ID: 930409708

View in Genome Browser
Species Human (GRCh38)
Location 2:51009744-51009766
Sequence CTGTCACCATAGAAGAGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 194}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930409708_930409710 -6 Left 930409708 2:51009744-51009766 CCATATCTCTTCTATGGTGACAG 0: 1
1: 0
2: 1
3: 18
4: 194
Right 930409710 2:51009761-51009783 TGACAGAGATGGATAACAACCGG 0: 2
1: 0
2: 0
3: 11
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930409708 Original CRISPR CTGTCACCATAGAAGAGATA TGG (reversed) Intronic
900355496 1:2260297-2260319 ATTTCACCAAAGAAGACATATGG - Intronic
903932340 1:26870010-26870032 CTGGCAATATAGAAAAGATAAGG - Intergenic
907609597 1:55854985-55855007 CTGTCATCATAAAACAGCTAAGG - Intergenic
915060707 1:153181845-153181867 CTATCACAATAGCAAAGATATGG - Intergenic
916510225 1:165466722-165466744 CTGCCACCAGAGAAAAGATTTGG - Intergenic
918245509 1:182656233-182656255 CTGTCACCAGAGGAGAGAGGAGG - Intronic
918602275 1:186377478-186377500 GTGACACCCTAGAAGAAATAAGG + Intronic
918959217 1:191250310-191250332 CTTTCACAATAGTAAAGATATGG - Intergenic
921431210 1:215068272-215068294 CTGTCACCAGATAAGACATGTGG + Intronic
921967841 1:221110591-221110613 ATGTCACCAAAGAAGGTATATGG - Intergenic
923751584 1:236751615-236751637 CTGTCACCATGGATGAGCTCCGG + Exonic
924617477 1:245624551-245624573 ATTTCACCAAAGAAGAGGTATGG - Intronic
1064525209 10:16249001-16249023 CTGTCATGATAGCAAAGATACGG + Intergenic
1065515719 10:26522622-26522644 CTGTCACCATAGGACACTTAAGG + Intronic
1066218381 10:33310984-33311006 CAGTCCCCTTTGAAGAGATAAGG + Intronic
1066506242 10:36047750-36047772 TTGTCACAATAGTAAAGATATGG + Intergenic
1067218267 10:44321856-44321878 CTGTCACCACAAGTGAGATATGG + Intergenic
1067956032 10:50791960-50791982 ATTTCACCAAAGAAGATATATGG - Intronic
1068756138 10:60655853-60655875 ATCTCAACATAGAAAAGATACGG - Intronic
1068890696 10:62145918-62145940 ATGTCACCATGGAAAAGACATGG + Intergenic
1070708395 10:78658098-78658120 GTGTCACCATAGAAGTGAGGAGG + Intergenic
1071316361 10:84403632-84403654 ATTTCACCAAAGAGGAGATATGG + Intronic
1073026011 10:100487845-100487867 CTGGCAGCATGGAAGGGATAAGG + Intronic
1073160746 10:101392694-101392716 GTTTCACCATAGTAGAGACAGGG + Intronic
1073741583 10:106414129-106414151 ATGTCACCATATAGGAGACAGGG + Intergenic
1074092080 10:110270226-110270248 GTGTGACCAAAGAAGAAATATGG + Intronic
1075984887 10:126776410-126776432 TTGTCACTATAGAAGATTTATGG + Intergenic
1076918748 10:133440638-133440660 AGGTCACCATAGAAGACACATGG + Intergenic
1078047222 11:7926212-7926234 CTGTCAGCAGAGAGGGGATATGG - Intergenic
1078848722 11:15144588-15144610 CTGTCAACATGGAAGGGACAGGG - Intronic
1082108009 11:48241962-48241984 CATTCACCATAGTAGAGTTATGG - Intergenic
1083045779 11:59733497-59733519 CTGTAACCAGAGAAGAGAGAAGG - Intronic
1083858659 11:65407083-65407105 CTGTCACCACATCAGAGCTAAGG - Intronic
1086719580 11:90103754-90103776 ATTTCACCATAGAAGACAGATGG + Intergenic
1089041981 11:115460689-115460711 CTGTCACCAGAGCTGAGAAAAGG - Intronic
1094038056 12:26091537-26091559 CTGTGGCCATGGAAGAGAGATGG - Intergenic
