ID: 930426017

View in Genome Browser
Species Human (GRCh38)
Location 2:51213601-51213623
Sequence GTGCCATCAACATTAACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930426017_930426022 29 Left 930426017 2:51213601-51213623 CCCTGGGTTAATGTTGATGGCAC No data
Right 930426022 2:51213653-51213675 TGAAATAACCAAGTCCTTTTGGG No data
930426017_930426019 4 Left 930426017 2:51213601-51213623 CCCTGGGTTAATGTTGATGGCAC No data
Right 930426019 2:51213628-51213650 CTAAGTGCAGCCTTAAATGATGG No data
930426017_930426021 28 Left 930426017 2:51213601-51213623 CCCTGGGTTAATGTTGATGGCAC No data
Right 930426021 2:51213652-51213674 GTGAAATAACCAAGTCCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930426017 Original CRISPR GTGCCATCAACATTAACCCA GGG (reversed) Intergenic
No off target data available for this crispr