic
1102416560 12:112767692-112767714 TCATACCCAGTTTTCATATAAGG - Intronic
1102467576 12:113138908-113138930 CCAGCCCCAGATTCCAGACATGG + Intergenic
1102548916 12:113676715-113676737 TCATCCCCATTTTACAGATAAGG - Intergenic
1102551148 12:113693157-113693179 TCGTCCCCATTTTACAGACAAGG + Intergenic
1102898041 12:116614306-116614328 TCATCCTCATTTTACAAACAAGG - Intergenic
1103147174 12:118604901-118604923 TCAGCTCCATTTCACAGACAAGG - Intergenic
1103897221 12:124280622-124280644 TGAGCCCCATTTTACAGACAAGG + Intronic
1104338736 12:127927055-127927077 TCAGCCCCATTTCACAGACAAGG - Intergenic
1105476435 13:20731682-20731704 TCAGTCCTAGTTTACAGATAAGG + Intronic
1105545211 13:21346288-21346310 TTAGCCCCATTTTACAGAGAAGG + Intergenic
1105838339 13:24230590-24230612 TCACCCACAGTTTACAGGCAAGG - Intronic
1106698933 13:32208426-32208448 TCAGTCCCATTTTACCGACAAGG + Intronic
1108061711 13:46539779-46539801 TCATCCTCATTTTACATATAAGG + Intergenic
1108235573 13:48400716-48400738 TTATCCCTATTTTACATACAAGG - Intronic
1108470148 13:50759410-50759432 CCATCCCTAGTTTACACACATGG - Intronic
1108479419 13:50853342-50853364 TTATCCCCAGTTTACAGATAAGG - Intergenic
1110844739 13:80181294-80181316 TTATCCCCATTTTACATATAAGG - Intergenic
1112364055 13:98741944-98741966 TCAGCACCAGTTTCCCCACATGG - Intronic
1113377413 13:109778198-109778220 TTACCCCCATTTTACAGACAGGG + Intronic
1115485898 14:33911159-33911181 TGAGCCCCATTTTATAGACAAGG + Intergenic
1115722062 14:36173515-36173537 TCAGCACCATTCTACTTACAAGG + Intergenic
1115834868 14:37390295-37390317 TCAGCCCCACTTTATCTACCTGG + Intronic
1116111056 14:40582778-40582800 GCATACCCAGTCTACATACATGG - Intergenic
1116187757 14:41619812-41619834 TTAGCCCCATTTTACAGATAAGG - Intronic
1116403982 14:44545590-44545612 TCTGCCCAAGTTTTCATTCAGGG + Intergenic
1116612982 14:47101871-47101893 TGAACCCCAGTATACATACTTGG - Intronic
1118775430 14:68970927-68970949 TTATCCCCATTTTACATGCAGGG - Intronic
1118913783 14:70083745-70083767 TCTGCCCAAGTTCACATAGATGG + Intronic
1119304311 14:73595133-73595155 TCAGCCACAGTTTCCATCAATGG + Exonic
1119617024 14:76105515-76105537 TCAGCCCCATTTTACAGATGAGG + Intergenic
1119946920 14:78704754-78704776 TTAGCCCCATTTTACAGACATGG - Intronic
1120372028 14:83648178-83648200 TCACCCTCAGGTTACAAACAAGG + Intergenic
1121284425 14:92724278-92724300 TCATCCCCATCTTACAGACAGGG + Intronic
1122581481 14:102774502-102774524 TCAGCCCAAGTTGACCCACAGGG + Intergenic
1123074190 14:105658776-105658798 GCAGACCCAGTTTTCACACAAGG - Intergenic
1123781312 15:23631710-23631732 TCAGCCCTTGTTTTCTTACATGG - Intergenic
1123804088 15:23853682-23853704 TTAGCCTCAATTTTCATACAAGG + Intergenic
1124467453 15:29950890-29950912 TCAGCCTCATTTTACAGATAAGG - Intronic
1124985238 15:34603212-34603234 TCAGCCACAGTTGACGTAGACGG + Intergenic
1125209696 15:37198899-37198921 TCAGCCTCAGTATACAGACATGG + Intergenic
1125584093 15:40808004-40808026 TTAGCCCCATTTTACAGAAATGG - Intronic
1125856849 15:42958460-42958482 TTATCCCTAGTTTACAGACAGGG - Intronic
1126330959 15:47530857-47530879 TTAGCCCCATTTTATAGACAAGG - Intronic
1126468134 15:48979348-48979370 TCAGCCCCATTTTACAGATAAGG - Intergenic
1127601130 15:60538017-60538039 TCATCCCCATTTTACAGATACGG + Intronic
1127985638 15:64068208-64068230 TCATCCCCATTTTACAAACGAGG + Intronic
1128187330 15:65653680-65653702 TTAGCCCCATTTCACAGACAAGG - Intronic
1128554712 15:68623544-68623566 CCAGCCTCTGTTTACATGCAGGG - Intronic
