ID: 930419883

View in Genome Browser
Species Human (GRCh38)
Location 2:51137102-51137124
Sequence GTAGTTTCTCTACTAAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930419881_930419883 20 Left 930419881 2:51137059-51137081 CCTTCCAAAATTTTTGTCAGATT No data
Right 930419883 2:51137102-51137124 GTAGTTTCTCTACTAAACACTGG No data
930419882_930419883 16 Left 930419882 2:51137063-51137085 CCAAAATTTTTGTCAGATTTCTT No data
Right 930419883 2:51137102-51137124 GTAGTTTCTCTACTAAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930419883 Original CRISPR GTAGTTTCTCTACTAAACAC TGG Intergenic
No off target data available for this crispr