1095682088 12:44989504-44989526 TTTTCACCAAAGAAGATATATGG + Intergenic
1098095238 12:66947348-66947370 CTGTCATCATAGTAGCCATAAGG + Intergenic
1106002830 13:25740391-25740413 ATTTCACCATTTAAGAGATAAGG + Intronic
1107479360 13:40772402-40772424 CTGTGACCCCAGAAGAGATGTGG + Intergenic
1107559093 13:41544449-41544471 ATGTCACCATAGTGGAGATGTGG + Intergenic
1110290823 13:73805022-73805044 TTGTCAGCAGAGAAGAGACATGG + Intronic
1112086169 13:96034295-96034317 CTGTCACTAGAGAGGAGACATGG - Intronic
1112099864 13:96176588-96176610 CTGTCCACATACAAGAAATATGG + Intronic
1112150109 13:96750151-96750173 CTGGCACCATACAAGAGATATGG + Intronic
1114049446 14:18910820-18910842 ATGTCACTACAGAAGAGAGATGG + Intergenic
1114113117 14:19491111-19491133 ATGTCACTACAGAAGAGAGATGG - Intergenic
1114304109 14:21405202-21405224 CCCTCACCATTGATGAGATATGG + Exonic
1116071520 14:40052435-40052457 ATGTAAACATAGAAAAGATATGG - Intergenic
1118027678 14:61786491-61786513 ATTTCACCAAAGAAAAGATATGG + Intronic
1118936046 14:70289376-70289398 CTGTCACCATCCAACTGATACGG + Intergenic
1119212836 14:72845678-72845700 CTGGGACCACAGAAGAGACAGGG + Intronic
1121488187 14:94336952-94336974 CATTCACCAAAGAAGACATATGG - Intergenic
1126558145 15:50013301-50013323 ATGTCCCCCTAGAAGAGCTATGG - Intronic
1128059541 15:64726216-64726238 CAGTCACCATGGCAGAGAGAAGG + Intergenic
1130074121 15:80674123-80674145 CTGTCATAATAGCACAGATAGGG - Intergenic
1131528162 15:93168899-93168921 ATTTCACCAAAGAAGACATATGG - Intergenic
1135291150 16:21239629-21239651 CTGTCACAATAGCAAAGACATGG + Intronic
1137956151 16:52832078-52832100 CTGTCACCATACTTGAGATCAGG + Intergenic
1138008135 16:53356007-53356029 TTATCTCCATAGAACAGATAGGG - Intergenic
1141760201 16:86023199-86023221 CTGACACCATGGGAGAGAAAAGG + Intergenic
1142112126 16:88338558-88338580 CTGTCACCAAGGAAGAAACACGG + Intergenic
1145822903 17:27853682-27853704 GTTTCACCACAGAAGATATATGG - Intronic
1146030065 17:29358649-29358671 TTCTCACCAAAGAAGATATATGG - Intergenic
1146094043 17:29910941-29910963 ATGTCACCATTTCAGAGATAAGG - Intronic
1146485021 17:33235708-33235730 CTGGCACCAAAGAAGAGTTCAGG - Intronic
1147485770 17:40812390-40812412 GTTTCACCAAAGAGGAGATACGG + Intergenic
1148071825 17:44913131-44913153 CTTTCACCAGAGAAGTGAGATGG - Intronic
1149933319 17:60777995-60778017 ATTTCACCAAAGAAGACATACGG - Intronic
1150877219 17:68983641-68983663 CCGTCATCATAGCAGAAATATGG + Intronic
1203165661 17_GL000205v2_random:90766-90788 TTGCCACTGTAGAAGAGATAAGG - Intergenic
1153401175 18:4685296-4685318 CTGGCACCAAAACAGAGATATGG + Intergenic
1154330490 18:13425613-13425635 CTGTCATCATTAAAGAGAGAAGG - Intronic
1158113699 18:53971377-53971399 CCCTGACCAAAGAAGAGATAGGG + Intergenic
1159833958 18:73313331-73313353 CTTTCTCCATAGAAAAGACAAGG - Intergenic
1160293265 18:77614818-77614840 GTGTCACCAATGAAGAGAAAGGG - Intergenic
1161730188 19:5955278-5955300 CTGCCACCACAGTAGAGATGGGG + Intronic
1162321240 19:9971685-9971707 CTGTCACCACAGTAGAGGTTGGG - Intronic
1162931242 19:13959029-13959051 CTGTCACCTAAGAAGAGATGGGG - Exonic
1163021507 19:14483126-14483148 CTGTCACTATACAAGAGATGAGG - Intronic
