ID: 930428803

View in Genome Browser
Species Human (GRCh38)
Location 2:51247436-51247458
Sequence TTCCTCTAGATGGCGATGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930428803_930428810 30 Left 930428803 2:51247436-51247458 CCTTTCATCGCCATCTAGAGGAA No data
Right 930428810 2:51247489-51247511 GAAAGTCCTCGGCTTCATTGTGG No data
930428803_930428805 -2 Left 930428803 2:51247436-51247458 CCTTTCATCGCCATCTAGAGGAA No data
Right 930428805 2:51247457-51247479 AAGACAAAACCTCGTCTCCCTGG No data
930428803_930428809 19 Left 930428803 2:51247436-51247458 CCTTTCATCGCCATCTAGAGGAA No data
Right 930428809 2:51247478-51247500 GGTTACGAGAAGAAAGTCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930428803 Original CRISPR TTCCTCTAGATGGCGATGAA AGG (reversed) Intergenic
No off target data available for this crispr