1128744212 15:70102358-70102380 TCAGCCCCATTTTACAGATGGGG + Intergenic
1128894366 15:71358815-71358837 TCATCCCCATTTTACACAGAAGG - Intronic
1129406430 15:75322076-75322098 CCTGCCCCAGCTTACCTACATGG - Intergenic
1129646924 15:77444182-77444204 TTAGCCCCATTTTACATATAAGG + Intronic
1130111616 15:80969942-80969964 TCATCCCCATTTTGCACACAAGG - Intronic
1130355247 15:83123646-83123668 CCAGCCTGAGTTTACATAGAAGG - Intronic
1130705944 15:86233031-86233053 TGATCCCCATTTTACATGCAAGG + Intronic
1131372310 15:91892825-91892847 TTATCCCCATTTTACGTACAAGG - Intronic
1133003810 16:2866249-2866271 TAATCCCCATTTTACACACAAGG + Intergenic
1133352859 16:5113752-5113774 TCATCCCCAAGTTACAGACAAGG - Intergenic
1134039935 16:11060562-11060584 TCAGCCCCATTTCACAGACCGGG - Intronic
1134487867 16:14672911-14672933 TCAGCCCCATTTTACAGAAAAGG + Intronic
1134681644 16:16130135-16130157 TTATCCCCAGTTTACACACAAGG - Intronic
1135117820 16:19738586-19738608 TCAGCCTCATTTTACATGGAAGG - Intronic
1135539223 16:23317176-23317198 TCATCACCATTTTACAGACAAGG - Intronic
1135768280 16:25196826-25196848 TCACCCCCATTTTACAGACAAGG - Intergenic
1135856995 16:26020925-26020947 CCATCCCCATTTTACATATATGG - Intronic
1136143942 16:28304509-28304531 GCAGCCCCATTTTACAGATAAGG - Intronic
1137396940 16:48122890-48122912 TTAGTCCCATTTTACAGACAAGG + Intronic
1137669401 16:50270746-50270768 TCAGCCCCATTTTACAGATAAGG - Intronic
1138100588 16:54249168-54249190 TCATCCCAGGTTTACCTACAAGG + Intronic
1138511802 16:57513024-57513046 TCACCCCCATTTTACAAGCAAGG + Intronic
1138557707 16:57782230-57782252 TGAGCCCCAGTTTAGAGACTGGG + Intronic
1139193115 16:64887769-64887791 TCATCCCTATTTTACAGACAGGG + Intergenic
1139366513 16:66437051-66437073 TCATCCCCATTTTATAAACAAGG - Intronic
1139396248 16:66641543-66641565 TTAGCCCCATTTTACAGATAAGG + Intronic
1139596461 16:67961215-67961237 TCATCCCCATTTTTCAGACAAGG - Intronic
1140226773 16:73083945-73083967 TCAGCCCCAGTTGAGAACCATGG - Intergenic
1141011844 16:80408322-80408344 TTAGCCCCATTTTACAAATAAGG + Intergenic
1141626073 16:85261774-85261796 TCGTCCCCAGTCTACAGACAAGG + Intergenic
1141725560 16:85786165-85786187 TCAGCTCCATTTTACAGACAGGG + Intronic
1142363240 16:89637033-89637055 CCAGCTCCATTTTACAGACAAGG - Intronic
1142605085 17:1077065-1077087 CTAGCCCCATTTTACAGACAAGG + Intronic
1143659855 17:8318188-8318210 TTAGCCCCATTTTACAGATAGGG + Intronic
1143800736 17:9378110-9378132 GAATCCCCATTTTACATACAAGG + Intronic
1144073111 17:11692243-11692265 TTAGTCCCAGTTTACACACAGGG - Intronic
1144429094 17:15174092-15174114 TCAACCACAGATAACATACAAGG + Intergenic
1144656691 17:17041905-17041927 TCATCCCCATTTTACATAGGAGG - Intergenic
1144706185 17:17369884-17369906 TCACCCACATTTTACACACAAGG + Intergenic
1145244892 17:21262263-21262285 TCAGCCTCACTTTACAGAGAGGG + Intergenic
1145264591 17:21373754-21373776 TCACCCCCATTTTACAGAGAGGG + Intergenic
1146022033 17:29287868-29287890 TCAGCCCCATTTTACAGACTAGG + Intronic
1146339425 17:32007042-32007064 TCAGCCTCAGTTTCCCTAGAGGG + Intergenic
1146470218 17:33118361-33118383 TCATCCCCATTTTACAGATAAGG + Intronic
1146498565 17:33344574-33344596 TTAGCCTCAGTTTACAGACAAGG - Intronic
1146958473 17:36951558-36951580 TTAGCCCCATTTTACAGATAAGG + Intronic
1147438604 17:40433061-40433083 GCATCCCCAGTTTACAGATAAGG + Intergenic
1147473032 17:40682164-40682186 TTATCCCCAGTTTACAGATAAGG - Intergenic
