ID: 930424178 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:51192839-51192861 |
Sequence | CTGAAATATATTTTCGTACT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
930424176_930424178 | -10 | Left | 930424176 | 2:51192826-51192848 | CCTGGATGACATCCTGAAATATA | No data | ||
Right | 930424178 | 2:51192839-51192861 | CTGAAATATATTTTCGTACTTGG | No data | ||||
930424174_930424178 | 17 | Left | 930424174 | 2:51192799-51192821 | CCTGTCTTGCTAGGTTGTAGACA | No data | ||
Right | 930424178 | 2:51192839-51192861 | CTGAAATATATTTTCGTACTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
930424178 | Original CRISPR | CTGAAATATATTTTCGTACT TGG | Intergenic | ||