ID: 930428802

View in Genome Browser
Species Human (GRCh38)
Location 2:51247435-51247457
Sequence TCCTCTAGATGGCGATGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930428802_930428809 20 Left 930428802 2:51247435-51247457 CCCTTTCATCGCCATCTAGAGGA No data
Right 930428809 2:51247478-51247500 GGTTACGAGAAGAAAGTCCTCGG No data
930428802_930428805 -1 Left 930428802 2:51247435-51247457 CCCTTTCATCGCCATCTAGAGGA No data
Right 930428805 2:51247457-51247479 AAGACAAAACCTCGTCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930428802 Original CRISPR TCCTCTAGATGGCGATGAAA GGG (reversed) Intergenic
No off target data available for this crispr