1147919034 17:43905472-43905494 ACAGCCCCAGTTTCCATTCCAGG + Intronic
1147976047 17:44248648-44248670 TCATCCCCATTTTACAGACGAGG + Exonic
1148191218 17:45680032-45680054 TGAGCCCCAGTTTCCTGACATGG - Intergenic
1148513698 17:48196098-48196120 TCATCCCCACTTTACAGACTAGG + Intronic
1148594359 17:48841046-48841068 TTAGCCCCAATTTACAGATAAGG + Intronic
1149146797 17:53504265-53504287 TCAGCCCCATTTTACAGATAAGG + Intergenic
1149975739 17:61264065-61264087 TTAACCCCATTTTACAGACAGGG - Intronic
1151576752 17:74956259-74956281 TCATCCCCATTTTACAGACATGG + Intronic
1151598136 17:75090329-75090351 TAAGTCCCAGGTCACATACACGG - Intronic
1153543288 18:6180277-6180299 TTATCCCCATTTTACATATAAGG + Intronic
1154279394 18:12989476-12989498 TTATCCCCACTTTACAGACAAGG + Intergenic
1155234861 18:23809218-23809240 TCAGCTCCAGTTTACAGAAGAGG + Intronic
1155712528 18:28900577-28900599 TTAACCCCTTTTTACATACAAGG - Intergenic
1155724944 18:29069777-29069799 GCAGCCTCAGTGGACATACATGG - Intergenic
1158126176 18:54101818-54101840 TCATCCCCATTTCACAGACATGG + Intergenic
1158547158 18:58406063-58406085 TTAGCACCAATGTACATACAAGG + Intergenic
1158587369 18:58753005-58753027 TCATCCCCATTTTACAGATAAGG - Intergenic
1161161480 19:2763878-2763900 TCAGCCCCATTTTACAGATGGGG - Intronic
1161305381 19:3564434-3564456 TCACCCCCATTTTACAGAGAGGG - Intronic
1161982732 19:7638255-7638277 TCACCCCCAATTTACAGACAGGG - Intronic
1162031601 19:7919913-7919935 TCAGCCCCAGTCTACAGAGGAGG + Intergenic
1162761871 19:12893294-12893316 ACAGCCCCACTTTACAGACTGGG - Intronic
1162836193 19:13319840-13319862 TCATCCCCATTTTACAGCCAAGG + Intronic
1163131356 19:15275346-15275368 TCATCCCCACTTTACAGATAGGG + Intronic
1163488085 19:17601162-17601184 TCATCCCCATTTTACAGAGAAGG - Intergenic
1163492032 19:17622837-17622859 TGAGCCCCATTTTCCAGACAAGG + Intronic
1165718785 19:38064028-38064050 TCATCCCCACTCTACAAACATGG + Intronic
1165811807 19:38616418-38616440 TCATTCCCATTTTACAGACAAGG + Intronic
1165863131 19:38919566-38919588 TCATCCCCACTTTACAGAGAGGG - Intronic
1165900190 19:39165921-39165943 TAAGCCCCGGATTACAGACAGGG - Intronic
1166200481 19:41234208-41234230 TCATCCCCATTTTACAGACAGGG - Intronic
1166280204 19:41787466-41787488 CCTGCCCCACTTTACAGACATGG - Intergenic
1166396532 19:42445261-42445283 CCTGCCCCACTTTACAGACATGG + Intergenic
1166412504 19:42565475-42565497 CCTGCCCCACTTTACAGACATGG + Intergenic
1166504046 19:43360556-43360578 TCACCCCCAGTTTTCATAAGGGG - Intronic
1166506411 19:43374202-43374224 TCACCCCCAGTTTTCATAAGGGG + Intergenic
1166769134 19:45270221-45270243 TCACCCTCAGTTTACATACAAGG + Intronic
1166980730 19:46630649-46630671 TTATCCCCATTTTACAGACAAGG - Intergenic
1167169969 19:47824451-47824473 TCATCCCCACTTTACAGAGAAGG - Intronic
1167218943 19:48184740-48184762 TCATCCCCATTTTACAGACAAGG + Intronic
1168060123 19:53886861-53886883 TCATCTCCACTTTACAAACAAGG - Intronic
925840341 2:7985991-7986013 TTACCCCCATTTTACAGACAAGG - Intergenic
926333280 2:11843477-11843499 TCAGCCCCATTTTATAGATAAGG - Intergenic
926584025 2:14665539-14665561 TTATCCCCATTTTGCATACAAGG + Intergenic
926738843 2:16094571-16094593 TTATCCCCATTTTACAGACAAGG + Intergenic
927461923 2:23306746-23306768 TTGGCCACAGGTTACATACAAGG + Intergenic
927497706 2:23561974-23561996 TTAGCCCCACTTCACAGACAAGG - Intronic
928392149 2:30918355-30918377 TCATCCTCATTTTACATGCAAGG - Intronic
