ID: 930414514

View in Genome Browser
Species Human (GRCh38)
Location 2:51074477-51074499
Sequence ATCTGTACACAGATGAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930414514_930414515 -5 Left 930414514 2:51074477-51074499 CCTTTTTTCATCTGTGTACAGAT No data
Right 930414515 2:51074495-51074517 CAGATGCTTCTCTATTGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930414514 Original CRISPR ATCTGTACACAGATGAAAAA AGG (reversed) Intergenic
No off target data available for this crispr