1164494015 19:28741594-28741616 CATTCACCATAGCAGAGACAGGG + Intergenic
1168676383 19:58280894-58280916 CTATGACTATAGAAGACATAAGG - Intronic
925574051 2:5341762-5341784 CTGTCACCAGAGCTGAGAGAGGG - Intergenic
925672753 2:6328838-6328860 CTGGTACCAAAGCAGAGATATGG - Intergenic
926543620 2:14210965-14210987 CTGTCTCCATAGTAGAAATAAGG + Intergenic
926674331 2:15607725-15607747 ATGCCACCTTAGTAGAGATAGGG + Intronic
928263457 2:29788662-29788684 CTGTCATAATAGAACAGAAAGGG + Intronic
930409708 2:51009744-51009766 CTGTCACCATAGAAGAGATATGG - Intronic
931926914 2:67083811-67083833 CTGTCTCCATTGAAGAGAAATGG - Intergenic
932386065 2:71333762-71333784 ATGTCACCATTTTAGAGATAAGG - Intronic
933248854 2:80005619-80005641 CTATCACCATAGATCAGCTATGG + Intronic
933668081 2:84980944-84980966 CTGTGGCCATAGAAGAGATGAGG - Intronic
933865825 2:86516374-86516396 ATTTCACCAAAGAGGAGATACGG + Intronic
935523539 2:104139044-104139066 CTGTCACAATAAGAGAGATGTGG + Intergenic
937691651 2:124762772-124762794 CTCACACCACAGAAGAGACAGGG - Intronic
938167822 2:129047206-129047228 CTGGCTCCATAAAAGAGTTAGGG + Intergenic
939248610 2:139658201-139658223 CTGTCACCATAGAAAAGTCAAGG - Intergenic
940342082 2:152591799-152591821 CTGTCTCTAAAGAAAAGATAAGG + Intronic
940628698 2:156209871-156209893 CTATCACAATAGCAAAGATATGG - Intergenic
940897066 2:159090873-159090895 CTGTCACCATACAAGCGAAGTGG - Intronic
943114793 2:183654736-183654758 AACTCACCAAAGAAGAGATATGG + Intergenic
943204987 2:184883410-184883432 CTGGCCTCATAGAAGAGTTAGGG - Intronic
944582501 2:201144296-201144318 CTGTCATCTGAGAAGAGAAAGGG + Intronic
944908152 2:204283339-204283361 CTGTTATCACAGAAGAGATGTGG + Intergenic
1169475036 20:5923439-5923461 CTGACACCAGAGAAGAGAAAAGG + Exonic
1173496940 20:43526286-43526308 CTGTCATAGTAGAAGAGATTTGG + Intronic
1173822336 20:46027708-46027730 TTGCCTCCATAGAAGAGACAAGG - Intronic
1176254036 20:64141289-64141311 TTTTCATCATAGAAGAAATAGGG - Intergenic
1176406093 21:6368313-6368335 TTGCCACTGTAGAAGAGATAAGG + Intergenic
1176935829 21:14865797-14865819 ATCTCAACATAGAAAAGATACGG + Intergenic
1178180672 21:30157481-30157503 CTATCAAAATAGAGGAGATAGGG + Intergenic
1178751545 21:35308876-35308898 CTGCCTCCATAGAAGCCATATGG + Intronic
1181061758 22:20285153-20285175 CTGTCACCAGAGAACATAAAGGG + Intergenic
1182113059 22:27737264-27737286 GTTTCACCAAAGAAGACATACGG + Intergenic
1184704936 22:46204648-46204670 ATATCACCAAAGAAGATATATGG - Intronic
949207483 3:1457451-1457473 CTGTCACCTTAAAAAAAATATGG + Intergenic
949960151 3:9305175-9305197 CTGCCACCAAAGAAGAGAGAAGG + Intronic
950993382 3:17465995-17466017 CAGTCACCTTAGAATTGATATGG + Intronic
951131622 3:19052933-19052955 CTGTCACCATATCAGTGTTATGG + Intergenic
952480533 3:33756405-33756427 GTGTCACCAAAGAAGACATATGG + Intergenic
954373129 3:50179945-50179967 CTTTCACCATATCAGTGATAAGG + Intronic
954864949 3:53720607-53720629 ATTTCACCAGAGAAGAGATGTGG + Intronic
958613832 3:96464100-96464122 TTTTCACTATAGAAGAGACAAGG - Intergenic
958914436 3:100033035-100033057 CTGTTACCATTGATGAGACATGG + Intronic
959196716 3:103192606-103192628 ATGTGACCATATAACAGATAAGG + Intergenic