928460222 2:31465596-31465618 GCAGCCCCTGCTTCCATACAAGG - Intergenic
928816388 2:35299890-35299912 TCATCCCCATTTTACAGATAAGG + Intergenic
929452466 2:42047016-42047038 TCAGCACCAACTTACACACAAGG + Intergenic
929577183 2:43059237-43059259 TCACCCCCATTTTACAGACACGG + Intergenic
929822635 2:45285647-45285669 TCAGCCCCATTTTACAGATGTGG - Intergenic
929934584 2:46285591-46285613 TCATCCCCATTTTACAGATAAGG + Intergenic
930406041 2:50956867-50956889 TCAGCCCCAGTTTACATACACGG + Intronic
930728335 2:54704382-54704404 TCATCCCCATTTTACAGATAAGG + Intergenic
931295174 2:60916438-60916460 TCATCCCCATTTTACAAACGAGG - Intronic
931695576 2:64868243-64868265 TCACACCCATTTTACAGACAAGG - Intergenic
931740101 2:65234309-65234331 TCAGCACCAGTTTTCATACAGGG - Intronic
932670042 2:73728982-73729004 TTACCCCCATTTTACACACAAGG - Intergenic
935811004 2:106797028-106797050 TCACCCCCATTTGATATACAAGG - Intergenic
936646720 2:114380405-114380427 TTAGCCCCATTTTAAAGACAAGG - Intergenic
938071806 2:128312329-128312351 GCAGCCCCATTTTCCACACAAGG - Intronic
938370885 2:130767771-130767793 TCAGCCCCATTTTTCAGACCTGG + Exonic
939846676 2:147255105-147255127 TCAACACCAGTTTACACACCTGG + Intergenic
942482050 2:176399078-176399100 TCAGCCCCACTTTTCAAATAGGG + Intergenic
943572072 2:189585455-189585477 TTATCCCCAGTGTACATATAAGG + Intergenic
943646242 2:190409509-190409531 TGAGCCCCAGTTTTCTCACATGG + Intronic
943727108 2:191263191-191263213 GCAGCCTCAGCTTCCATACAGGG - Intronic
944385011 2:199154513-199154535 TCAGCCCCAGTGTACATATTTGG + Intergenic
946407690 2:219500670-219500692 TCACCCCCATTTTACACATAAGG - Intronic
948823566 2:240562864-240562886 TCAGGCCCAGTTTATAAACTGGG - Exonic
1168966594 20:1902309-1902331 TCATCCCCACTTTACAGATAAGG + Intronic
1169966273 20:11221128-11221150 TCATCCCCATTTTACAGACGAGG - Intergenic
1170713513 20:18812771-18812793 TTATCCCCATTTTACATATAAGG - Intronic
1172114530 20:32565623-32565645 ATAGCCCCAGTTTACAGAGAGGG - Intronic
1173132658 20:40409089-40409111 TCACCCCCACTTTACATATGGGG + Intergenic
1173311793 20:41903234-41903256 TTACCCCCATTTTACATATAGGG - Intergenic
1173805078 20:45919550-45919572 TCACCCCCAGTTTACAGATAAGG + Intergenic
1173843272 20:46172882-46172904 TCAGCCCCAGTTCACAGATGAGG - Intergenic
1173895950 20:46550851-46550873 TTAGCCCCATTTTACAGAGAAGG + Intergenic
1174013197 20:47467468-47467490 CCAGCACCAGTTTTCATGCAAGG - Intergenic
1174062425 20:47842289-47842311 TCAGGCCCACGTTACATACGAGG - Intergenic
1174451215 20:50621660-50621682 TTGGCCCCAGTTTCCCTACATGG - Intronic
1174451896 20:50625731-50625753 TCTGCCCCAGTTGACAGGCATGG - Intronic
1175296449 20:57912150-57912172 GCAGCACCAGTCTACAGACAAGG + Intergenic
1175638209 20:60603114-60603136 TTAGCCCCATTTTACAGACAGGG + Intergenic
1175916400 20:62428006-62428028 TTATCCCCAATTTACAGACAGGG - Intergenic
1177996163 21:28101707-28101729 CCATCCACAGTTTATATACAAGG - Intergenic
1179080600 21:38167184-38167206 TCATCCCCATTTTACATATGAGG + Intronic
1179722698 21:43324609-43324631 TCAGCCCCATGTCACAGACAAGG + Intergenic
1180931692 22:19596672-19596694 TCATCCCCATTTTACGGACAGGG + Intergenic
1182019205 22:27066739-27066761 TCAGCCTCATTTTATAGACAAGG + Intergenic
1182302611 22:29346062-29346084 ACACCCCCACTTTACAAACAAGG + Intronic
1182806281 22:33073292-33073314 TCAGCCCCACTCTACAGAGATGG - Intergenic
1183023448 22:35045811-35045833 TCATCCGCATTTTACAGACAAGG + Intergenic
