ID: 930410561

View in Genome Browser
Species Human (GRCh38)
Location 2:51020622-51020644
Sequence TCGCAAACAATCTGTGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 153}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930410559_930410561 22 Left 930410559 2:51020577-51020599 CCCACAAATTTTTAAGCTTTGAA 0: 1
1: 1
2: 3
3: 48
4: 481
Right 930410561 2:51020622-51020644 TCGCAAACAATCTGTGAAGTAGG 0: 1
1: 0
2: 1
3: 8
4: 153
930410560_930410561 21 Left 930410560 2:51020578-51020600 CCACAAATTTTTAAGCTTTGAAA 0: 1
1: 1
2: 4
3: 65
4: 705
Right 930410561 2:51020622-51020644 TCGCAAACAATCTGTGAAGTAGG 0: 1
1: 0
2: 1
3: 8
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930410561 Original CRISPR TCGCAAACAATCTGTGAAGT AGG Intronic
902525639 1:17055384-17055406 TCCCAAACAAACTGGGCAGTTGG + Intergenic
902622843 1:17660409-17660431 TCACAACCATTCTATGAAGTGGG - Intronic
904675542 1:32197165-32197187 TAGCAAACACTCTGTGAGGTTGG - Exonic
906185301 1:43858009-43858031 TCTCAAACCATCTGTGAAGAGGG - Intronic
907119846 1:51998825-51998847 TCACAATGAACCTGTGAAGTTGG + Intergenic
907260705 1:53216396-53216418 TCACAACAAATCTGTGAGGTAGG - Intronic
907618226 1:55947098-55947120 TCCCGAACAATCTATGAAGTGGG - Intergenic
910709357 1:90163460-90163482 TCACAAACAACCTATGAAGGAGG - Intergenic
912068327 1:105776115-105776137 TCACAACTATTCTGTGAAGTAGG - Intergenic
915702350 1:157807904-157807926 TCACAAAAACTCTGTGAGGTAGG - Intronic
915800106 1:158781868-158781890 TCACAATTACTCTGTGAAGTTGG + Intergenic
916742227 1:167656120-167656142 TCACAGACATTCTGTGAGGTGGG + Intronic
917035829 1:170746005-170746027 TGGCAAACAAAGGGTGAAGTAGG - Intergenic
918565068 1:185919438-185919460 TAGCAAGCATTCTGTGAATTTGG + Intronic
920727670 1:208451462-208451484 TCACAAAAACCCTGTGAAGTGGG - Intergenic
921052689 1:211522357-211522379 TTCCAAACACCCTGTGAAGTAGG + Intergenic
924421804 1:243916995-243917017 TTGTAAAGACTCTGTGAAGTAGG - Intergenic
1066066586 10:31765420-31765442 GCGAATACCATCTGTGAAGTTGG + Intergenic
1067791264 10:49289498-49289520 AGGCAACCAATCTGTAAAGTTGG + Intergenic
1068963671 10:62890544-62890566 TCACCAACAATCTGTATAGTTGG - Intronic
1070012086 10:72485507-72485529 TCCCAACCATTCTGTGACGTCGG + Intronic
1072051984 10:91714141-91714163 TCACAACCACCCTGTGAAGTGGG + Intergenic
1072096755 10:92189451-92189473 TCGCACTCACTCTATGAAGTAGG + Intronic
1072263421 10:93704100-93704122 TCCCACACAATCCATGAAGTGGG - Intergenic
1079631372 11:22680971-22680993 TCTCAAGAAAACTGTGAAGTGGG - Intronic
1080023562 11:27590206-27590228 TCACAACCACTCTGTGAAGCAGG + Intergenic
1081323042 11:41714542-41714564 TCGTAACCCATCTGTGAAGCAGG + Intergenic
1082655913 11:55856959-55856981 TGGAATTCAATCTGTGAAGTGGG + Intergenic
1087165100 11:94995289-94995311 TCACAACTAATCTATGAAGTTGG - Intronic
1089418196 11:118311062-118311084 TCGCAAAAACTTTGTGAGGTTGG + Intronic
1089565700 11:119370353-119370375 CCTCAAGTAATCTGTGAAGTGGG + Intronic
1089908726 11:122073649-122073671 CCACAAACATTTTGTGAAGTAGG - Intergenic
1094232746 12:28126612-28126634 TAGCAAACAAACACTGAAGTTGG - Intergenic
