ID: 930408089

View in Genome Browser
Species Human (GRCh38)
Location 2:50987844-50987866
Sequence TTTCTGCAGCTGCTACAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 259}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930408089_930408091 11 Left 930408089 2:50987844-50987866 CCAGTTTGTAGCAGCTGCAGAAA 0: 1
1: 0
2: 2
3: 25
4: 259
Right 930408091 2:50987878-50987900 GAAACACAGAATTACTTTTTTGG 0: 1
1: 1
2: 1
3: 33
4: 380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930408089 Original CRISPR TTTCTGCAGCTGCTACAAAC TGG (reversed) Intronic
900372753 1:2339541-2339563 TTTCTGCAGCTGCAGCAACAAGG + Intronic
900388292 1:2420478-2420500 TTTCTGCAGCCCCTACCTACCGG - Intergenic
901664027 1:10816358-10816380 TTTCTGCAGCGGCTGTAAAATGG - Intergenic
902053395 1:13581617-13581639 TAACAGCAGCTGCTACATACTGG - Intergenic
902104171 1:14019717-14019739 TTTCTGCAGCTTATTCTAACAGG + Intergenic
902663731 1:17923062-17923084 GTTCTGCAGCTGCTCGAAAAGGG + Intergenic
902788508 1:18748899-18748921 ATTATGCAGCTGCTCCAAAAGGG + Intergenic
903030826 1:20463159-20463181 GATCTGCAGCAGCCACAAACTGG + Intergenic
903040153 1:20523431-20523453 TTTCTGCTGCAGCTAGAAAAAGG + Intergenic
903922538 1:26810634-26810656 ATTCAGCAGCTGCTACAAGAAGG - Intergenic
905355697 1:37382687-37382709 TTTCTACAGCTGCTACAAGTTGG - Intergenic
905422198 1:37855270-37855292 TTTCTGCAGGTGCTGCCCACTGG - Intronic
908971068 1:69832342-69832364 TTTCTTCAGCTGCTAAAGCCTGG - Intronic
911574109 1:99554047-99554069 TTTTTGCAGCTGTTGCAAAAGGG - Intergenic
912187743 1:107300014-107300036 TTTCTACAGCTGTTACACAAAGG - Intronic
913373636 1:118128164-118128186 TTTGTGCAGCTGTTGCAAATGGG + Intronic
915423134 1:155801171-155801193 TTTCTGAACCTGGTAGAAACAGG + Intronic
915629498 1:157140762-157140784 CTTCTCCATCTGCTGCAAACAGG + Intergenic
917064947 1:171082311-171082333 TTTATGCAGCTGATACACACTGG + Intergenic
918123073 1:181556823-181556845 CTGCTGCTGCTGCTACAAAGAGG + Intronic
922783076 1:228268834-228268856 TCACAGCAGCAGCTACAAACAGG - Intronic
923338191 1:232987511-232987533 TCCCTGCAGCTGCTACAATTAGG + Intronic
924322594 1:242864830-242864852 TTACTGCTACTGCTACAAACAGG + Intergenic
1063988590 10:11535174-11535196 AATCTGCAGATGCCACAAACAGG - Intronic
1064724289 10:18261739-18261761 TTTCTGAAGCTGCTCAAAATAGG - Intronic
1065201592 10:23317542-23317564 TTGCAGCAGCTGCTCCAGACAGG + Exonic
1065454485 10:25892529-25892551 TTACTGCAGTTGATACAGACAGG - Intergenic
1066544010 10:36480432-36480454 TTTCTGCAGCTGTTGTAAATGGG + Intergenic
1070069073 10:73068271-73068293 TTTCTGCAGCTGACAATAACAGG + Intronic
