ID: 930428809

View in Genome Browser
Species Human (GRCh38)
Location 2:51247478-51247500
Sequence GGTTACGAGAAGAAAGTCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930428797_930428809 27 Left 930428797 2:51247428-51247450 CCCCCTGCCCTTTCATCGCCATC No data
Right 930428809 2:51247478-51247500 GGTTACGAGAAGAAAGTCCTCGG No data
930428802_930428809 20 Left 930428802 2:51247435-51247457 CCCTTTCATCGCCATCTAGAGGA No data
Right 930428809 2:51247478-51247500 GGTTACGAGAAGAAAGTCCTCGG No data
930428800_930428809 24 Left 930428800 2:51247431-51247453 CCTGCCCTTTCATCGCCATCTAG No data
Right 930428809 2:51247478-51247500 GGTTACGAGAAGAAAGTCCTCGG No data
930428799_930428809 25 Left 930428799 2:51247430-51247452 CCCTGCCCTTTCATCGCCATCTA No data
Right 930428809 2:51247478-51247500 GGTTACGAGAAGAAAGTCCTCGG No data
930428798_930428809 26 Left 930428798 2:51247429-51247451 CCCCTGCCCTTTCATCGCCATCT No data
Right 930428809 2:51247478-51247500 GGTTACGAGAAGAAAGTCCTCGG No data
930428804_930428809 9 Left 930428804 2:51247446-51247468 CCATCTAGAGGAAGACAAAACCT No data
Right 930428809 2:51247478-51247500 GGTTACGAGAAGAAAGTCCTCGG No data
930428803_930428809 19 Left 930428803 2:51247436-51247458 CCTTTCATCGCCATCTAGAGGAA No data
Right 930428809 2:51247478-51247500 GGTTACGAGAAGAAAGTCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930428809 Original CRISPR GGTTACGAGAAGAAAGTCCT CGG Intergenic
No off target data available for this crispr