1097857705 12:64483527-64483549 TCACAACAATTCTGTGAAGTGGG + Intronic
1098342262 12:69464487-69464509 TCACAAAAATCCTGTGAAGTGGG + Intergenic
1098724961 12:73952201-73952223 TGGTATTCAATCTGTGAAGTGGG + Intergenic
1099127726 12:78786536-78786558 TCACTGACAATCTGTGAAGAAGG - Intergenic
1099821341 12:87714979-87715001 TGACCAACAAGCTGTGAAGTTGG - Intergenic
1100218877 12:92482405-92482427 TGGAAAACCTTCTGTGAAGTTGG - Intergenic
1102918934 12:116777240-116777262 TCCCAAAGACTCTATGAAGTAGG - Intronic
1103277021 12:119720838-119720860 TTGCAAACATTCAGAGAAGTTGG - Intronic
1104156030 12:126133323-126133345 ACACAAACAATCTCTGAAGATGG - Intergenic
1106404918 13:29465062-29465084 TCACAAAAGTTCTGTGAAGTAGG - Intronic
1107005233 13:35601978-35602000 TCACAAAAAGTTTGTGAAGTAGG - Intronic
1107364160 13:39652017-39652039 TGGAAAACAATATGTGAAATAGG + Intergenic
1108203693 13:48066872-48066894 TGGGAATCAATCTGTGAGGTGGG + Intronic
1108212944 13:48156733-48156755 TGGGATTCAATCTGTGAAGTGGG + Intergenic
1108820451 13:54342879-54342901 TTACAAACAATCTGTGAACCAGG + Intergenic
1111426718 13:88094368-88094390 TCTTAAAAAATCTGAGAAGTAGG + Intergenic
1114786568 14:25606760-25606782 TCACAACCAATCTATGAAGAAGG + Intergenic
1115308168 14:31952981-31953003 TAGCAATAACTCTGTGAAGTAGG + Intergenic
1116103503 14:40470400-40470422 TGGTATTCAATCTGTGAAGTGGG + Intergenic
1118272531 14:64356848-64356870 TTGCAACCACTCTGTGAGGTGGG + Intergenic
1118321873 14:64758064-64758086 CTGCAAACCACCTGTGAAGTAGG - Intronic
1118460265 14:65980831-65980853 TCTCAAACAATCTGTGATGATGG + Intronic
1119190406 14:72678070-72678092 TTGCAAAAACTTTGTGAAGTAGG + Intronic
1120060869 14:79980430-79980452 TCTCAAACAACCTGTGATGAAGG - Intergenic
1121486966 14:94323783-94323805 TCACAATGACTCTGTGAAGTGGG + Intergenic
1126451007 15:48809682-48809704 TCAGAATCAATCTTTGAAGTAGG - Intronic
1128903766 15:71449498-71449520 TCACAATGACTCTGTGAAGTAGG - Intronic
1129151656 15:73692482-73692504 TCCCAACAATTCTGTGAAGTAGG - Intronic
1130125233 15:81088382-81088404 TAGCAAACAAGCAGTGAGGTAGG - Intronic
1130149223 15:81298646-81298668 TAGAAAGGAATCTGTGAAGTAGG - Intronic
1133853000 16:9523818-9523840 TCACAAAAACTCTGTGAAGTGGG - Intergenic
1135142471 16:19933469-19933491 CCTCAAACAATCTCAGAAGTAGG + Intergenic
1137481206 16:48853210-48853232 TGGCAAACAATCCGTCAAGCAGG + Intergenic
1137821760 16:51452772-51452794 TCTCAAACAATGGCTGAAGTTGG + Intergenic
1138126339 16:54442054-54442076 TTGCAATGACTCTGTGAAGTAGG + Intergenic
1140064801 16:71601951-71601973 TCTCAAAAACTCTGTGAAATAGG - Intergenic
1143029019 17:3957189-3957211 CCGCAAACAAGCTGGGAAGGAGG + Intronic
1144321298 17:14122923-14122945 TCTCAAACCATTTCTGAAGTGGG - Intronic
1145364297 17:22243083-22243105 ACACAAGCTATCTGTGAAGTAGG - Intergenic
1146632028 17:34477068-34477090 TCCCAACAAGTCTGTGAAGTAGG + Intergenic
1148787927 17:50154688-50154710 TCACAAAAACTCTATGAAGTTGG - Intergenic
1149028779 17:52061215-52061237 TCACAAACATTCTGAAAAGTGGG + Intronic
1151592779 17:75057390-75057412 TCACAAAAGATCTGTGATGTTGG - Intronic