1070706318 10:78641721-78641743 TTCCTGCAGCTCCACCAAACTGG + Intergenic
1070993482 10:80753962-80753984 TTTCTCAAGCTGATACAAGCTGG + Intergenic
1071158092 10:82714365-82714387 TTTCTGCAGCTGCTCACAGCAGG - Intronic
1071227218 10:83544456-83544478 TTGCTGCAGAGGCTACAATCTGG + Intergenic
1072488293 10:95877547-95877569 TTTCTTCATCTACTACAGACAGG - Intronic
1074676146 10:115853511-115853533 TTTCAGAGGCTGCTAGAAACTGG - Intronic
1075986648 10:126793085-126793107 TTTTTGCAGCTGTTATAAAAGGG - Intergenic
1076303204 10:129443497-129443519 TTTCTGCATCTGTTACCAAGTGG - Intergenic
1077938718 11:6817787-6817809 TTGCAGCAGCTGCTTCAGACAGG - Intergenic
1078345676 11:10545344-10545366 TTGCAGCAGCTGCTCCAGACGGG + Intergenic
1079627273 11:22631093-22631115 TTTCTGCAGCTACTGTAAAAGGG + Intronic
1079764376 11:24372914-24372936 TTTCTGCAGTTGCTAAAAAAAGG + Intergenic
1081977587 11:47245522-47245544 GTTCTGCAGCTGCTCATAACGGG + Exonic
1086251460 11:84819950-84819972 TTTATGAATCTGCTACAAAGAGG + Intronic
1086754932 11:90548515-90548537 TTTCTAAAACTGCTACAAATAGG + Intergenic
1087203486 11:95369786-95369808 TTTATGCAGCTGATAAAAATTGG + Intergenic
1087464681 11:98489634-98489656 TTTCTGTAACTGCTTCATACTGG + Intergenic
1087727265 11:101735798-101735820 TTTATACATCTGCTACAAATTGG - Intronic
1088718599 11:112572308-112572330 TTTCTACAGCTGCTGTGAACAGG + Intergenic
1090041782 11:123298603-123298625 TTGCAGCAGCTGCTCCAGACGGG - Intergenic
1091237744 11:134033202-134033224 TCTCTCCAGCTGCTACCCACAGG + Intergenic
1091700600 12:2657719-2657741 TTACTGTAGCTGTTATAAACAGG - Intronic
1093347533 12:18057235-18057257 ATCCTGCAGCTGCTAGAAGCTGG - Intergenic
1095653682 12:44644185-44644207 TTTCTTCTGCTGCTACATAATGG - Intronic
1095788230 12:46134751-46134773 TTTCTGCTGCTACTACTGACAGG + Intergenic
1095899867 12:47317251-47317273 GTGCTGCAGCTGCTAAAAAAAGG + Intergenic
1096077433 12:48814414-48814436 TTTCTGCGGGTGCGTCAAACAGG - Intronic
1097156244 12:57014286-57014308 TCTCTGCAGCTGCAATTAACTGG - Intronic
1097295188 12:57955367-57955389 TTTCTGCTGCTGCTACCCAATGG - Intronic
1097490544 12:60264092-60264114 TTTCTGCAGCTGTTGCAAAAGGG + Intergenic
1097504070 12:60442250-60442272 TTCCTGCAGCTATTACAAAAGGG - Intergenic
1099371062 12:81830140-81830162 GTTCTGCAGCAGATACCAACTGG - Intergenic
1099406539 12:82270519-82270541 AATCAGCAGATGCTACAAACAGG + Intronic
1100291998 12:93224497-93224519 ATTCTGCACCTGCTACAACATGG + Intergenic
1100706651 12:97207755-97207777 TTTCTGTAGCTACTATAAAAGGG - Intergenic
1100826053 12:98475524-98475546 TTTCTGCAGTTGCTTCAGCCTGG - Intergenic
