ID: 930420177

View in Genome Browser
Species Human (GRCh38)
Location 2:51141397-51141419
Sequence CACTTTCCATTTAATCTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930420177_930420180 22 Left 930420177 2:51141397-51141419 CCCTGGAGATTAAATGGAAAGTG No data
Right 930420180 2:51141442-51141464 GAAGCAGCAAGAACTGGAACAGG No data
930420177_930420179 16 Left 930420177 2:51141397-51141419 CCCTGGAGATTAAATGGAAAGTG No data
Right 930420179 2:51141436-51141458 TCAAAAGAAGCAGCAAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930420177 Original CRISPR CACTTTCCATTTAATCTCCA GGG (reversed) Intergenic
No off target data available for this crispr