ID: 930428799

View in Genome Browser
Species Human (GRCh38)
Location 2:51247430-51247452
Sequence TAGATGGCGATGAAAGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930428799_930428805 4 Left 930428799 2:51247430-51247452 CCCTGCCCTTTCATCGCCATCTA No data
Right 930428805 2:51247457-51247479 AAGACAAAACCTCGTCTCCCTGG No data
930428799_930428809 25 Left 930428799 2:51247430-51247452 CCCTGCCCTTTCATCGCCATCTA No data
Right 930428809 2:51247478-51247500 GGTTACGAGAAGAAAGTCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930428799 Original CRISPR TAGATGGCGATGAAAGGGCA GGG (reversed) Intergenic
No off target data available for this crispr