1101190501 12:102327540-102327562 TTTCTCCAGCTTCTCCAACCTGG - Intergenic
1105340124 13:19515241-19515263 TTTTTGCTGCTGATAAAAACTGG + Intronic
1109566883 13:64130220-64130242 TGTCTGCAGTTGTTACAATCTGG - Intergenic
1109575260 13:64248435-64248457 GTTTTGCAGCTGTTACATACAGG - Intergenic
1110154368 13:72295727-72295749 TTTCAGCTGATACTACAAACGGG + Intergenic
1111573281 13:90116098-90116120 TTTCTTCAGTTGCTGGAAACTGG + Intergenic
1112211033 13:97377192-97377214 TTTCTTCAGCTTCTCTAAACTGG - Intronic
1114550747 14:23531555-23531577 CGTCTGCAGCTGCTACAGAATGG - Exonic
1114556238 14:23563955-23563977 TTACTCCAGCTGCTCTAAACTGG + Intronic
1114567317 14:23642162-23642184 TTCCTGCAGCCAATACAAACAGG - Intronic
1114577204 14:23725950-23725972 TTTCAGCACCTGCCCCAAACAGG + Intergenic
1115372783 14:32637362-32637384 TTCCTGAACCTGCTACAATCTGG - Intronic
1115947696 14:38681281-38681303 TTTTTGCAGCTGTTATAAAAGGG + Intergenic
1116396647 14:44454974-44454996 TTTCTGTAGCTGGCAAAAACTGG + Intergenic
1117130552 14:52682542-52682564 TTTATGCAGTTGTTATAAACTGG - Intronic
1118047165 14:61982813-61982835 TGTCTGCACATGCTAAAAACTGG + Intergenic
1119008890 14:70962278-70962300 TTTCTGGAACTGCAACCAACTGG - Exonic
1119119158 14:72057407-72057429 TATCTGTAGCTGCTACAAGAAGG + Intronic
1119583519 14:75810226-75810248 TTTCTGGACCTGCTACAATGAGG + Intronic
1119876446 14:78063732-78063754 TTTAAGCAGCTGGTAGAAACTGG - Intergenic
1120338089 14:83184838-83184860 TTTCTGCAGCTTCTTCTACCTGG + Intergenic
1120865546 14:89292763-89292785 TTTGTGCTGCTGTCACAAACTGG - Intronic
1202894126 14_KI270722v1_random:187669-187691 TTTCTGATGCTGCAACAAAAAGG + Intergenic
1124035524 15:26050522-26050544 CTTCTCCAGCTGCTAAAAGCAGG + Intergenic
1124263826 15:28215789-28215811 CTCCTGCAGCTTCTCCAAACAGG - Exonic
1124314250 15:28654265-28654287 CTCCTGCAGCTTCTCCAAACAGG + Intergenic
1126271923 15:46829285-46829307 ATTCTGCACCTGGAACAAACTGG + Intergenic
1126560662 15:50040283-50040305 TAGCCACAGCTGCTACAAACAGG + Intronic
1129297724 15:74609057-74609079 ATGCTGCAGCTGCTCCAAGCAGG + Intronic
1129946151 15:79540862-79540884 TTTCTTCTGCTGCTATAAGCTGG - Intergenic
1132207634 15:99997499-99997521 GTTCTGCAGCTGGTACACGCAGG + Exonic
1132469033 16:91592-91614 TTTATTCAGCTGGTACAACCTGG + Intronic
1136584431 16:31174796-31174818 TTTCTTCAGCCACTCCAAACTGG - Intergenic
1136765522 16:32773473-32773495 CTTCCGCAGCTTCTCCAAACAGG + Intergenic
1136802577 16:33096906-33096928 CTTCCGCAGCTTCTCCAAACAGG - Intergenic
1138052499 16:53794773-53794795 TTTCTGCAGCTGCCTCCACCAGG - Intronic
1138159004 16:54735769-54735791 TTTCTGCTGCTGCGACCTACAGG - Intergenic