1183259778 22:36787085-36787107 TCAGCCCCACTTTACAGATAAGG - Intergenic
1184657493 22:45949170-45949192 TCATGCCCATTTTACAGACAAGG - Intronic
1185225334 22:49648693-49648715 TCAGCCCCAGTACAGAAACAGGG + Intronic
949630887 3:5924865-5924887 TTATCCCCATTTTACAGACAAGG - Intergenic
950499717 3:13355914-13355936 TAAGCCCCATATTACAAACAGGG + Intronic
950501245 3:13365319-13365341 TCAGTCCCATTTTACAGGCAGGG + Intronic
950681987 3:14591820-14591842 TCTGCCTCAGTTTACCTACTGGG - Intergenic
950915525 3:16641196-16641218 TTATCCCCATTTTACAAACAGGG + Intronic
951539579 3:23769477-23769499 TTATCCCCTTTTTACATACAAGG + Intergenic
953910324 3:46889548-46889570 ACATCCCCATTTTACAGACAGGG - Intronic
954171395 3:48805581-48805603 TTATCCCCAATTTACAGACAAGG - Intronic
954216671 3:49128631-49128653 TCAGCCCCAGATTAGATAACAGG + Intronic
954656866 3:52199116-52199138 TCAACCGCAGTTTATATAAAGGG - Intronic
955220389 3:57018450-57018472 TTAGCCTCATTTTACATGCAAGG + Intronic
956332322 3:68125225-68125247 TCAGTCCAACTTTACAGACAAGG - Intronic
956506395 3:69944688-69944710 TGATCCCCATTTTACAGACAAGG - Intronic
959225447 3:103577166-103577188 TCAGTACCTGTTTACTTACAAGG - Intergenic
959375616 3:105585283-105585305 TCTGCCCCAGTTCCCATCCAGGG + Intergenic
959544650 3:107579745-107579767 TCTTCCCCAGTTTGCATACTCGG + Intronic
959681770 3:109104717-109104739 TCAGGGCCAGTTTACAAACTGGG - Intronic
960551712 3:118983269-118983291 TCATCTCCAGTTTACAAATAAGG + Intronic
960713510 3:120554568-120554590 ACATTCCCAGTTAACATACAAGG - Intergenic
960953069 3:123012148-123012170 TGAGCCCCGGTTTACACACGAGG - Intronic
961064655 3:123865019-123865041 TCAGGCCCTGGTTACATACCTGG + Intronic
961786384 3:129349684-129349706 TTAGCCTCAGTTTCCAAACAGGG - Intergenic
962021505 3:131507020-131507042 TCAACCCCATTTTACAAATATGG + Intergenic
962494725 3:135927553-135927575 TCAGCCTCATTTTTCAGACAAGG - Intergenic
962865126 3:139442186-139442208 TTATCCCCATTTTACAGACAAGG - Intergenic
963233030 3:142928005-142928027 CCATCCCCAGTTTACAGATAAGG - Intergenic
963949072 3:151178678-151178700 TTATCCCCAGTTTACAAATAAGG - Intronic
966105769 3:176331876-176331898 TTATCCCCATTTTATATACAAGG + Intergenic
966166103 3:177018031-177018053 TTATCCCCATTTTACAGACAAGG + Intergenic
966422680 3:179748877-179748899 TTATCCCCAGTTTACAGATAGGG - Intronic
966705726 3:182911520-182911542 TCATCCCCAGTTTACAGATGAGG - Intronic
967091323 3:186137273-186137295 CCAGCCCCATTTTACATGTAGGG + Intronic
967301254 3:188016504-188016526 TCAGCCTCAGTTTACATATGAGG + Intergenic
968574758 4:1360440-1360462 TCCACCCCATTTTACAGACAGGG + Intronic
969130473 4:4987389-4987411 TCGTCCCCAGTTTACCCACAAGG + Intergenic
970331153 4:14985738-14985760 TTAGCCCCATTTTACAGATAAGG - Intergenic
971130253 4:23800828-23800850 TCATCCCCATTTTACAGATAAGG - Intronic
972174406 4:36385835-36385857 TGAGACTCAGTTTACATAAAAGG - Intergenic
972277772 4:37573339-37573361 TTATCCCCATTTTACAGACAAGG + Intronic
972419594 4:38874202-38874224 TCAGCTCCATTTTACAGACGAGG - Intronic
973788384 4:54356444-54356466 TCACCCCCATTTGACATCCAAGG + Intergenic
973819268 4:54648449-54648471 TTAGCCCCATTTTACAGATAAGG - Intergenic
973832037 4:54771441-54771463 TAAGCCTCAGTTTTCTTACAAGG + Intergenic
974689642 4:65279974-65279996 TCATCTCCACTTTAGATACAAGG + Intergenic
975541118 4:75513428-75513450 TCATCTCCATTTTACATACGGGG + Intronic
976049238 4:80991661-80991683 TTAGCCTCAGTTTCCATACCTGG - Intergenic
