ID: 930428810

View in Genome Browser
Species Human (GRCh38)
Location 2:51247489-51247511
Sequence GAAAGTCCTCGGCTTCATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
930428806_930428810 0 Left 930428806 2:51247466-51247488 CCTCGTCTCCCTGGTTACGAGAA No data
Right 930428810 2:51247489-51247511 GAAAGTCCTCGGCTTCATTGTGG No data
930428804_930428810 20 Left 930428804 2:51247446-51247468 CCATCTAGAGGAAGACAAAACCT No data
Right 930428810 2:51247489-51247511 GAAAGTCCTCGGCTTCATTGTGG No data
930428803_930428810 30 Left 930428803 2:51247436-51247458 CCTTTCATCGCCATCTAGAGGAA No data
Right 930428810 2:51247489-51247511 GAAAGTCCTCGGCTTCATTGTGG No data
930428808_930428810 -9 Left 930428808 2:51247475-51247497 CCTGGTTACGAGAAGAAAGTCCT No data
Right 930428810 2:51247489-51247511 GAAAGTCCTCGGCTTCATTGTGG No data
930428807_930428810 -8 Left 930428807 2:51247474-51247496 CCCTGGTTACGAGAAGAAAGTCC No data
Right 930428810 2:51247489-51247511 GAAAGTCCTCGGCTTCATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
930428810 Original CRISPR GAAAGTCCTCGGCTTCATTG TGG Intergenic
No off target data available for this crispr