1138751122 16:59422350-59422372 TTTTTGCAGCTGTTATAAAAGGG + Intergenic
1139960342 16:70714024-70714046 TCTCTGCAGCTGCTGGAAACAGG + Intronic
1140872071 16:79115496-79115518 TTTTAGCAGCTGCCACAAACTGG + Intronic
1142023043 16:87795914-87795936 TTTTTGTTGCTGCAACAAACAGG - Intergenic
1142042820 16:87906068-87906090 CATCAGCAGCTGCTACAAATGGG + Intronic
1142321312 16:89384757-89384779 TTTCTGTAGGTGCTAAATACAGG - Intronic
1142889800 17:2935849-2935871 TTTCTCCAGCAGCTGCAATCCGG - Intronic
1144015746 17:11193785-11193807 TTTCTAAAACTGCTACAATCAGG + Intergenic
1144642773 17:16947018-16947040 TTTGTGCATCTGCTAGAATCTGG - Intronic
1145038906 17:19561890-19561912 ATTATGCAACTACTACAAACCGG - Intronic
1146791381 17:35752666-35752688 TTCCTGCAGGTGCTGGAAACGGG - Exonic
1147129530 17:38398775-38398797 TTTCTGCAGCTTCTGTCAACTGG - Intronic
1148902468 17:50888561-50888583 TTTGTCCATCAGCTACAAACTGG + Intergenic
1149009675 17:51842399-51842421 TTTCTGCAGCTGTTGCTCACAGG - Intronic
1149273103 17:55004374-55004396 TTTCTTCTGCTGCTACAAAGAGG + Intronic
1156790614 18:40968813-40968835 TTTCTGCAGCTATTATAAAAGGG - Intergenic
1157060302 18:44280449-44280471 TTTGTGCAACTGCTTCCAACAGG - Intergenic
1159756015 18:72366931-72366953 TTGCTGCATTTCCTACAAACAGG - Intergenic
1159923789 18:74249036-74249058 TTTCTGCATCTATTACAAAAGGG - Intergenic
1160101515 18:75923783-75923805 TTTCTGCAGCTACTTCAGAGGGG + Intergenic
1161297409 19:3526843-3526865 TTTTTACAGCTGCTCCACACAGG + Intronic
1163199473 19:15754484-15754506 TTTTTGCAGCTACTATAAAAGGG + Intergenic
1163964128 19:20728021-20728043 TTTCTGCAGCTGATGTAAAGTGG - Intronic
1164315403 19:24083203-24083225 TTTTTGCAGCTGCTTTAAAAGGG - Intronic
1164791990 19:30994696-30994718 TTTCTGCATTTTCTACAAAATGG + Intergenic
927126207 2:20013806-20013828 TTTTGGCAGATGCTACAAAATGG + Intergenic
928641939 2:33308388-33308410 ATTCAGCAGCTGTAACAAACAGG - Intronic
929639608 2:43564378-43564400 TGCCTGCAGCTGCTAGAAGCTGG - Intronic
929722544 2:44385232-44385254 TTTTTGCAGCTGTTGCAAAAAGG + Intronic
929796063 2:45059100-45059122 TTTCTGCAGCTGAAACAGGCTGG - Intergenic
930408089 2:50987844-50987866 TTTCTGCAGCTGCTACAAACTGG - Intronic
931648044 2:64443178-64443200 CTTCTGCAGCTGAGCCAAACTGG - Intergenic
933286868 2:80394156-80394178 TTTCTGCAGCTGAAACAATTGGG + Intronic
935649383 2:105369234-105369256 TTACTGCAGCTGCTTCCACCTGG - Intronic
935788900 2:106572879-106572901 TTACTGTAGCTGATACACACAGG + Intergenic
937261760 2:120591215-120591237 TTTCTGGAGCTGCTTCAGATAGG + Intergenic
938832775 2:135070184-135070206 TGTCTGCCTCTGTTACAAACAGG - Intronic