977743594 4:100517772-100517794 TCAGCCTCAGTTTACTTTCAGGG - Intronic
979096392 4:116556242-116556264 TCAGCCTCAGTTTTCAAAAATGG - Intergenic
979456463 4:120930939-120930961 TAAGCCTCATTTTACACACAAGG + Intergenic
980084162 4:128374456-128374478 TCATCCCCATTTTACAGATAAGG + Intergenic
980273603 4:130618940-130618962 TCAGCCTAAGTGTAGATACATGG + Intergenic
982305505 4:153926416-153926438 TCATCCCCATTTCACATATAAGG - Intergenic
983961388 4:173759369-173759391 TCATGCCCATTTCACATACATGG - Intergenic
983976243 4:173937705-173937727 TCAGCCCCTGTTTAAAATCATGG + Intergenic
987193102 5:15499743-15499765 TCCGCCCCAGTCTCCAAACAGGG + Intergenic
988435169 5:31165719-31165741 TCAGGCCCATTTAACAGACAAGG + Intergenic
988562729 5:32295709-32295731 TCATCCCCACTTTACAGATAAGG + Intronic
992128189 5:73664489-73664511 TTATCCCCATTTTACATATAAGG - Intronic
992430423 5:76705336-76705358 TTATCCCCAATTTACACACAGGG + Intronic
993475143 5:88355458-88355480 TCAGCCACAGTTGAAATATAAGG + Intergenic
994074089 5:95631738-95631760 TCATCTCCAGTTTACACATAAGG + Intergenic
995174063 5:109153709-109153731 TTATCCCCAGTTTACAGATAAGG + Intronic
996205093 5:120724388-120724410 TCATCCCCAGTTTACAGATGAGG - Intergenic
996770223 5:127077931-127077953 TCAGTCCCATTTTACAGACAAGG + Intergenic
997480631 5:134181711-134181733 TAATCCCCACTTTACAGACAAGG - Intronic
999013280 5:148067397-148067419 TCAGCACCTGTTTACTTGCAGGG - Intronic
999078267 5:148818060-148818082 ACAGCCCCAATTTACAGATAAGG + Intergenic
999133945 5:149305046-149305068 TCAGCCCCATTTTGTAGACAAGG - Intronic
999591170 5:153148245-153148267 TCAGCCTCAAATTATATACAGGG - Intergenic
1000086720 5:157894079-157894101 TCATCCACATTTTACATATAGGG - Intergenic
1000280556 5:159778139-159778161 TCAGCATCAGGCTACATACAAGG + Intergenic
1000929643 5:167235843-167235865 TGAGACCCAGGTTGCATACATGG + Intergenic
1001321611 5:170686988-170687010 TCAGCCCCAGTGGACATCCCAGG - Intronic
1001518283 5:172372712-172372734 TCAACCCCAGTTTACAGATAAGG + Intronic
1001793724 5:174483878-174483900 GCAGCCCCATTTTACAGACGAGG + Intergenic
1002128411 5:177064286-177064308 GCACCCTCATTTTACATACAAGG - Intronic
1002248180 5:177903521-177903543 TCATCCCCATTTTACAGATAAGG + Intergenic
1002576825 5:180178808-180178830 TTAGGCCCATTTTACATATAAGG - Intronic
1002884899 6:1284985-1285007 TCACCCCCATTTTACAGATATGG + Intergenic
1002993925 6:2264977-2264999 TCAGTCCTAGTTTCCATTCATGG - Intergenic
1003406421 6:5830231-5830253 TTAGCCCCATTTTACAGAGAAGG - Intergenic
1003417875 6:5929030-5929052 TCATCCTCATTTTACAGACAAGG - Intergenic
1004045921 6:12022572-12022594 TCATCTCCATTTTACACACAAGG - Intronic
1004181116 6:13381339-13381361 GCAGCCCCATTTTACAGACAAGG + Intronic
1005144814 6:22676988-22677010 TTAGTCCCTGATTACATACAGGG + Intergenic
1005418564 6:25626699-25626721 TCAGCCCCTGTTGAGACACAGGG + Intergenic
1006046832 6:31306003-31306025 TCAGCCCCATTTTACAGACAAGG - Intronic
1006454404 6:34123705-34123727 GCATCCCCATTTTACACACAAGG + Intronic
1006783817 6:36651332-36651354 TTACCCCCAGTTTACAGATAAGG + Intergenic
1007158786 6:39772047-39772069 TCAGTCCCAATTTACATATGAGG + Intergenic
1007605864 6:43117574-43117596 TCAGCCTCATTTTATAGACAAGG - Intronic
1008085557 6:47240459-47240481 TCAGCCCCATTTTACAGATGAGG + Intronic
1008091953 6:47302893-47302915 TTAGCCCCATTTTACAGATAAGG - Intronic
1008489284 6:52068575-52068597 TTAGCCCCATTTTACAGATAAGG - Intronic