959811140 3:110620955-110620977 CTTTCATGCTAGAAGAGATAGGG - Intergenic
960530381 3:118757508-118757530 CTTTGCCCACAGAAGAGATAAGG + Intergenic
960753973 3:120989089-120989111 AAGTCACAATAGCAGAGATATGG - Intronic
961174685 3:124824740-124824762 AATTCACCAAAGAAGAGATATGG + Intronic
961357391 3:126347747-126347769 ATGTCACCAGAGAAGGGACAGGG + Intronic
963107175 3:141657381-141657403 CTCTCAGCAGAGAAGAGATGCGG - Intergenic
963323891 3:143839955-143839977 CTTTCACCATAGGAGAGTAATGG + Intronic
965981840 3:174702207-174702229 GTTTAACCATAGAAGATATATGG - Intronic
966365418 3:179181123-179181145 CTGTCACCACACACCAGATATGG + Intronic
968581478 4:1397311-1397333 CAGTCACCAGGGAAGAGATGGGG + Intergenic
971183448 4:24351864-24351886 CAGTCAACAAAGAAGAGAAAGGG + Intergenic
972361363 4:38328428-38328450 CTGTAACCTGAGAAGAGAAAAGG - Intergenic
972714507 4:41632371-41632393 GTGACACCATAGAAGAGAGAAGG + Intronic
972737639 4:41860124-41860146 TTTTTACCATAGAAGATATAAGG + Intergenic
974416366 4:61612309-61612331 CTGTCACAAGTGAAGAGAGAAGG - Intronic
975122736 4:70746637-70746659 CTGTCACCATTTTATAGATAAGG + Intronic
977072178 4:92405071-92405093 CTGTAACCATATCAGATATATGG + Intronic
977125825 4:93166467-93166489 CTGACAGCATTGCAGAGATAAGG - Intronic
979109287 4:116730948-116730970 CAGTCACAATAGCAAAGATATGG - Intergenic
979488822 4:121300655-121300677 CTGTCAACATAGACCAGAAAGGG + Intergenic
980206526 4:129725959-129725981 CTGTCAGCACAGAACAGATGAGG + Intergenic
981212958 4:142130436-142130458 CAGTCACCATGGTAGGGATAGGG + Intronic
982204311 4:152985617-152985639 ATTTCACCAAAGAGGAGATATGG + Intergenic
982698881 4:158636427-158636449 CTGCCACCAGAGAAGTGGTAGGG - Intronic
984813046 4:183811800-183811822 TTGACACTATGGAAGAGATAAGG + Intergenic
986401194 5:7383400-7383422 CTGTAACCCCAGAAGAGGTAAGG + Intergenic
987432705 5:17856083-17856105 CATTCACCAGAGAAAAGATACGG - Intergenic
987729338 5:21748550-21748572 GGGTCACCAGAGGAGAGATATGG - Intergenic
988587399 5:32519608-32519630 CTTTCACCATAGCAAAGACAAGG + Intergenic
990141985 5:52715761-52715783 ATCTCACCAAAGAAGACATATGG - Intergenic
991253060 5:64585223-64585245 CTGCCACCAAGGAAGTGATAGGG + Intronic
996295897 5:121916070-121916092 CTGTTAACATTGAAGAGGTAGGG - Intergenic
996390501 5:122955697-122955719 ATGCCACCATAGAAGAGAAAGGG + Intronic
997076541 5:130685468-130685490 CTGTCACAACAAAAGAGACAAGG - Intergenic
998571900 5:143267774-143267796 ATCTCACCAAAGAAGATATATGG - Intergenic
999163239 5:149523352-149523374 CTGTTAACATAAAAGAGATGGGG + Intronic
1002369005 5:178734986-178735008 CTTTCACCATAGCAAAGACATGG - Intergenic
1005922049 6:30410923-30410945 TTGTCACAATAGAAAAGACATGG + Intergenic
1007083282 6:39124133-39124155 CTGTCACCAAAGAAGATATTTGG + Intergenic
1008006509 6:46415368-46415390 GTGACACCATAAATGAGATAAGG + Intronic
1010870284 6:81028875-81028897 CTCTCACCAAATGAGAGATATGG - Intergenic
1011606263 6:89109411-89109433 CTGTTACCATTTAAGAGTTAAGG + Intronic
1014126773 6:117785165-117785187 ATTTCACCAAAGAAGACATATGG - Intergenic
1014162344 6:118184892-118184914 CTTTCCCCATATCAGAGATAGGG + Intronic
1014585537 6:123193660-123193682 TTATCAGCACAGAAGAGATAAGG - Intergenic