939837542 2:147149801-147149823 TTGCTGCGGCTGCTACAGACAGG - Intergenic
940013354 2:149078173-149078195 TTTCTTCTGCTGCTACAAATGGG - Intronic
941169193 2:162117007-162117029 TTTCTGCAGGTGCCACCTACTGG + Intergenic
941256323 2:163236006-163236028 TTTTTGTAGCTGTTATAAACAGG + Intergenic
941881053 2:170480728-170480750 ATTCTGCAGCAGATACCAACTGG - Intronic
943542562 2:189235746-189235768 TTTCTGCATGAGCTCCAAACTGG - Intergenic
943805499 2:192120288-192120310 TGTGTGCAGCCTCTACAAACTGG - Intronic
945194148 2:207222607-207222629 ATACTGCAGGTGCTGCAAACTGG - Intergenic
1168934053 20:1647699-1647721 GTTCTGCAGCTGCTAAAGAGTGG + Intronic
1169577320 20:6979564-6979586 CTTCTGCAGCTCAGACAAACAGG - Intergenic
1170708244 20:18765637-18765659 TATCTGCAGCTGCCTCAAAAAGG + Intergenic
1171062156 20:21975983-21976005 TTTTTGCAGCTGTTATAAAAGGG + Intergenic
1171372145 20:24668839-24668861 CATCTGCAGCTGCCACAGACAGG + Intergenic
1172604671 20:36206603-36206625 TTTCTGCTGCTGCTTCCAGCAGG + Intronic
1174371842 20:50095357-50095379 TTTCTGCGTCTGCTAAATACCGG - Intronic
1174475094 20:50790836-50790858 TCCCTGCAGCTGGTTCAAACTGG + Intergenic
1182230778 22:28836001-28836023 TTCCTCCAGCTGCTCCAGACGGG + Intergenic
949141478 3:638657-638679 GTTCTGCAGGTGCTCCAAAAAGG + Intergenic
949285807 3:2402928-2402950 TTCCTGGAGCTGCCACAAACTGG + Intronic
949401311 3:3667738-3667760 GTTCTGGAGCTGCTAAGAACAGG + Intergenic
949656174 3:6222800-6222822 TTTCTCAAGCTCATACAAACAGG + Intergenic
950512154 3:13437038-13437060 TTGCTGCTGCTGCTGCAAAAAGG + Intergenic
951720151 3:25689442-25689464 TTTCTTCAGCTCCTACTCACAGG - Intergenic
952446229 3:33383774-33383796 TTTGTGCTGCTACTACAGACTGG + Intronic
953211148 3:40876261-40876283 TGTCTGCAGCTGCAAGAAAGGGG - Intergenic
953797912 3:45999767-45999789 CTTCTGCAGCAGATACCAACTGG + Intergenic
953822397 3:46219218-46219240 TTTTTGCAGCTGTTATAAAAGGG - Intronic
954263251 3:49455147-49455169 TTCCTGCAGCTGCTGGGAACAGG + Intergenic
955038557 3:55292646-55292668 TTTCTCCAGCTCCTACAGACAGG - Intergenic
955062041 3:55501252-55501274 TTTCTGCAGCTGCATCGAACTGG + Intergenic
955579604 3:60404939-60404961 TTTCTGCTGCTGCTGCAACCTGG - Intronic
957506343 3:81125742-81125764 TTTCTGCAGCTGCCAGAGGCTGG + Intergenic
958730144 3:97952577-97952599 TTTCTCTTGCTGCTACCAACTGG - Intronic
962403785 3:135083164-135083186 TTTCTACAGCTGCTCCAATGGGG - Intronic
964867900 3:161281658-161281680 TTTTTGCAGCTATTACAAAAGGG - Intergenic
965741291 3:171877333-171877355 TTGCAGGAGCTTCTACAAACAGG - Intronic
967221999 3:187255181-187255203 CTTCTGCTGCTGCTACCAGCAGG - Intronic
