ID: 930411096

View in Genome Browser
Species Human (GRCh38)
Location 2:51027606-51027628
Sequence CCCTCCTCGCCCGCCTCGCA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 157}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930411085_930411096 21 Left 930411085 2:51027562-51027584 CCACCACGGAGCACACACCTCCG 0: 1
1: 0
2: 0
3: 14
4: 153
Right 930411096 2:51027606-51027628 CCCTCCTCGCCCGCCTCGCACGG 0: 1
1: 0
2: 1
3: 13
4: 157
930411086_930411096 18 Left 930411086 2:51027565-51027587 CCACGGAGCACACACCTCCGTTG 0: 1
1: 0
2: 0
3: 4
4: 52
Right 930411096 2:51027606-51027628 CCCTCCTCGCCCGCCTCGCACGG 0: 1
1: 0
2: 1
3: 13
4: 157
930411084_930411096 30 Left 930411084 2:51027553-51027575 CCTGGTCGTCCACCACGGAGCAC 0: 1
1: 0
2: 0
3: 3
4: 42
Right 930411096 2:51027606-51027628 CCCTCCTCGCCCGCCTCGCACGG 0: 1
1: 0
2: 1
3: 13
4: 157
930411088_930411096 4 Left 930411088 2:51027579-51027601 CCTCCGTTGAGGCACACCCCGCC 0: 1
1: 0
2: 0
3: 5
4: 48
Right 930411096 2:51027606-51027628 CCCTCCTCGCCCGCCTCGCACGG 0: 1
1: 0
2: 1
3: 13
4: 157
930411089_930411096 1 Left 930411089 2:51027582-51027604 CCGTTGAGGCACACCCCGCCCTC 0: 1
1: 0
2: 0
3: 8
4: 113
Right 930411096 2:51027606-51027628 CCCTCCTCGCCCGCCTCGCACGG 0: 1
1: 0
2: 1
3: 13
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930411096 Original CRISPR CCCTCCTCGCCCGCCTCGCA CGG Exonic