ID: 930428800

View in Genome Browser
Species Human (GRCh38)
Location 2:51247431-51247453
Sequence CTAGATGGCGATGAAAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930428800_930428805 3 Left 930428800 2:51247431-51247453 CCTGCCCTTTCATCGCCATCTAG No data
Right 930428805 2:51247457-51247479 AAGACAAAACCTCGTCTCCCTGG No data
930428800_930428809 24 Left 930428800 2:51247431-51247453 CCTGCCCTTTCATCGCCATCTAG No data
Right 930428809 2:51247478-51247500 GGTTACGAGAAGAAAGTCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930428800 Original CRISPR CTAGATGGCGATGAAAGGGC AGG (reversed) Intergenic
No off target data available for this crispr