967911011 3:194542470-194542492 ATTCTGCAGCTGATACCAGCTGG - Intergenic
968730709 4:2268020-2268042 TTTCTGCAGCTGCTGGGACCAGG + Intergenic
971464240 4:26937840-26937862 TTTCTGCTACTGCTAAACACTGG + Intronic
971697654 4:29927327-29927349 ATTTTGTAGCTGCTACAAATGGG - Intergenic
972705333 4:41537324-41537346 TTTCTGCAGATTCTAAAAGCAGG - Intronic
972919610 4:43921880-43921902 TTTCTTCATCTGCTAAAAGCAGG + Intergenic
973076371 4:45932590-45932612 ATTCTGCAGCTGCTACACATAGG - Intergenic
974450162 4:62044791-62044813 CATCTGCTGCTGCTATAAACTGG + Intronic
975251969 4:72191092-72191114 TTTCTGCATATTCTACAAATTGG - Intergenic
975906057 4:79213903-79213925 TATCTGCATGTGCTACAAATTGG - Intergenic
976909709 4:90286870-90286892 TTTCTTAAACTGCTACAAAGAGG + Intronic
977009368 4:91616994-91617016 TTTCTGTAGCTATTACAAACTGG - Intergenic
977245097 4:94621990-94622012 TTGCTCCAGGTGCTATAAACAGG + Intronic
977786845 4:101045409-101045431 AATCTGCAAATGCTACAAACCGG + Intronic
978149502 4:105415747-105415769 TTGCAGCAGCTGCTCCAGACGGG + Intronic
978226178 4:106338212-106338234 TTTCTGCAGCTGGCAGAAATGGG - Intronic
979606639 4:122645439-122645461 TTTCTGAAGTGCCTACAAACAGG + Intergenic
980926855 4:139146263-139146285 TTTTTGCAGCTGTTATAAAATGG - Intronic
980941368 4:139278556-139278578 TTTCTGCAGCTACAAAAAAAAGG + Intronic
982397383 4:154926665-154926687 TGACTGCAGCTGCTTCTAACTGG + Intergenic
983609368 4:169625930-169625952 GTTCTGCAGCAGATACCAACTGG + Intronic
984176983 4:176431024-176431046 TCAGTGCAGCTGCTACTAACAGG - Intergenic
986209015 5:5652697-5652719 TTTCTGGAGCTGCCAGAAACTGG + Intergenic
986227771 5:5832448-5832470 TTTTTGCAGCTGCTGTAAAAGGG - Intergenic
988034705 5:25811471-25811493 TATCTGCAGATGCAACCAACTGG + Intergenic
988929364 5:36021179-36021201 TTTTTGCAGCTGTTATAAAATGG + Intergenic
989392171 5:40912451-40912473 TCACTGCAGCTGCTACATCCTGG + Intronic
991356084 5:65769946-65769968 TTTCTGGATCTGCCACTAACTGG - Intronic
993672323 5:90776409-90776431 TATGTGCACCTGCTACAAAGTGG + Intronic
995012280 5:107270342-107270364 TTTTTGCTGCTGCTGCAATCTGG + Intergenic
995156858 5:108924866-108924888 TTTATGCGGCTGCTTCAAATGGG + Intronic
996914577 5:128696995-128697017 TTTCTGCAGCTGTTTCAGACTGG + Intronic
997493156 5:134296594-134296616 TTTGTGCAGCCTCTATAAACTGG + Intronic
999339437 5:150757194-150757216 TTTCATCATCTGCTATAAACAGG + Intronic
1001985385 5:176070208-176070230 TTTCTGCAGATGACACAAACTGG - Intronic
1002231485 5:177767912-177767934 TTTCTGCAGATGACACAAACTGG + Intronic
1002263855 5:178015836-178015858 TTTCTGCCGATGACACAAACTGG - Intronic
1003616851 6:7662429-7662451 TTTCTGCAGCTGTTGTAAATGGG - Intergenic
