ID: 930411323

View in Genome Browser
Species Human (GRCh38)
Location 2:51028875-51028897
Sequence GCTATCCTCGGGTTAAGAAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 41}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930411323_930411328 9 Left 930411323 2:51028875-51028897 CCATTTCTTAACCCGAGGATAGC 0: 1
1: 0
2: 0
3: 3
4: 41
Right 930411328 2:51028907-51028929 CTGCTTCTTCTGTCATAGCATGG 0: 1
1: 0
2: 1
3: 12
4: 210
930411323_930411329 10 Left 930411323 2:51028875-51028897 CCATTTCTTAACCCGAGGATAGC 0: 1
1: 0
2: 0
3: 3
4: 41
Right 930411329 2:51028908-51028930 TGCTTCTTCTGTCATAGCATGGG 0: 1
1: 1
2: 1
3: 15
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930411323 Original CRISPR GCTATCCTCGGGTTAAGAAA TGG (reversed) Exonic
901431740 1:9219741-9219763 GCCATCCTAGGGGTATGAAATGG + Intergenic
906422515 1:45682430-45682452 GCTGACCTCTGGTTAACAAAAGG + Intronic
909923607 1:81412121-81412143 ACTATCCCCGGTTGAAGAAAGGG + Intronic
916869615 1:168898869-168898891 GCTATCTTCAAGTTAAGGAAAGG - Intergenic
917545150 1:175958556-175958578 GTTATCTTCTGGTTAATAAAAGG - Intronic
1065999904 10:31094817-31094839 GCTACCCTCTGGGAAAGAAATGG - Intergenic
1097673574 12:62571044-62571066 CATAACATCGGGTTAAGAAAAGG + Intronic
1097710259 12:62909997-62910019 TTTATCCTGGGGTTCAGAAATGG + Intronic
1104252325 12:127107295-127107317 GCTGTCCACAGGTTAAGAAGGGG + Intergenic
1109589342 13:64457428-64457450 GCTATCTTAGGGTTATCAAAGGG + Intergenic
1111957595 13:94775621-94775643 GCTGTCTTCAGGTTAAGAAAAGG - Intergenic
1130130685 15:81139425-81139447 GCTAATCTCTGGTTAAGAAATGG - Intronic
1141090462 16:81126840-81126862 GGTCTCCTGGGGTTAAGGAAAGG - Intergenic
1142832350 17:2558584-2558606 GATATCCTGGGGTTGAGAGATGG - Intergenic
1144189665 17:12832958-12832980 GCTATCGTCGGGGAAGGAAAAGG - Intronic
1148101259 17:45093237-45093259 GCCATCATCTGGTTCAGAAATGG + Intronic
1162962371 19:14135909-14135931 GATCTCCGTGGGTTAAGAAATGG + Intronic
928913795 2:36449793-36449815 GCTCGCCTAGGGATAAGAAAAGG + Intronic
929266893 2:39928500-39928522 GCTTTCCTCTGATTAAAAAAGGG - Intergenic
930411323 2:51028875-51028897 GCTATCCTCGGGTTAAGAAATGG - Exonic
940787404 2:157996707-157996729 GCAATCCTAGGATTTAGAAAAGG - Intronic
943551292 2:189343669-189343691 GATATTCTCAGGTTATGAAATGG - Intergenic
944199309 2:197089022-197089044 TCTATCCTGGGATTAAAAAATGG - Intronic
1169596135 20:7201395-7201417 ACTATCCTCAGGGTAAAAAAGGG - Intergenic
1172064510 20:32209522-32209544 GCCATGCTGGGATTAAGAAAAGG + Intronic
950155568 3:10719101-10719123 GCTGACCTTGGGCTAAGAAAAGG - Intergenic
951660050 3:25053354-25053376 GCTTTCCTAGGGGTAAGAATTGG + Intergenic
953183516 3:40618039-40618061 GCTATCCTATGGTTAAAATAGGG - Intergenic
959926764 3:111930561-111930583 GTTGTCCTCTGGCTAAGAAAAGG - Intronic
965165958 3:165194852-165194874 GCTATCCTGAGCTAAAGAAAAGG - Intronic
973188796 4:47363490-47363512 GCTATCCCAGGGTTAAAAAGAGG + Intronic
981330135 4:143498748-143498770 TCTATCCTCAGGTGAAGGAAGGG + Intergenic
1002289589 5:178190648-178190670 GAAATGCTTGGGTTAAGAAAGGG + Intergenic
1015363719 6:132372992-132373014 GCTATCCTGGGGATCAGACATGG + Exonic
1020529654 7:9316847-9316869 GCTATCCTGGTTTTAAAAAATGG - Intergenic
1027329035 7:77071885-77071907 GATATCCTCAGCTGAAGAAAAGG + Intergenic
1027914480 7:84298329-84298351 CCTTTCCTGGGGTTAAGAATGGG - Intronic
1027998147 7:85453389-85453411 GCTATCCACTGGTTAACCAATGG - Intergenic
1029215607 7:98947085-98947107 GCGATCCTCGGGGTAAGAAGGGG - Intronic
1029786734 7:102799482-102799504 GATATCCTCAGCTGAAGAAAAGG - Intronic
1034211171 7:149364602-149364624 CCTATCCTAGGGCTGAGAAAGGG + Intergenic
1038516916 8:28195199-28195221 GCTGCCCTCTGGATAAGAAAGGG - Intergenic
1044384108 8:91567031-91567053 GCTACCATGGGGGTAAGAAATGG + Intergenic
1046299034 8:112261425-112261447 GCTACCCTGGGCCTAAGAAAAGG - Intronic
1197461542 X:126748900-126748922 GCTATCCTCTGGTTAAAGAGAGG - Intergenic