1008542508 6:52557455-52557477 TCAACCCCATTTTACTGACAAGG + Intronic
1008604944 6:53131265-53131287 TCACCCCCAGTTTACAGAACAGG + Intronic
1010811630 6:80307257-80307279 TCATCCTCAGTTTACAAATAAGG - Intronic
1011372263 6:86649976-86649998 TTATCACCAGTTTACATATAGGG + Intergenic
1012482091 6:99678513-99678535 TCAGCCACAGTTTAGAACCACGG + Intergenic
1012902008 6:105017545-105017567 TTATCCCTAGTTTACAGACAAGG + Intronic
1013274668 6:108572835-108572857 TAAGCCTCAGTTTAAAGACAAGG + Intronic
1013598488 6:111682791-111682813 TCATCCCCAGTTTACAGACAAGG - Intronic
1015497695 6:133897886-133897908 TCAGCCCCACTTCACCTCCAGGG - Intergenic
1018135479 6:160774742-160774764 TCATCCCCATTTTATACACAAGG + Intergenic
1020262977 7:6541199-6541221 CCAGCCTCAGTTTCCTTACATGG - Intronic
1021079487 7:16347150-16347172 TCAGCCCCATTTATCAGACAAGG + Intronic
1022233603 7:28439544-28439566 TCAGCCCCAGTTTGCAGAGGAGG + Intronic
1022423159 7:30243208-30243230 TTATCTCCAGTTTACAGACAGGG - Intergenic
1022424115 7:30251685-30251707 TTATCTCCAGTTTACAGACAGGG - Intergenic
1023467760 7:40476109-40476131 TCATCCCCATTTTACATATGAGG - Intronic
1023561235 7:41475283-41475305 TCATACCCAATTTACAGACAAGG - Intergenic
1026336969 7:69402672-69402694 TTAGCCCCATTTTACAGATAAGG - Intergenic
1026840809 7:73669029-73669051 TCTGCCCCATTTTCCATGCATGG - Intronic
1029581795 7:101441217-101441239 TTATTCCCAGTTTACAGACAAGG - Intronic
1030273815 7:107698167-107698189 GCAGCTCCATTTTACGTACAAGG + Intronic
1031518742 7:122736417-122736439 TGAGCACCAGTTTTCACACATGG - Intronic
1031553655 7:123145238-123145260 TCATCCCCATTTTACAGAAAAGG + Intronic
1032090931 7:128911144-128911166 TGATCCCCAGTTTACAGATAGGG - Intergenic
1032995508 7:137441514-137441536 TTAGCTCCATTTTACAGACAAGG + Intronic
1034840474 7:154390999-154391021 TCCGCCCCATTTTACAGACAAGG - Intronic
1034885452 7:154795042-154795064 TCCGCCCCAGGTTAGATAAAAGG - Intronic
1037380381 8:18278642-18278664 TAAGCCCTAGTTCACATACTAGG + Intergenic
1037587645 8:20288871-20288893 ATAGCTCCAGTTTACAGACAAGG - Intronic
1037671472 8:21018949-21018971 TCAGCCCCATTTTACAGGTAAGG - Intergenic
1038261906 8:26003026-26003048 TCAGCCTCATTTTGCAGACAAGG + Intronic
1039414952 8:37385890-37385912 CCAACCCCCGTTTACATGCATGG + Intergenic
1039872771 8:41560907-41560929 TTAGCTCCAGTTTACAGATAAGG - Intergenic
1040465022 8:47686610-47686632 TAAGACCCAGCTCACATACAGGG - Intronic
1040705260 8:50118489-50118511 TCAGCTCTACTTTACATATAAGG + Intronic
1041974673 8:63783741-63783763 TCAGCCCCAGGGTTAATACAGGG + Intergenic
1042028881 8:64452651-64452673 TCATCCCCATTTTACAGAGAAGG + Intergenic
1043133330 8:76489061-76489083 TCTGCTCCAGTCTACATACCTGG - Intergenic
1044920382 8:97164016-97164038 CCAGGCCCAGTTCACATAGATGG - Intergenic
1045034959 8:98169790-98169812 TCATCCCCATTTTACAGAGAGGG + Intergenic
1045169162 8:99644490-99644512 TCCACGTCAGTTTACATACAAGG - Intronic
1045748212 8:105449732-105449754 TTAGCCCTATTTTACAAACAAGG - Intronic
1045805067 8:106149656-106149678 TCAGCCCCACTTTACATTTGAGG + Intergenic
1047525706 8:125632433-125632455 TCAGCCTCAGTTTTCACACCAGG - Intergenic
1047532882 8:125693344-125693366 TTAGGCCCATTTTACAGACAAGG + Intergenic
1048015419 8:130492236-130492258 TTATCCCCAGTTTACAGACAAGG + Intergenic
1050434604 9:5595990-5596012 TTGTCCCCAGTTTACATATAAGG + Intergenic
1051349581 9:16186367-16186389 TTATCCCCATTTTACTTACAAGG + Intergenic