1156949381 18:42875362-42875384 TCACAAAAATTCTATGAAGTAGG - Intronic
1157549026 18:48568068-48568090 TCACAAAGAATCTATGAAATAGG - Intronic
1158877167 18:61744598-61744620 TCTTAAACCTTCTGTGAAGTTGG - Intergenic
1162196141 19:8986211-8986233 TGCAAAACAATCTGTGAAGATGG - Intergenic
1167849856 19:52193100-52193122 TCACAATCACTCTTTGAAGTAGG + Intronic
930343194 2:50143872-50143894 TAGCATACATTCTGTGGAGTTGG - Intronic
930410561 2:51020622-51020644 TCGCAAACAATCTGTGAAGTAGG + Intronic
930714767 2:54582920-54582942 TCACAACTACTCTGTGAAGTAGG - Intronic
933619088 2:84516326-84516348 TCTCCAACAATCAGCGAAGTAGG + Intergenic
937144028 2:119627059-119627081 TGGCAAACAAACTGTGGATTGGG - Intronic
939147420 2:138432711-138432733 TTGCAACTACTCTGTGAAGTAGG - Intergenic
941689369 2:168483181-168483203 TCACATAAAGTCTGTGAAGTAGG + Intronic
942301811 2:174570261-174570283 TAGCAAACAATATATGTAGTGGG + Intronic
944899751 2:204202114-204202136 TCACAAACACTTTGGGAAGTAGG + Intergenic
945579250 2:211572346-211572368 ACGCTAACAATCTGTGACATTGG + Intronic
946042118 2:216791579-216791601 ACTCAAAAACTCTGTGAAGTAGG + Intergenic
946046097 2:216822344-216822366 TGTCAAACAACCTGTGAAGAAGG + Intergenic
1169627923 20:7593728-7593750 TCATAAACAATCTGCGAATTTGG + Intergenic
1170280695 20:14644344-14644366 TAGCAAACAAGCTTTGAAATGGG - Intronic
1172014702 20:31866349-31866371 TCCCAACCACTCAGTGAAGTGGG + Intronic
1173360991 20:42344259-42344281 TTCAAAACAATCTGTGATGTAGG + Intronic
1176990634 21:15491908-15491930 TCACGACAAATCTGTGAAGTAGG + Intergenic
1183874605 22:40768408-40768430 TCTCAAACATCCTCTGAAGTGGG + Intergenic
953728269 3:45420285-45420307 TTGCAAACAAATTGTGAACTGGG + Intronic
956571457 3:70700955-70700977 TCTCAAATTGTCTGTGAAGTAGG + Intergenic
958027462 3:88065704-88065726 TAATAAACAATCTGTGAGGTAGG - Intronic
960496543 3:118382518-118382540 TCACAGACTATCTGTGAAGAGGG - Intergenic
961243443 3:125431931-125431953 CTCCTAACAATCTGTGAAGTAGG - Intergenic
965842380 3:172921774-172921796 TCACAACAACTCTGTGAAGTGGG + Intronic
967923388 3:194629271-194629293 TTCTAAACCATCTGTGAAGTGGG + Intronic
970650030 4:18167536-18167558 TCTGAGACCATCTGTGAAGTGGG + Intergenic
970884057 4:20966890-20966912 TCAGAAGCACTCTGTGAAGTTGG + Intronic
974222800 4:58997969-58997991 TGGTATTCAATCTGTGAAGTGGG + Intergenic
975320277 4:73002428-73002450 TCTGAAACTATCTATGAAGTTGG + Intergenic
979694147 4:123592815-123592837 TGGCAAACACTCTTTGCAGTGGG - Intergenic
979939472 4:126742066-126742088 TCACAAACAGTTTGTGGAGTTGG - Intergenic
980192308 4:129540758-129540780 TGGTAAACAAACTGTGAAGATGG + Intergenic
981044270 4:140251980-140252002 TCACAAAAAACCTGTGTAGTAGG + Intergenic
981427054 4:144615786-144615808 TGGCAACCAATCTGTGAAACTGG + Intergenic
981960136 4:150527596-150527618 AGGCAAACAATCTGAGAGGTTGG + Intronic
982431738 4:155330396-155330418 TCCCAAACATCCTATGAAGTAGG - Intergenic
983194835 4:164795651-164795673 TCCCAACAACTCTGTGAAGTAGG - Intergenic
984512790 4:180699073-180699095 TGGTAATCAATCTGTTAAGTGGG + Intergenic
984714292 4:182912566-182912588 TAAAAAACAATCGGTGAAGTTGG + Intronic
