ID: 930424176

View in Genome Browser
Species Human (GRCh38)
Location 2:51192826-51192848
Sequence TATATTTCAGGATGTCATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930424176_930424178 -10 Left 930424176 2:51192826-51192848 CCTGGATGACATCCTGAAATATA No data
Right 930424178 2:51192839-51192861 CTGAAATATATTTTCGTACTTGG No data
930424176_930424180 24 Left 930424176 2:51192826-51192848 CCTGGATGACATCCTGAAATATA No data
Right 930424180 2:51192873-51192895 TTGTATCTTTCAGTTACCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930424176 Original CRISPR TATATTTCAGGATGTCATCC AGG (reversed) Intergenic