1005346944 6:24900149-24900171 TTTTTGAACATGCTACAAACTGG + Intronic
1006286597 6:33100820-33100842 TTTTTGCAGCTACTATAAAAGGG - Intergenic
1008590989 6:52993802-52993824 TTTCTTCAGTGGCTTCAAACTGG - Intronic
1009495244 6:64338369-64338391 TTTCTGCAGCTGTTGTAAAAGGG - Intronic
1009588507 6:65637382-65637404 TTGCAGCAGCTGCTCCACACTGG - Intronic
1010315939 6:74450603-74450625 TTTTTGCAGCTGTTATAAAAGGG + Intergenic
1013438722 6:110139422-110139444 TTGCAGCAGCTGCTACATACGGG + Intronic
1013495927 6:110697374-110697396 TTTTTGCAGCTGTTATAAAAGGG - Intronic
1014285405 6:119491558-119491580 TTTCTGCAGCTGTTGTAAAAGGG - Intergenic
1014395321 6:120921235-120921257 TTTCTGCAGCTGGTGAAAACAGG - Intergenic
1014523852 6:122478008-122478030 TTTCTGCAGGTGATGCAAAGCGG - Intronic
1014532376 6:122574158-122574180 TTTTTGCAGCTGTTGCAAAAGGG - Intronic
1014941500 6:127445419-127445441 TTTCTGCACCTTATAAAAACAGG + Intronic
1015807894 6:137130818-137130840 TTTCTGCAGATGATACAATTAGG - Intergenic
1017056165 6:150437468-150437490 TTTTTGCAGCTGTTGCAAAAGGG - Intergenic
1017375506 6:153762972-153762994 TTTCTGCAGCTGTTACAAAAGGG - Intergenic
1017428161 6:154343751-154343773 TTTCTGGAGCTGCTTTAAAAGGG - Intronic
1018092650 6:160358506-160358528 TCTCTGGAGCTGGTATAAACTGG + Intronic
1019103761 6:169651744-169651766 CTGCTGCAGCTGCTGCTAACTGG + Intronic
1019104934 6:169660230-169660252 TTTCTGGAGCTGGCAGAAACTGG + Intronic
1019199852 6:170305867-170305889 TTTCTGCAGCTGCTCTAAGATGG - Intronic
1019856819 7:3617517-3617539 TTTCTGCTGCTGTAACAGACTGG + Intronic
1021212138 7:17867260-17867282 TGTCTGCAGGTACTACAATCTGG + Intronic
1023117460 7:36876206-36876228 TTTCTGCATTTGCTATTAACTGG - Intronic
1024863380 7:53873319-53873341 TTTTTGCAGCTGCTATAAAATGG - Intergenic
1025807287 7:64846514-64846536 TTTATGCAGCTGTTATAAAAGGG + Intergenic
1028281370 7:88933675-88933697 TTTTTGCAGCTGTTGCAAAATGG - Intronic
1029936477 7:104430308-104430330 TTCCTGCAGATGCTACAAACAGG - Intronic
1033438585 7:141357259-141357281 TTTCTGTAGGTGGTACTAACTGG - Intronic
1033954813 7:146833713-146833735 TTTCTGTAGCTGATACACACAGG + Intronic
1034233167 7:149548441-149548463 TTTATCCAGGTGCTACAGACAGG - Intergenic
1034404920 7:150896827-150896849 TCTCTCCAGCTGCGACAGACAGG - Intergenic
1036989661 8:13578415-13578437 ATTCTGCAGTGGATACAAACTGG + Intergenic
1037264783 8:17046280-17046302 GTTCTGCAGCAGCCACCAACTGG - Intronic
1039488928 8:37933021-37933043 CTTGTGCATCTGCTATAAACTGG - Intergenic
1039686073 8:39802618-39802640 TTACTGGAGCCCCTACAAACTGG + Intronic
1040903965 8:52445787-52445809 TCTCTGAATCTGTTACAAACAGG + Intronic