984894301 4:184523186-184523208 TCTCTAACAATCAGTGATGTTGG + Intergenic
988701664 5:33681242-33681264 TTTAAAACAATCTGTGGAGTGGG - Intronic
989091737 5:37741098-37741120 TCTCAAACCATCTGTGATGGAGG - Intronic
989165706 5:38431816-38431838 TCACAACAACTCTGTGAAGTAGG - Intronic
994267093 5:97730398-97730420 TAGAAAACACTCTGGGAAGTGGG + Intergenic
996289726 5:121838133-121838155 TCACAAACATGCTGTGCAGTAGG - Intergenic
997765908 5:136502906-136502928 TCACAATAACTCTGTGAAGTTGG - Intergenic
1000675666 5:164119898-164119920 TGGGAATCAATCTGTGAGGTGGG - Intergenic
1001431646 5:171667232-171667254 TCACAAGCACCCTGTGAAGTAGG - Intergenic
1002985308 6:2184621-2184643 TCCCAAACTATCTGTGATGAAGG + Intronic
1003933880 6:10955748-10955770 TCACAAAAATTGTGTGAAGTAGG - Intronic
1008029107 6:46673264-46673286 TCCCCAACAATCTGTGCAGCAGG + Intronic
1008802398 6:55385476-55385498 TTACAAGCAATATGTGAAGTAGG + Intronic
1012798777 6:103798326-103798348 TAGCAAACAATCTGTTTTGTTGG - Intergenic
1013550758 6:111205583-111205605 TCGCAACCAATTTCTGAAGTAGG + Intronic
1015436234 6:133192459-133192481 TCACAAACACTCTGTGAGCTGGG - Intergenic
1016331476 6:142956958-142956980 TCTCAAAAATTCTGTGAGGTAGG - Intergenic
1020444968 7:8259391-8259413 TGGAAAACACTCTCTGAAGTTGG - Intronic
1022039022 7:26562419-26562441 TCACAACAAACCTGTGAAGTAGG + Intergenic
1022853791 7:34295623-34295645 TTTTAAAAAATCTGTGAAGTGGG + Intergenic
1026761250 7:73127533-73127555 TGGGCAACAATCTGTGAAGAAGG + Intergenic
1027085971 7:75265121-75265143 TGGGCAACAATCTGTGAAGAAGG - Intergenic
1033351032 7:140562210-140562232 TTGCAGACAATTTCTGAAGTTGG + Intronic
1036508227 8:9375976-9375998 TAGCAAACAAGCTGTCAAGTTGG - Intergenic
1041988938 8:63961425-63961447 TCACAACCACTCTATGAAGTAGG - Intergenic
1043221408 8:77670506-77670528 TCGCTAATAATCAGTGATGTTGG - Intergenic
1044387448 8:91606296-91606318 TCGTAACAACTCTGTGAAGTAGG + Intergenic
1048163371 8:132040662-132040684 TCACAACTAATCTCTGAAGTAGG + Intronic
1050430534 9:5557430-5557452 TCGCAACCACTCTGTGAAGTTGG - Intronic
1050445784 9:5721408-5721430 TGGTAATCAATCTGTGAAGTGGG - Intronic
1051956784 9:22704856-22704878 CCACAGACACTCTGTGAAGTTGG - Intergenic
1056207231 9:84331925-84331947 TGGCAAAATATCTGTGGAGTGGG + Intronic
1058762881 9:108152545-108152567 TCTCAAACAATCTCTGAAAGTGG + Intergenic
1060068787 9:120528556-120528578 TTGCAATAACTCTGTGAAGTAGG - Intronic
1061254865 9:129449047-129449069 TCCCAAACTATCTGTGATGAAGG + Intergenic
1061260778 9:129479864-129479886 TCGCAAAAGCTCTGAGAAGTAGG - Intergenic
1203544638 Un_KI270743v1:120227-120249 TCGCCTACAATGTGTGAACTCGG + Intergenic
1186924327 X:14315762-14315784 TCCTAAAGACTCTGTGAAGTAGG - Intergenic
1188530830 X:31139029-31139051 AGGCAATGAATCTGTGAAGTAGG - Intronic
1192605108 X:72508350-72508372 TCACAAAAACCCTGTGAAGTAGG + Intronic
1195588775 X:106599677-106599699 TATCAAACACTCTGTGAATTGGG + Intergenic
1196145398 X:112311278-112311300 TCCCCAACAAACTGTGAAATTGG - Intergenic
1201413862 Y:13728269-13728291 AGGCAAACCATCTGTGAATTAGG - Intergenic