1051711784 9:19938379-19938401 ACAGCCCCATTTAACTTACATGG + Intergenic
1052715013 9:32104620-32104642 TTATCCTCATTTTACATACAAGG - Intergenic
1053371004 9:37561574-37561596 TCAGCCTCAGTTTAGAGGCAAGG - Intronic
1053792420 9:41696265-41696287 TTAACCCCATTTTACAGACAAGG + Intergenic
1054180829 9:61908285-61908307 TTAACCCCATTTTACAGACAAGG + Intergenic
1054472530 9:65549703-65549725 TTAACCCCATTTTACAGACAAGG - Intergenic
1054656762 9:67672857-67672879 TTAACCCCATTTTACAGACAAGG - Intergenic
1055938330 9:81624055-81624077 TAAACTCAAGTTTACATACATGG + Intronic
1056687641 9:88779465-88779487 TCATCTCCAGTTTACACACAAGG + Intergenic
1057634295 9:96748801-96748823 TCAGGCCCAGTTTATTTCCATGG - Intergenic
1058127512 9:101211900-101211922 CCACCTCCACTTTACATACAAGG + Intronic
1058424919 9:104868084-104868106 TTAGCCCCATTTTATATCCAAGG - Intronic
1058625950 9:106932693-106932715 TCAGCCCCATTTTACAGAAAAGG - Intronic
1058643986 9:107113543-107113565 TGATCCCCATTTTACAAACAAGG + Intergenic
1059139457 9:111838628-111838650 TTAGCCTCATTTTACATTCAGGG + Intergenic
1059323155 9:113484652-113484674 TTAGCCCCATTTTACAAATAAGG - Intronic
1059327247 9:113511573-113511595 TCAGCCCCATTTTGTAGACAAGG - Intronic
1059429383 9:114240827-114240849 TCAGCCCCATTTTACAGATGAGG + Intronic
1059618658 9:115978913-115978935 TCAGCCCAAGATTACATGGAAGG + Intergenic
1060675421 9:125510114-125510136 TTAGCCCCAGTTTACAGATTGGG + Intronic
1060926940 9:127461665-127461687 CCATCCCCAGTTTACACACGAGG + Intronic
1061304882 9:129726476-129726498 TTATCCCCATTTTACAGACAAGG - Intergenic
1061734490 9:132644411-132644433 TCATCCCCATTTTACAGACATGG + Intronic
1061840195 9:133354234-133354256 TCAGCCACATTTTCCATTCAGGG - Intronic
1061958405 9:133975534-133975556 ACAGCCCCAGTTTACAGATAAGG + Intronic
1186757627 X:12689453-12689475 TTATCCCCAGTTTACACACAGGG + Intronic
1187234188 X:17451536-17451558 TCAGCTCCATTTTACAAACAGGG + Intronic
1189197359 X:39163289-39163311 TCAGCCCCATTTTACATAGTAGG + Intergenic
1190048923 X:47134741-47134763 TTAGCCCCAGTTTACAGAGGGGG + Intergenic
1190334911 X:49256490-49256512 TTACCCCCATTTTACAGACAAGG - Intronic
1190922993 X:54874611-54874633 TCAGCCCCATATTAAACACAAGG - Intergenic
1192005638 X:67209157-67209179 TCACCCCCATTTTACAGATAAGG + Intergenic
1192130341 X:68543727-68543749 TTAGCACCATTTTACAAACAAGG + Intergenic
1192192125 X:68997315-68997337 TTAGCCTCACTTTACAGACAAGG - Intergenic
1192212144 X:69134419-69134441 TCACCCCCATTTTACAGATAGGG - Intergenic
1192500722 X:71649766-71649788 TTATCCCCATTTTATATACAAGG + Intergenic
1192549596 X:72043457-72043479 CCATCCCCATTTTACACACAAGG + Intergenic
1193170900 X:78334170-78334192 TTGGCCCCATTTTACAGACAAGG - Intergenic
1194637001 X:96358248-96358270 TCAGTCCTAGTTTAGAGACAAGG - Intergenic
1195152642 X:102088094-102088116 TCATCCTCATTTTACAGACAAGG - Intergenic
1195614009 X:106898544-106898566 TTAGCCCCATTTTACAGACGAGG + Intronic
1195641139 X:107175978-107176000 TCCACCCCAGTTTACTTGCAGGG + Intronic
1195748231 X:108139301-108139323 TTAGCCCTATTTTACATAAAAGG - Intronic
1195752966 X:108175824-108175846 TCACTCCCATTTTACATACCAGG + Intronic
1197150226 X:123212850-123212872 TTAGCTCCAATTTACAAACAAGG + Intronic
1199031006 X:143000284-143000306 TCAGCCCCATTTTACAGATAAGG + Intergenic
1199056392 X:143300449-143300471 TCAGCTGCATTTTACAGACAAGG - Intergenic
1199916875 X:152352268-152352290 TTATCCCCATTTTACATATATGG - Intronic