1015418791 6:132982452-132982474 CTGTTACCAAAACAGAGATATGG - Intergenic
1017174348 6:151489141-151489163 ATGTCACAATAGAACAAATAAGG + Intergenic
1018536954 6:164830664-164830686 CTGTCATAATAGAAGACAGATGG - Intergenic
1018807998 6:167276276-167276298 CTGTCACAATAGCCAAGATATGG - Intronic
1020397426 7:7731947-7731969 CTGTCTCCATTGTACAGATAAGG - Intronic
1020907993 7:14089449-14089471 CTGTCACCATGGAAAAGAGAAGG - Intergenic
1020983667 7:15104971-15104993 CTGTCACCATAGAGTACATGAGG - Intergenic
1021608239 7:22431226-22431248 CAGGCACCATAGAAGAGAAGAGG - Intronic
1021630511 7:22640750-22640772 CATTCACCATAGACAAGATATGG - Intergenic
1022043965 7:26608513-26608535 CAGTCACCAGAGCAGAGAAACGG + Intergenic
1022141453 7:27496532-27496554 CTCTTACCAGAGAAGAGATTGGG + Intergenic
1022402929 7:30058089-30058111 ATTTCACAATGGAAGAGATAGGG - Intronic
1024601338 7:50984334-50984356 ATGCCACCATAGAATAGAGAGGG - Intergenic
1024853434 7:53747745-53747767 CTATCCTCATAGAAGAGTTAGGG - Intergenic
1025591326 7:62863561-62863583 CTGTTACCAAAACAGAGATATGG + Intergenic
1028115806 7:86996310-86996332 CTGTCAGCATAGAGGAGAAATGG + Intronic
1028200679 7:87957266-87957288 CTGATACCATAGAACAGCTAAGG - Intronic
1030868120 7:114724449-114724471 CTTTCACAATAGCAAAGATATGG - Intergenic
1031092067 7:117369925-117369947 CTGTCTCCATTCTAGAGATACGG - Intronic
1031596379 7:123654256-123654278 ATTTCACCAAAGAAGATATAAGG + Intergenic
1033959096 7:146890956-146890978 CTATCACAATAGCAAAGATATGG + Intronic
1039230097 8:35436667-35436689 CTGTCACAATAGGAGAGATTGGG + Intronic
1041450824 8:58004916-58004938 CTGTCTCCCGAGAAGCGATAAGG + Intronic
1043535586 8:81200637-81200659 CTGGCACCAAAACAGAGATATGG - Intergenic
1043861752 8:85325687-85325709 CTGCCACCACAGAACAGAGAAGG + Intergenic
1045052864 8:98342724-98342746 CTGACACCCTTTAAGAGATAAGG + Intergenic
1046939325 8:119915743-119915765 TTGATACCATAGAAGAGATGAGG + Intronic
1048962497 8:139592459-139592481 CTGTGACCATAAAAGGGGTAAGG - Intergenic
1049678912 8:143906942-143906964 CTTTCACCAGTGAAGATATATGG - Intergenic
1050710647 9:8458709-8458731 CTCTCTCCATGTAAGAGATAAGG - Intronic
1055358130 9:75459361-75459383 CTGGCACCCTAGAAGAAATATGG - Intergenic
1060143694 9:121232988-121233010 CTCTCAACAGAGAAGTGATAGGG - Intronic
1062731233 9:138110894-138110916 GTGTCATCAAAGAAGATATATGG + Intronic
1186253025 X:7689469-7689491 CTATCACAATAGCAAAGATATGG - Intergenic
1188799187 X:34505978-34506000 CTGTGACTATAGAGGAGAAAAGG - Intergenic
1191649917 X:63525602-63525624 CTGTGACCATAGCTGAGAAACGG + Intergenic
1192226221 X:69229840-69229862 CTCTCACCTTTGAAGAGATAGGG + Intergenic
1192979289 X:76321798-76321820 CTGGTCCCATAGAAGAGATTTGG - Intergenic
1194056886 X:89146152-89146174 CTGTCACCATAGCAAAGACTTGG + Intergenic
1196809386 X:119616671-119616693 CTGCCATTATAGAAGAGTTAGGG - Intronic
1197086628 X:122484247-122484269 CTATCACAATAGCAAAGATATGG + Intergenic
1198180826 X:134207185-134207207 ATGTAAACATAGAAAAGATATGG - Intergenic
1199300969 X:146213561-146213583 CTAACATCATAGAAGAGACATGG - Intergenic
1201706246 Y:16940255-16940277 CTGTCTCAAAAGAAGAGATGAGG + Intergenic