ID: 930418605

View in Genome Browser
Species Human (GRCh38)
Location 2:51121002-51121024
Sequence GACATCTTTTGGCCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930418599_930418605 15 Left 930418599 2:51120964-51120986 CCTACCATCTTCTACTTATAACC No data
Right 930418605 2:51121002-51121024 GACATCTTTTGGCCTGTTACTGG No data
930418602_930418605 -6 Left 930418602 2:51120985-51121007 CCACTCTCCTATTGGTAGACATC No data
Right 930418605 2:51121002-51121024 GACATCTTTTGGCCTGTTACTGG No data
930418598_930418605 16 Left 930418598 2:51120963-51120985 CCCTACCATCTTCTACTTATAAC No data
Right 930418605 2:51121002-51121024 GACATCTTTTGGCCTGTTACTGG No data
930418600_930418605 11 Left 930418600 2:51120968-51120990 CCATCTTCTACTTATAACCACTC No data
Right 930418605 2:51121002-51121024 GACATCTTTTGGCCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930418605 Original CRISPR GACATCTTTTGGCCTGTTAC TGG Intergenic
No off target data available for this crispr