ID: 930424174

View in Genome Browser
Species Human (GRCh38)
Location 2:51192799-51192821
Sequence TGTCTACAACCTAGCAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930424174_930424178 17 Left 930424174 2:51192799-51192821 CCTGTCTTGCTAGGTTGTAGACA No data
Right 930424178 2:51192839-51192861 CTGAAATATATTTTCGTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930424174 Original CRISPR TGTCTACAACCTAGCAAGAC AGG (reversed) Intergenic