1043091364 8:75908217-75908239 ATTCTGCAGCAGATACCAACTGG - Intergenic
1043333680 8:79147567-79147589 TTTCTGCTGCTGCTGCAACTGGG + Intergenic
1044358222 8:91250763-91250785 ATTCTGTAGCTGGAACAAACTGG + Intronic
1045165547 8:99600753-99600775 TTTCTCCAGCTGTTCCAAATTGG + Intronic
1046729668 8:117711586-117711608 TTTCTCCAGCTGGTAGAAAAAGG - Intergenic
1046775311 8:118158342-118158364 TTGCAGCAGCTGCTCCAGACAGG - Intergenic
1048205265 8:132410592-132410614 CTGCTGCAGCTGCTGCTAACTGG - Intronic
1048613344 8:136048127-136048149 TTTCTACAGCTGCCCCAATCTGG + Intergenic
1050426486 9:5517027-5517049 CTGCTGCAGCTGCTCTAAACGGG + Intronic
1051733546 9:20173571-20173593 TTTTTGCAGCTACTATAAAAGGG - Intergenic
1054731289 9:68705092-68705114 TTGCGGCAGGTGCTGCAAACCGG + Intergenic
1055864151 9:80792583-80792605 TTCCTCCTGCTGCTACAAATAGG + Intergenic
1058077544 9:100666813-100666835 TTGCAGCAGCTGCTCCAGACTGG - Intergenic
1058300581 9:103367095-103367117 TTTCAGCCGTAGCTACAAACTGG - Intergenic
1058636708 9:107045015-107045037 CTTCTGCAGATGCTACAGAAGGG + Intergenic
1061030195 9:128077093-128077115 TCTCTGCTGCTGCTAAAAACAGG + Intronic
1062562990 9:137150100-137150122 CTCCTGCAGCTGCTATAAAAAGG + Intronic
1187928126 X:24268991-24269013 TTTCTTCAGCTTTAACAAACTGG + Intergenic
1188042145 X:25381055-25381077 TTACTCCTGCTGCTACAAAAAGG - Intergenic
1189681204 X:43518545-43518567 TTTCAGCAGCTGCTCCATATGGG - Intergenic
1190583045 X:51907190-51907212 TGTCTCAAGCTGGTACAAACTGG - Intergenic
1191577393 X:62721454-62721476 TTTTTGCAGATTCTACAAAAAGG + Intergenic
1191948713 X:66564568-66564590 TTTATGCAGCTGAAACACACAGG - Intergenic
1192000172 X:67141289-67141311 TTTCTGCAAAAGCTCCAAACTGG + Intergenic
1192926615 X:75760430-75760452 TTGCTGCAGCTGCTGCACATTGG + Intergenic
1193190809 X:78568437-78568459 TTTCTGCAGCTGTTGTAAAAGGG - Intergenic
1196039166 X:111183312-111183334 TTGCTGCTGCTGCTATAAAAAGG - Intronic
1196611345 X:117718181-117718203 CTCCTTCAGCTGCTTCAAACAGG + Intergenic
1196935109 X:120722373-120722395 TTTTTGCAGCTGCTGTAAAAGGG + Intergenic
1197018551 X:121657683-121657705 TCTTTGCAGCTGTTACTAACAGG - Intergenic
1197591311 X:128414185-128414207 TTTTTGCAGCTGTTATAAAAGGG + Intergenic
1198189347 X:134287487-134287509 TTGCAGCAGCTGCTCCAGACAGG - Intergenic
1198995874 X:142573276-142573298 TTTCTGCAGCTGGTGTAAAAGGG - Intergenic
1201283001 Y:12357339-12357361 ATTCAGCAACTGTTACAAACTGG - Intergenic
1201714174 Y:17025683-17025705 TTTTTGCAGCTACTGTAAACAGG + Intergenic
1202592118 Y:26496032-26496054 TTTTTGCTGCTGATAAAAACTGG - Intergenic